* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Sequencing genomes
Molecular cloning wikipedia , lookup
DNA barcoding wikipedia , lookup
Neocentromere wikipedia , lookup
Gene desert wikipedia , lookup
Genetic engineering wikipedia , lookup
Primary transcript wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Epigenomics wikipedia , lookup
Human genetic variation wikipedia , lookup
Copy-number variation wikipedia , lookup
Segmental Duplication on the Human Y Chromosome wikipedia , lookup
Public health genomics wikipedia , lookup
Oncogenomics wikipedia , lookup
DNA sequencing wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Genome (book) wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Designer baby wikipedia , lookup
Point mutation wikipedia , lookup
Microevolution wikipedia , lookup
Transposable element wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
History of genetic engineering wikipedia , lookup
Smith–Waterman algorithm wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Minimal genome wikipedia , lookup
Sequence alignment wikipedia , lookup
Multiple sequence alignment wikipedia , lookup
Pathogenomics wikipedia , lookup
Microsatellite wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Whole genome sequencing wikipedia , lookup
Non-coding DNA wikipedia , lookup
Genomic library wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Human genome wikipedia , lookup
Human Genome Project wikipedia , lookup
Metagenomics wikipedia , lookup
Helitron (biology) wikipedia , lookup
Genome editing wikipedia , lookup
Last lecture summary Sequencing strategies • Hierarchical genome shotgun HGS – Human Genome Project • “map first, sequence second” • clone-by-clone … cloning is performed twice (BAC, plasmid) Sequencing strategies • Whole genome shotgun WGS – Celera • shotgun, no mapping • Coverage - the average number of reads representing a given nucleotide in the reconstructed sequence. HGS: 8, WGS: 20 Human genome • 3 billions bps, ~20 000 – 25 000 genes • Only 1.1 – 1.4 % of the genome sequence codes for proteins. • State of completion: • best estimate – 92.3% is complete • problematic unfinished regions: centromeres, telomeres (both contain highly repetitive sequences), some unclosed gaps • It is likely that the centromeres and telomeres will remain unsequenced until new technology is developed • Genome is stored in databases • Primary database – Genebank (http://www.ncbi.nlm.nih.gov/sites/entrez?db=nucleotide) • Additional data and annotation, tools for visualizing and searching • UCSCS (http://genome.ucsc.edu) • Ensembl (http://www.ensembl.org) New stuff Personal human genomes • Personal genomes had not been sequenced in the Human Genome Project to protect the identity of volunteers who provided DNA samples. • Following personal genomes were available by July 2011: • Japanese male (2010, PMID: 20972442) • Korean male (2009, PMID: 19470904) • Chinese male (2008, PMID: 18987735) • Nigerian male (2008, PMID: 18987734) • J. D. Watson (2008, PMID: 18421352) • J. C. Venter (2007, PMID: 17803354) • HGP sequence is haploid, however, the sequence maps of Venter and Watson are diploid. Next generation sequencing (NGS) • The completion of human genome was just a start of modern DNA sequencing era – “high-throughput next generation sequencing” (NGS). • New approaches, reduce time and cost. • Holly Grail of sequencing – complete human genome below $ 1000. 1st and 2nd generation of sequencers • 1st generation – ABI Prism 3700 (Sanger, fluorescence, 96 capillaries), used in HGP and in Celera • Sanger method overcomes NGS by the read length (600 bps) • 2nd generation - birth of HT-NGS in 2005. 454 Life Sciences developed GS 20 sequencer. Combines PCR with pyrosequencing. • Pyrosequencing – sequencing-by-synthesis • Relies on detection of pyrophosphate release on nucleotide incorporation rather than chain termination with ddNTs. • The release of pyrophosphate is detected by flash of light (chemiluminiscence). • Average read length: 400 bp • Roche GS-FLX 454 (successor of GS 20) used for J. Watson’s genome sequencing. 3rd generation • 2nd generation still uses PCR amplification which may introduce base sequence errors or favor certain sequences over others. • To overcome this, emerging 3rd generation of seqeuencers performs the single molecule sequencing (i.e. sequence is determined directly from one DNA molecule, no amplification or cloning). • Compared to 2nd generation these instruments offer higher throughput, longer reads (~1000 bps), higher accuracy, small amount of starting material, lower cost Moore’s law source: http://www.genome.gov/27541954 transition to 2nd generation 5,000$ 4,905 $ 0.054$ Illumina HiSeq X Ten • 14. 1. 2014 Illumina anounced the new HiSeq X Ten Sequencing System. • Illumina claims they are enabling the $1,000 genome. • Uses Illumina SBS technology (sequencing-by-synthesis). • It sells for at least $10 million. Human Longevity • 4. 3. 2014 – Human Longevity was founded by Craig • • • • Venter Its main aim: to slow down the process of ageing The largest human DNA sequencing operation in the world, capable of processing 40,000 human genomes a year. DNA data will be combined with other data on the health and body composition of the people whose DNA is sequenced, in the hope of gleaning insights into the molecular causes of aging and age-related illnesses like cancer and heart disease. Equipment: 2x Illumina Hiseq X Ten Which genomes were sequenced? • http://www.ncbi.nlm.nih.gov/sites/genome • GOLD – Genomes online database (http://www.genomesonline.org/) • information regarding complete and ongoing genome projects Important genomics projects • The analysis of personal genomes has demonstrated, how difficult is to draw medically or biologically relevant conclusions from individual sequences. • More genomes need to be sequenced to learn how genotype correlates with phenotype. • 1000 Genomes project (http://www.1000genomes.org/) started in 2009. Sequence the genomes of at least a 1000 people from around the world to create the detailed and medically useful picture of human genetic variation. • 2nd generation of sequencers is used in 1000 Genomes. • 10 000 Genomes will start soon. Important genomics projects • ENCODE project (ENCyclopedia Of DNA Elements, http://www.genome.gov/ENCODE/) • by NHGRI • identify all functional elements in the human genome sequence • Defined regions of the human genome corresponding to 30Mb (1%) have been selected. • These regions serve as the foundation on which to test and evaluate the effectiveness and efficiency of a diverse set of methods and technologies for finding various functional elements in human DNA. Sequence Alignment What is sequence alignment ? CTTTTCAAGGCTTA GGCTTATTATTGC Fragment overlaps CTTTTCAAGGCTTA GGCTATTATTGC CTTTTCAAGGCTTA GGCT-ATTATTGC What is sequence alignment ? CCCCATGGTGGCGGCAGGTGACAG CATGGGGGAGGATGGGGACAGTCCGG TTACCCCATGGTGGCGGCTTGGGAAACTT TGGCGGCTCGGGACAGTCGCGCATAAT CCATGGTGGTGGCTGGGGATAGTA TGAGGCAGTCGCGCATAATTCCG CCCCATGGTGGCGGCAGGTGACAG CATGGGGGAGGATGGGGACAGTCCGG TTACCCCATGGTGGCGGCTTGGGAAACTT TGGCGGCTCGGGACAGTCGCGCATAAT CCATGGTGGTGGCTGGGGATAGTA TGAGGCAGTCGCGCATAATTCCG TTACCCCATGGTGGCGGCTGGGGACAGTCGCGCATAATTCCG consensus Sequence alphabet side chain charge at physiological pH 7.4 Positively charged side chains Negatively charged side chains Polar uncharged side chains Special Hydrophobic side chains Name Arginine Histidine Lysine Aspartic Acid Glutamic Acid Serine Threonine Asparagine Glutamine Cysteine Selenocysteine Glycine Proline\ Alanine Leucine Isoleucine Methionine Phenylalanine Tryptophan Tyrosine Valine 3 letters Arg His Lys Asp Glu Ser Thr Asn Gln Cys Sec Gly Pro Ala Leu Ile Met Phe Trp Tyr Val 1 letter R H K D E S T N Q C U G P A L I M F W Y V Adenine A Thymine T Cytosine G Guanine C Sequence alignment • Procedure of comparing sequences • Point mutations – easy ACGTCTGATACGCCGTATAGTCTATCT ACGTCTGATTCGCCCTATCGTCTATCT gapless alignment • More difficult example ACGTCTGATACGCCGTATAGTCTATCT CTGATTCGCATCGTCTATCT • However, gaps can be inserted to get something like this insertion × deletion indel ACGTCTGATACGCCGTATAGTCTATCT ----CTGATTCGC---ATCGTCTATCT gapped alignment Why align sequences – continuation • The draft human genome is available • Automated gene finding is possible • Gene: AGTACGTATCGTATAGCGTAA • What does it do? • One approach: Is there a similar gene in another species? • Align sequences with known genes • Find the gene with the “best” match Flavors of sequence alignment pair-wise alignment × multiple sequence alignment Flavors of sequence alignment global alignment × local alignment global local align entire sequence stretches of sequence with the highest density of matches are aligned, generating islands of matches or subalignments in the aligned sequences Evolution common ancestors wikipedia.org Evolution of sequences • The sequences are the products of molecular evolution. • When sequences share a common ancestor, they tend to exhibit similarity in their sequences, structures and biological functions. DNA1 DNA2 Protein1 Protein2 Sequence similarity Similar 3D structure Similar function Similar sequences produce similar proteins However, this statement is not a rule. See Gerlt JA, Babbitt PC. Can sequence determine function? Genome Biol. 2000;1(5) PMID: 11178260 Homology • During the time period, the molecular sequences undergo • • • • random changes, some of which are selected during the process of evolution. Selected sequences accumulate mutations, they diverge over time. Two sequences are homologous when they are descended from a common ancestor sequence. Traces of evolution may still remain in certain portions of the sequences to allow identification of the common ancestry. Residues performing key roles are preserved by natural selection, less crucial residues mutate more frequently. Orhology, paralogy I • Orthologs – homologous proteins from different species that possess the same function (e.g. corresponding kinases in signal transduction pathway in humans and mice) • Paralogs – homologous proteins that have different function in the same species (e.g. two kinases in different signal transduction pathways of humans) However, these terms are controversially discussed: Jensen RA. Orthologs and paralogs - we need to get it right. Genome Biol. 2001;2(8), PMID: 11532207 and references therein Orthology, paralogy II • Orthologs – genes separated by the event of speciation • Sequences are direct descendants of a common ancestor. • Most likely have similar domain structure, 3D structure and biological function. • Paralogs – genes separated by the event of genetic duplication • Gene duplication: An extra copy of a gene. Gene duplication is a key mechanism in evolution. Once a gene is duplicated, the identical genes can undergo changes and diverge to create two different genes. http://www.globalchange.umich.edu/globalchange1/current/lectures/speciation/speciation.html Gene duplication 1. Unequal cross-over 2. Entire chromosome is replicated twice • This error will result in one of the daughter cells having an extra copy of the chromosome. If this cell fuses with another cell during reproduction, it may or may not result in a viable zygote. 3. Retrotransposition • Sequences of DNA are copied to RNA and then back to DNA instead of being translated into proteins resulting in extra copies of DNA being present within cell. Unequal cross-over Homologous chromosomes are misaligned during meiosis. The probability of misalignment is a function of the degree of sharing the repetitive elements. • Comparing sequences through alignment – patterns of conservation and variation can be identified. • The degree of sequence conservation in the alignment reveals evolutionary relatedness of different sequences • The variation between sequences reflects the changes that have occurred during evolution in the form of substitutions and/or indels. • Identifying the evolutionary relationships between sequences helps to characterize the function of unknown sequences. • Protein sequence comparison can identify homologous sequences from common ancestor 1 billions year ago (BYA). DNA sequences typically only 600 MYA.