* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Answered copy of exam 3
DNA supercoil wikipedia , lookup
Genomic library wikipedia , lookup
Oncogenomics wikipedia , lookup
DNA vaccination wikipedia , lookup
SNP genotyping wikipedia , lookup
Epigenetics in learning and memory wikipedia , lookup
Transposable element wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Saethre–Chotzen syndrome wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Gene therapy of the human retina wikipedia , lookup
Epigenetics of diabetes Type 2 wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Molecular cloning wikipedia , lookup
Epigenomics wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Gene desert wikipedia , lookup
Non-coding DNA wikipedia , lookup
Gene nomenclature wikipedia , lookup
Copy-number variation wikipedia , lookup
Hardy–Weinberg principle wikipedia , lookup
Genetic engineering wikipedia , lookup
Gene therapy wikipedia , lookup
Point mutation wikipedia , lookup
X-inactivation wikipedia , lookup
Genome (book) wikipedia , lookup
Primary transcript wikipedia , lookup
Genome evolution wikipedia , lookup
Dominance (genetics) wikipedia , lookup
Gene expression programming wikipedia , lookup
Gene expression profiling wikipedia , lookup
Genome editing wikipedia , lookup
Genomic imprinting wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
History of genetic engineering wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Helitron (biology) wikipedia , lookup
Designer baby wikipedia , lookup
NAME GENETICS 310 EXAM 3 June 30, 2016 I. Which of the following enzymes or cloning tools would be used for the specific steps listed bellow? Put the code(s) provided in each blank as appropriate. RE, restriction endonuclease, RT, reverse transcriptase H, RNAase H L, DNA Ligase, T primer made of all Ts, B, beads with T tails, TdT terminal deoxynucleotide transferase, P, DNA polymerase a) cDNA clone preparation B Collecting eukaryotic mRNAs from ground tissue RT Making a cDNA copy of the messages H, RT or P TdT Replacing the RNA strand with a second strand of DNA Adding A tails to the double stranded cDNAs b) Shotgun cloning step RE Fragmenting donor DNA L Inserting fragments into a linearized pUC vector II Given the sequence below describe how you could make millions of copies in a short period of time. For simplicity, use arrows to indicate primers 1 and 2 that are just 7 bases long: 5’ ACCGTCAACTGCAATGCGCGCTAGAATCGTTGCATGATGG 3’ 3’TGGCAGTTGACGTTACGCGCGATCTTAGCAACGTACTACC 5’ Name of process? Polymerase Chain Reactio Enzyme used? TAQ polymerase Source? Hot springs bacterium III. Cross out the maize plants below that would not produce pollen based on their genotype (in the nucleus)/cytotype combinations? S F R_ rr_ F S rr rr R_ rr_ IV. A) RB gene defects appear to be inherited as dominant, but not everyone who gets a defective copy develops retinoblastoma. Tumor Suppressor 2. What is the normal function of such genes? Turn off cell division 3. Why do some individuals with a defective RB gene escape getting retinoblastoma? It requires a mutation in the remaining copy of a somatic cell B) The SRC gene was originally discovered to cause sarcomas in chickens following infection with Rous Sarcoma virus. 1. What type of gene is SRC in terms of cancer ? Oncogene 2. What is the normal function of such genes? Turn on cell division 3. What general type of virus is RSV? Retrovirus 4. What is unusual about the RSV particles that cause sarcomas? They carry an onc gene incorporated from a host genome 5. How do we know that humans also have a SRC gene? DNA hybridization to the cloned chicken gene C) At least 3 DNA viruses are associated with increased risk of cancer in humans. List 2 of them. Epstein Barr & Hepatitis B or HPV V. A) Check the following that are found in or as a part of eukaryotic but not prokaryotic chromosomes: X DNA RNA centromeres X X teleomeres histones lipids mitomeres B) Why do the chromosomes in a typical human karyotype appear doubled? They are taken from cells trapped at metaphase of mitosis VI. Fill in affected individuals assuming a perfect segregation ratio for each trait Mom is heterozygous for Duchene MD Dad is colorblind, mom is heterozygous Dad has a defect in one copy of the ‘Prader-Willi’ genes which should remain active in sperm MomhasMERRF,amitochondrialdefect Momisheterozygousforcompleteandrogensensitivity (testicularfeminization) Whatdoesaffectedmeaninthiscase? VII.Giveanexampleof: Momisheterozygousforadominantsex-linkedgene Aholandricgene Sry=tdf,HYantigen AvisibleconsequenceoftheLyonHypothesis calicocats Asex-limitedtrait hornsinsheep,patternbaldness lactation Asex-influencedtrait XYfemale Amaternaleffectstrait left/rightcoilinginsnails Whatforcealtersallelefrequenciesinsmallpopulations drift (chance) VIII.Placetheletterorlettersofeachofthefollowingsyndromesinallappropriateblanks: Syndrome Characteristic A)Angelman's 47chromosomes,D,JK,X C)Cri-du-chat SomeIQlossA,CD,J,K,(T),X D)Down's Female(always)T,X J)Jacobs AbnormalsexchromosomenumberJ,K,T,X K)Klinefelter's NormalfertilityJ,X T)Turner's 45chromosomesT X)TriploX genomicimprintingA tallforfamilyexpectation J,K Deletion C IX.IncattleC_animalsarenormalandccdevelopcataracts.ADNAbasedpolymorphism detectedbyPCRisjust4mapunitsfromthecataractsgene.It’sallelesaredesignatedA35 orA50forthesizeoftheamplifiedproduct.Supposeabullhasthegenotype CA35/cA50 Whatfractionofthespermheproduceswillhavethefollowinggenearrangements: CA3548% CA50 2% cA35 2% cA50 48% ? WhatgenotypewouldbeoptimalinthecowsifarancherwantedtousePCRteststocull calveswiththecataractscallelefromhisherdbeforetheywereallowedtoreproduce? CA35/CA35 X.a)Twofactorsareknowntoleadtosignificantincreaseintheriskoftrisomy21.What arethey? Agedmother & Translocationof21toanother b)1.Howaretheseedsusedtogrowseedlesswatermelonsproduced? 4NX2Ncrosses b)2.Whyaretheyseedless? Gameteswillnothavebalancedsetsofchromosomesandwillnotfunction c)1.Amousehomozygousforthegenearrangement‘A B C • D E’is crossedtoanotherwiththearrangement ‘a b d • c e’ Capitalandsmalllettersareusedjusttoaidinthefollowingdrawing.Showsynapsis(with thegeneslabeled)inmeiosisoftheF1hybridbetweenthetwoanimals. c)2.Whatisthenameofthechromosomalaberration? Prericentricinversion c)3.What%fertilityisexpected intheF1malesandfemales?Males 50% females 50% XI.Althoughothergenesmaymodifytheactualcolors,inmanybreedsofsheepwhitewool isdominant(W_)andblackisrecessive(ww).Inalargerandommatingflock16%ofthe lambsareblack.WhataretheallelefrequenciesofWandw? P=f(W)=0.6;q=f(w)=0.4 Whatarethepredictedgenotypicfrequenciesintheflock? 36WW:48Ww:16ww Supposetheshepherdsoldoffalltheblacklambsbornoneyear,andkepttheresttostarta newflock.What‘force’wouldbeinvolvedinchangingallelefrequencies? Selection Iftherewere100lambsandtheblackonesweresold,whatwilltheWandwallele frequenciesbeinthisnewflockoncetheyaregone? F(W)=(2X36+48)/168f(w)=48/168