* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download What Do Genes Look Like? - Effingham County Schools
Messenger RNA wikipedia , lookup
RNA silencing wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Molecular cloning wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Transfer RNA wikipedia , lookup
Epigenomics wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
DNA supercoil wikipedia , lookup
Epigenetics of human development wikipedia , lookup
DNA vaccination wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
Genome (book) wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Designer baby wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Genetic engineering wikipedia , lookup
Frameshift mutation wikipedia , lookup
Non-coding DNA wikipedia , lookup
Epitranscriptome wikipedia , lookup
History of RNA biology wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Non-coding RNA wikipedia , lookup
Helitron (biology) wikipedia , lookup
Expanded genetic code wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Primary transcript wikipedia , lookup
History of genetic engineering wikipedia , lookup
Microevolution wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
What do genes look like? I. Genes – segments of DNA that carry hereditary instructions and are passed from parent to offspring; genes are located on chromosomes Chromosome Structure of Eukaryotes Section 12-2 Chromosome Nucleosome DNA double helix Coils Supercoils Histones Go to Section: II. DNA – Hereditary material that controls all the activities of a cell and provides the instructions for making proteins A. B. DNA is made of nucleotides Nucleotides have three parts; 5-carbon sugar, phosphate group and a nitrogen base 1. 2. Nucleotides are identical except for the nitrogen base A nucleotide can contain 1 of 4 Nitrogen Bases – • • • • Adenine Guanine Cytosine Thymine Nucleotide Phosphate Group Nitrogen Base Sugar Can Be: Adenine Guanine Cytosine Thymine 3. The amount of Adenine = Thymine, Cytosine = Guanine (Chargaff’s Rule) III. The Double Helix- 1953, 2 American scientists, Watson and Crick, discovered the structure of DNA using the X-rays made by Rosalind Franklin A. 2 strands wound around each other like a twisted ladder B. Strands are held together by hydrogen bonds between the nitrogen bases C. Adenine bonds to Thymine and Cytosine bonds to Guanine Section 12-1 Structure of DNA Nucleotide Hydrogen bonds Sugar-phosphate backbone Key Adenine (A) Thymine (T) Cytosine (C) Guanine (G) Go to Section: Mealor’s First Love IV. Replication: Before a cell divides, DNA on every chromosome is copied so that each new cell has an identical set of chromosomes DNA Replication IV. Replication: Before a cell divides, DNA on every chromosome is copied so that each new cell has an identical set of chromosomes TAAGTGTACACGTA ATTCACATGTGCAT TAAGTGTACACGTA TAAGTGTACACGTA TCACATCGTAAGTGTACACGTA AGTCCGATCGTAACTGGGTCACATCGTAAGTGTACACGTA AGTCCGATCGTAACTGGG |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| TCAGGCTAGCATTGACCCAGTGTAGCATTCACATGTGCAT TCAGGCTAGCATTGACCC AGTGTAGCATTCACATGTGCAT ATTCACATGTGCAT TAAGTGTACACGTA ATTCACATGTGCAT Make a complimentary strand ATT CGT ACG TTT ACT Make a complimentary strand ATT CGT ACG TTT ACT Make a complimentary strand ATT CGT ACG TTT ACT TAA Make a complimentary strand ATT CGT ACG TTT ACT TAA GCA Make a complimentary strand ATT CGT ACG TTT ACT TAA GCA TGC Make a complimentary strand ATT CGT ACG TTT ACT TAA GCA TGC AAA Make a complimentary strand ATT CGT ACG TTT ACT TAA GCA TGC AAA TGA Making the Traits! I. How DNA works to create our traits – DNA cannot leave the nucleus. A copy of the DNA code is made in the nucleus into RNA. RNA travels to the ribosome where the code is read and the protein is assembled A. The nitrogen bases in every gene make a code B. Every three bases makes one codon C. One codon is the code for one amino acid D. Long chains of amino acids make proteins E. ****Proteins determine an organisms traits and characteristics Making a Protein – Translation Section 12-3 Nucleus Messenger RNA Messenger RNA is transcribed in the nucleus. Phenylalanine tRNA The mRNA then enters the cytoplasm and attaches to a ribosome. Translation begins at AUG, the start codon. Each transfer RNA has an anticodon whose bases are complementary to a codon on the mRNA strand. The ribosome positions the start codon to attract its anticodon, which is part of the tRNA that binds methionine. The ribosome also binds the next codon and its anticodon. Ribosome Go to Section: mRNA Transfer RNA Methionine mRNA Lysine Start codon Making a Protein Section 12-3 The Polypeptide “Assembly Line” The ribosome joins the two amino acids— methionine and phenylalanine—and breaks the bond between methionine and its tRNA. The tRNA floats away, allowing the ribosome to bind to another tRNA. The ribosome moves along the mRNA, binding new tRNA molecules and amino acids. Lysine Growing polypeptide chain Ribosome tRNA tRNA mRNA Completing the Polypeptide mRNA Ribosome Go to Section: Translation direction The process continues until the ribosome reaches one of the three stop codons. The result is a growing polypeptide chain. The Genetic Code Making a Protein: Translation DNA in the Nucleus: ATA GCT CCG TTA Code is made into RNA: UAU CGA GGC AAU ***In RNA Thymine is replaced by Uracil Amino Acid Chain is made at the ribosome: Tyrosine: Arginine: Glycine: ___________ Go to Section: The Genetic Code Making a Protein: DNA in the Nucleus: ATA GCT CCG TTA Code is made into RNA: UAU CGA GGC AAU ***In RNA Thymine is replaced by Uracil Amino Acid Chain is made at the ribosome: Tyrosine: Arginine: Glycine: Asparagine http://www.learnerstv.com/animation/biology/Proteinsynthesis.swf Go to Section: The Genetic Code Making a Protein: DNA in Nucleus: TTA TTT CCC AAT RNA: Go to Section: The Genetic Code Making a Protein: DNA in Nucleus: TTA TTT CCC AAT RNA: Go to Section: AAU The Genetic Code Making a Protein: DNA in Nucleus: TTA TTT CCC AAT RNA: Go to Section: AAU AAA The Genetic Code Making a Protein: DNA in Nucleus: TTA TTT CCC AAT RNA: Go to Section: AAU AAA GGG The Genetic Code Making a Protein: DNA in Nucleus: TTA TTT CCC AAT RNA: AAU AAA GGG UUA Amino Acid Chain (Protein): Go to Section: The Genetic Code Making a Protein: DNA in Nucleus: TTA TTT CCC AAT RNA: AAU AAA GGG UUA Amino Acid Chain (Protein): Asparagine: Go to Section: The Genetic Code Making a Protein: DNA in Nucleus: TTA TTT CCC AAT RNA: AAU AAA GGG UUA Amino Acid Chain (Protein): Asparagine: Lysine Go to Section: The Genetic Code Making a Protein: DNA in Nucleus: TTA TTT CCC AAT RNA: AAU CGC GGG UUA Amino Acid Chain (Protein): Asparagine: Lysine: Glycine: Go to Section: The Genetic Code Making a Protein: DNA in Nucleus: TTA TTT CCC AAT RNA: AAU AAA GGG UUA Amino Acid Chain (Protein): Asparagine: Lysine: Glycine: Leucine This protein will determine a characteristic or trait Go to Section: The Genetic Code Making a Protein: DNA in Nucleus: AAA TCT GAC CAT RNA: Go to Section: The Genetic Code Making a Protein: DNA in Nucleus: AAA TCT GAC CAT RNA: Go to Section: UUU The Genetic Code Making a Protein: DNA in Nucleus: AAA TCT GAC CAT RNA: Go to Section: UUU AGA The Genetic Code Making a Protein: DNA in Nucleus: AAA TCT GAC CAT RNA: Go to Section: UUU AGA CUG The Genetic Code Making a Protein: DNA in Nucleus: AAA TCT GAC CAT RNA: UUU AGA CUG GUA Amino Acid Chain (Protein): Go to Section: The Genetic Code Making a Protein: DNA in Nucleus: AAA TCT GAC CAT RNA: UUU AGA CUG GUA Amino Acids Chain (Protein): Phenylalanine: Go to Section: The Genetic Code Making a Protein: DNA in Nucleus: AAA TCT GAC CAT RNA: UUU AGA CUG GUA Amino Acids Chain (Protein): Phenylalanine: Arginine: Go to Section: The Genetic Code Making a Protein: DNA in Nucleus: AAA TCT GAC CAT RNA: UUU AGA CUG GUA Amino Acids Chain (Protein): Phenylalanine: Arginine: Leucine: Go to Section: The Genetic Code Making a Protein: DNA in Nucleus: AAA TCT GAC CAT RNA: UUU AGA CUG GUA Amino Acids Chain (Protein): Phenylalanine: Arginine: Leucine: Valine This protein will now determine a trait or a characteristic Go to Section: Section 12-1 Structure of DNA Nucleotide Hydrogen bonds Sugar-phosphate backbone Key Adenine (A) Thymine (T) Cytosine (C) Guanine (G) Go to Section: III. Mutations- changes in the DNA sequence that affect genetic information (not all are harmful) Can affect all types of cells Germ Mutations- affect sex cells – inherited by offspring (ex- Down Syndrome) B. Somatic Mutations – affect other cells- not inherited (many cancers caused by somatic mutations) A. IV. 2 types of mutations A. Gene Mutations (#1) - changes in a single gene. 2 types of gene mutations1. Point mutations- affect only one nucleotide *Can be caused by substitutions 2. Frameshift mutations - type of point mutation where nucleotide is inserted or deleted;affects every amino acid after that point. *Can be caused by deletion or insertion Effect of Mutations • Sickle cell disease – single nucleotide change AT Point Mutation Gene Mutations: Substitution, Insertion, and Deletion Deletion Substitution Go to Section: Insertion B. Chromosomal Mutations (#2) - changes in whole chromosomes. 4 types of chromosomal mutations. 1. Deletion- loss of all or part of chromosome 2. Duplication- segment of a chromosome is repeated 3. Inversion- chromosome becomes reversed 4. Translocation- part of a chromosome breaks off and attaches to a different chromosome Section 12-4 Chromosomal Mutations Deletion Duplication Inversion Translocation Go to Section: V. What are the effects of mutations? A. Proteins are altered. B. Proteins are unable to perform “normal” functions. Sometimes mutations are harmful, sometimes there is no affect, and sometimes mutations can be helpful. (Helpful when mutation produces a trait that aids in survival) Populations Can Change! VI. Genetic Manipulation- when humans change the genes of an organism to achieve a desired result. A. Selective breeding- allowing only the individuals with desired traits to reproduce. 2 types 1. Hybridization-crossbreeding dissimilar individuals: offspring will have the best of both – Ex: donkey x horse = mule 2. Inbreeding-breeding individuals with similar characteristics: maintain certain characteristics in offspring – Ex: German Shepard x German Shepard = German Shepard VII. Genetic Engineering – Desired genes are removed from one organism and added or recombined into another organism. This forms a transgenic organism with recombinant DNA A. This is used to make proteins not normally made by the cell. Can be used to produce: Drugs like insulin, Vaccines, Plants resistant to Insects, Reduce pollution, Better crops/meat 1. The flounder’s antifreeze gene is copied and inserted into a small ring of DNA taken from a bacteria cell. This diagram shows how one type of GM food, a strawberry that resists frost damage is made. The flounder is a fish that live in icy seas. It has a gene that stops it from freezing to death.Strawberries are soft fruits that can easily be damaged by frost. 2. The DNA ring containing the flounder gene is put into a second bacterium. 3. This second bacterium is used to infect the strawberry cell. The flounder’s antifreeze gene enters the strawberry’s DNA. 4. The new GM strawberry cell is grown into a GM strawberry plant which can be bred many times. Strawberry cell with Antifreeze gene Wonder what they used to make this one green! Thanks to the new gene, GM strawberries make a protein which helps them resist frost. They don’t contain any other fish genes and, and do not taste or smell of fish. What’s Been Done So Far? • Genetically engineering chickens so they have no feathers – why? • Genetically engineering mice so they have no fur – why? • Genetically engineering salmon (fish) so they grow much faster than normal salmon – why? http://www.exn.ca/Stories/2 000/04/11/61.asp • Glowing mice VIII. Evolution –natural process through which species change over time A. The environment “selects” the best traits – only those best suited will survive and pass on their traits to offspring. B. Evolution– occurs because of genetic differences caused by mutations in DNA Section 15-3 Concept Map Evidence of Evolution includes The fossil record Geographic distribution of living species Homologous body structures Similarities in early development which is composed of which indicates which implies which implies Physical remains of organisms Common ancestral species Similar genes Similar genes