* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Chapter 17~ From Gene to Protein
Designer baby wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Transcription factor wikipedia , lookup
DNA vaccination wikipedia , lookup
DNA polymerase wikipedia , lookup
Human genome wikipedia , lookup
Short interspersed nuclear elements (SINEs) wikipedia , lookup
DNA supercoil wikipedia , lookup
RNA interference wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Epigenomics wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
History of genetic engineering wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Microevolution wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
RNA silencing wikipedia , lookup
Frameshift mutation wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
Non-coding DNA wikipedia , lookup
Polyadenylation wikipedia , lookup
Helitron (biology) wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Expanded genetic code wikipedia , lookup
History of RNA biology wikipedia , lookup
Point mutation wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Transfer RNA wikipedia , lookup
Genetic code wikipedia , lookup
RNA-binding protein wikipedia , lookup
Non-coding RNA wikipedia , lookup
Messenger RNA wikipedia , lookup
Ch. 17 Lecture Flow of genetic information in a cell How do we move information from DNA to proteins? DNA replication RNA protein DNA gets all the glory, but proteins do all the work! trait a a From gene to protein nucleus DNA cytoplasm transcription mRNA a a translation ribosome a a a a a a a a a a a a protein a a a a a a trait RNA ribose sugar N-bases uracil instead of thymine U :A C:G single stranded lots of RNAs mRNA, tRNA, rRNA, snRNA… DNA transcription RNA Transcription Making mRNA transcribed DNA strand = template strand untranscribed DNA strand = coding strand same sequence as RNA synthesis of complementary RNA strand transcription bubble enzyme RNA polymerase 5 DNA C G 3 build RNA 53 A G T A T C T A rewinding mRNA 5 coding strand G C A G C A T C G T T A 3 G C A U C G U C G T A G C A T A T RNA polymerase C A G C T G A T A T 3 5 unwinding template strand RNA polymerases 3 RNA polymerase enzymes RNA polymerase 1 only transcribes rRNA genes makes ribosomes RNA polymerase 2 transcribes genes into mRNA RNA polymerase 3 only transcribes tRNA genes each has a specific promoter sequence it recognizes Which gene is read? Promoter region binding site before beginning of gene TATA box binding site binding site for RNA polymerase & transcription factors Enhancer region binding site far upstream of gene turns transcription on HIGH Transcription Factors Initiation complex transcription factors bind to promoter region suite of proteins which bind to DNA hormones turn on or off transcription trigger the binding of RNA polymerase to DNA Transcription: the process 1.Initiation~ transcription factors mediate the binding of RNA polymerase to an initiation sequence (TATA box) 2.Elongation~ RNA polymerase continues unwinding DNA and adding nucleotides to the 3’ end 3.Termination~ RNA polymerase reaches terminator sequence Eukaryotic genes have junk! Eukaryotic genes are not continuous exons = the real gene expressed / coding DNA introns = the junk inbetween sequence introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence mRNA splicing Post-transcriptional processing eukaryotic mRNA needs work after transcription primary transcript = pre-mRNA mRNA splicing edit out introns make mature mRNA transcript intron = noncoding (inbetween) sequence ~10,000 base eukaryotic DNA exon = coding (expressed) sequence primary mRNA transcript mature mRNA transcript pre-mRNA ~1,000 base spliced mRNA Splicing must be accurate No room for mistakes! a single base added or lost throws off the reading frame AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP| RNA splicing enzymes snRNPs small nuclear RNA proteins exon Spliceosome 5' snRNPs snRNA intron exon 3' several snRNPs recognize splice site sequence cut & paste gene No, not smurfs! “snurps” spliceosome 5' 3' lariat 5' exon mature mRNA 5' 3' exon 3' excised intron Alternative splicing Alternative mRNAs produced from same gene when is an intron not an intron… different segments treated as exons Starting to get hard to define a gene! More post-transcriptional processing Need to protect mRNA on its trip from nucleus to cytoplasm enzymes in cytoplasm attack mRNA protect the ends of the molecule add 5 GTP cap add poly-A tail longer tail, mRNA lasts longer: produces more protein a a From gene to protein nucleus DNA cytoplasm transcription mRNA a a translation ribosome a a a a a a a a a a a a protein a a a a a a trait How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA 4 ATCG mRNA AUGCGUGUAAAUGCAUGCGCC 4 AUCG protein ? Met Arg Val Asn Ala Cys Ala 20 How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? mRNA codes for proteins in triplets DNA TACGCACATTTACGTACGCGG codon mRNA AUGCGUGUAAAUGCAUGCGCC ? protein Met Arg Val Asn Ala Cy Cracking the code 1960 | 1968 Nirenberg & Khorana Crick determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT Nirenberg & Khorana determined mRNA–amino acid match added fabricated mRNA to test tube of ribosomes, tRNA & amino acids created artificial UUUUU… mRNA found that UUU coded for phenylalanine Marshall Nirenberg 1960 | 1968 Har Khorana The code Code for ALL life! strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base “wobble” Why is the wobble good? Start codon AUG methionine Stop codons UGA, UAA, UAG How are the codons matched to amino acids? DNA mRNA 3 TACGCACATTTACGTACGCGG 5 5 3 AUGCGUGUAAAUGCAUGCGCC 3 tRNA amino acid UAC codon 5 Met GCA Arg CAU Val anti-codon a a From gene to protein nucleus DNA cytoplasm transcription mRNA translation ribosome aa a a a a a a a a a a a a a a protein a a a a a a trait Transfer RNA structure “Clover leaf ” structure anticodon on “clover leaf ” end amino acid attached on 3 end Loading tRNA Aminoacyl tRNA synthetase enzyme which bonds amino acid to tRNA bond requires energy ATP AMP bond is unstable so it can release amino acid at ribosome easily Trp activating enzyme C=O OH OH Trp C=O O Trp H 2O tRNATrp anticodon tryptophan attached to tRNATrp O AC C UGG mRNA tRNATrp binds to UGG Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon organelle or enzyme? Structure ribosomal RNA (rRNA) & proteins 2 subunits large small E P A Ribosomes A site (aminoacyl-tRNA site) holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site) holds tRNA carrying growing polypeptide chain E site (exit site) empty tRNA leaves ribosome from exit site Met U A C A U G 5' E P A 3' Building a polypeptide Initiation brings together mRNA, ribosome subunits, initiator tRNA Elongation adding amino acids based on codon sequence Termination end codon 3 2 1 Val Leu Met Met Met Leu Met Leu Ala Leu release factor Ser Trp tRNA UAC 5' C UG A A U mRNA A U G 3' E P A 5' UA C G A C A U G C U GA A U 5' 3' U A C GA C A U G C UG AA U 3' 5' U AC G A C AA U A U G C UG 3' A CC U GG U A A 3' Protein targeting Destinations: Signal peptide address label start of a secretory pathway secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… RNA polymerase DNA Can you tell the story? amino acids exon pre-mRNA intron 5' GTP cap mature mRNA large ribosomal subunit 5' small ribosomal subunit tRNA poly-A tail aminoacyl tRNA synthetase 3' polypeptide tRNA E P A ribosome Prokaryote vs. Eukaryote genes Prokaryotes Eukaryotes DNA in cytoplasm DNA in nucleus circular chromosome linear chromosomes naked DNA DNA wound on histone no introns proteins introns vs. exons introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence Translation in Prokaryotes Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing ribosomes read mRNA as it is being transcribed Translation: prokaryotes vs. eukaryotes Differences between prokaryotes & eukaryotes time & physical separation between processes takes eukaryote ~1 hour from DNA to protein no RNA processing Mutations Point mutations single base change base-pair substitution silent mutation no amino acid change redundancy in code missense change amino acid nonsense change to stop codon When do mutations affect the next generation? Point mutation leads to Sickle cell anemia What kind of mutation? Missense! Sickle cell anemia Primarily Africans recessive inheritance pattern strikes 1 out of 400 African Americans hydrophilic amino acid hydrophobic amino acid Mutations Frameshift shift in the reading frame changes everything “downstream” insertions adding base(s) deletions losing base(s) Where would this mutation cause the most change: beginning or end of gene? Cystic fibrosis Primarily whites of European descent strikes 1 in 2500 births 1 in 25 whites is a carrier (Aa) normal allele codes for a membrane protein that transports Cl- across cell membrane defective or absent channels limit transport of Cl- (& H2O) across cell membrane thicker & stickier mucus coats around cells mucus build-up in the pancreas, lungs, digestive tract & causes bacterial infections without treatment children die before 5; with treatment can live past their late 20s Deletion leads to Cystic fibrosis delta F508 loss of one amino acid What’s the value of mutations? 2007-2008