Download RECOMBINANT DNA TECHNOLOGY AND BIOTECHNOLOGY

RECOMBINANT DNA TECHNOLOGY AND
BIOTECHNOLOGY
Tools of Recombinant DNA Technology
Rakesh Bhatnagar
Professor
Centre for Biotechnology
Jawaharlal Nehru University
JNU New Campus
New Delhi 110067
27-Mar-2006 (Revised 24-Jul-2007)
CONTENTS
What is a Recombinant DNA
Goals of Recombinant DNA Technology
Basic Tools of Recombinant DNA Technology
Visualization of DNA: Agarose Gel Electrophoresis
Restriction Endonuclease – An overview
DNA Modifying Enzymes
Polymerase Chain Reaction (PCR)
Vectors
Plasmids
Bacteriophage vectors
Lambda-Replacement Vector
Insertion Vectors
Shuttle vectors
Plant Vectors
Ti plasmid
Cloning
PCR Mediated Gene Cloning
Methods for Selection and/or Screening of Desired Recombinants
Keywords
Recombinant DNA; Plasmids; Bacteriophages; Agarose Gel Electrophoresis; Restriction endonuclease;
Isochizomers; DNA ligase; DNA polymerase;Bacteriophage polymerase; Reverse Transriptase; Nucleases;
Alkaline phosphatase; Poymerase Chain Reaction (PCR); Plasmid vectors; Gene cloning; Bacteriophage vector;
Lambda replacement vector; Insertion vector; Shuttle vector; Plant vector; Ti plasmid.
What is a Recombinant DNA
DNA molecules constructed outside the living cells that is in vitro by joining natural or
synthetic DNA segments that can replicate in a living cell
Goals of Recombinant DNA Technology
a) To isolate and characterize a gene
b) To make desired alterations in one or more isolated genes
c) To return altered genes to living cells
Basic Tools of Recombinant DNA Technology
Nucleic Acid Enzymes
DNA and RNA polymerases, reverse transcriptase, DNA ligases, Restriction endonucleases
and many more.
Plasmids and Bacteriophages
a) Bacteriophages replicate via the lytic phase cycle and the phage genome is injected into
the cell, phage genes are expressed and phage proteins and DNA are made, progeny
phage are packaged, and the cell is lysed. Two genetically different phage that infect the
same host cell may recombine during the lytic cycle
b) Some PHAGE can also replicate via the Lysogenic cycle. The phage genome is integrated
into the host chromosome and is inherited into the chromosomes of all daughter bacteria.
This "prophage" can be induced to enter the lytic cycle and kill its host by a variety of
stresses like UV light
c) Plasmids: Circular DNAs that replicate autonomously
Visualization of DNA: Agarose Gel Electrophoresis
Electrophoresis is a technique used to separate and purify macromolecules like nucleic acids
that differ in size, charge or conformation. It is one of the most widely-used techniques in
biochemistry and molecular biology. When charged molecules are placed in an electric field,
they migrate toward either the positive or negative pole according to their charge. In contrast
to proteins, which can have either a net positive or net negative charge, nucleic acids have a
consistent negative charge imparted by their phosphate backbone, and migrate towards the
positive end of the electrode, anode.
The nucleic acids are electrophoresed on a matrix called as Gel. Most commonly, the gel is
cast in the shape of a thin slab, with wells for loading the sample. The gel is immersed within
an electrophoresis buffer that provides ions to carry a current and maintain the pH at a
relatively constant value. The gel is composed of agarose, a polysaccharide extracted from
seaweed. It is typically used at concentrations of 0.5 to 2%. The higher the agarose
concentration the gel is of less porosity. The agarose gels have a large range of separation,
but relatively low resolving power. By varying the concentration of agarose, fragments of
DNA from about 200 to 50,000 bp can be separated using standard electrophoretic
techniques.
2
The distance DNA has migrated in the gel can be judged by visually monitoring migration of
the tracking dyes. Bromophenol blue and xylene cyanol dyes are used usually and they
migrate through agarose gels at roughly the same rate as double-stranded DNA fragments of
300 and 4000 bp, respectively. When adequate migration has occured, DNA fragments are
visualized by staining with ethidium bromide, a fluorescent dye which intercalates between
the bases of DNA and RNA. Fragments of linear DNA migrate through agarose gels with a
mobility that is inversely proportional to the log10 of their molecular weight. However,
circular forms of DNA migrate in agarose distinctly differently from linear DNAs of the same
mass. Uncut plasmids will migrate more rapidly than the same plasmid when linearized and
most preparations of uncut plasmid contain two topologically-different forms of DNA,
corresponding to supercoiled forms and nicked circles. Several additional factors have
important effects on the mobility of DNA fragments in agarose gels like:
Agarose concentration: By using gels with different concentrations of agarose, we can
resolve different sizes of DNA fragments. Higher concentrations of agarose facilitate
separation of small DNAs, while low agarose concentrations allow resolution of larger DNAs
Voltage: As the voltage applied to a gel is increased, larger fragments migrate proportionally
faster than the small fragments. For that reason, the best resolution of fragments larger than
about 2 kb is attained by applying no more than 5 volts per cm to the gel where, cm value is
the distance between the two electrodes, not the length of the gel).
Electrophoresis buffer: Several different buffers have been recommended for
electrophoresis of DNA. The most commonly used for duplex DNA are TAE (Tris-acetateEDTA) and TBE (Tris-borate-EDTA). DNA fragments will migrate at somewhat different
rates in these two buffers due to differences in ionic strength. Buffers not only establish a pH,
but provide ions to support conductivity. If water is used instead of buffer there will be no
migration of DNA in the gel and conversely, if concentrated buffer is used like a 10X
solution instead of 1X, heat will be generated in the gel which is enough to melt it.
Ethidium bromide: Ethidium bromide is a fluorescent dye that intercalates between bases of
nucleic acids and allows very convenient detection of DNA fragments in gels. It is added to
the DNA sample before loading to enable visualization of the fragments within the gel or can
be added in the electrophoresis buffer. The binding of ethidium bromide to DNA alters its
mass and rigidity, and therefore its mobility.
Restriction Endonuclease – An overview
Phage growth restriction – Methylase & Nuclease concept
It has been observed that phage particles that grow well and efficiently infect one strain of
bacteria are often unable to grow well and infect other strains of the same bacterial species.
Studies carried out showed that the phage particles that efficiently grow and infect host cells
have DNA molecules which are chemically modified by the addition of –CH3 groups to some
of their A/C bases, while the DNA of phage particles, which poorly infect the bacterial strain,
does not show this pattern of chemical modification of methylation. To summarize, phage
particles with unmethylated DNA do not grow and infect efficiently. Therefore, their DNA
molecules gets cleaved and degraded by the enzyme of host cells, which recognize it as
foreign. In contrast, methylated DNA is recognized as self and is protected from hostmediated destruction. This phenomenon of degrading unmethylated DNA and protecting the
self methylated DNA is responsible for the phenomenon of phage growth restriction. In
3
addition to this particular methylase, individual bacterial strains also contain accompanying
specific endonuclease activity. In late 1960s, Stewart Linn and Werner Arber isolated two
types of enzymes responsible for this observed phage restriction phenomenon. Later on, in
1978, Smith, Nathans and Arber were awarded Nobel Prize for Physiology and Medicine for
the discovery of endonucleases. The first type of enzyme was called a methylase while other
was called a restriction nuclease. The endonuclease cleaves at or near the methylation
recognition site. Different strains have difference in residues which are methylated. Typical
sites of methylation include N6 position of adenine, N4 of cytosine or C5 of Cytosine. And,
only a fraction of bases are methylated, that is, not every A/C will be methylated. This
suggests that there are only few unique bases which are substrates of methylase. Thus, this
unique system was coined as Restriction Modification system in bacteria. It acts as a small
immune system for protection from infection by foreign DNA, example viral DNA, in
individual bacterial strains and provides a reason why the restriction endonuclease doesn’t
chew its own DNA.
Eg. ECOR I methylase, the sequence GAATTC will be internally methylated at adenine base
(shown in asterisks) by the enzyme. The ECOR I endonuclease within the host bacteria will
not cleave the methylated DNA. The foreign viral DNA, which is not methylated at this
particular sequence, GAATTC, will be recognized as foreign invasive DNA and will be
cleaved by ECOR I endonuclease. This cleavage of foreign DNA abandons any viral
infection, thus protecting the host from any fatal consequence. Such endonucleases are
termed as restriction endonucleases since they restrict the DNA within the cell to being
“self”.
If the attacking phage was previously grown on the same strain, which is infecting now, this
system will be rendered ineffective. In this case, the phage’s DNA will already be methylated
at appropriate sequence and will be recognized as self. Structural and biochemical studies
have indicated that for the type II R/M system, the methylase recognizes and methylates one
strand of DNA duplex, whereas restriction endonucleases recognize both the strands, that is,
both should be non-methylated for recognition. It is able to do this because it is a homodimer.
The methyl group protrudes into the major groove of DNA at the binding site and prevents
the restriction enzyme from acting upon it. Together, a Restriction enzyme and its cognate
modification enzyme, works in the bacteria to prevent it from infections, acting as miniature
microbial immune system. In some R-M systems, the restriction enzyme and the modification
enzyme(s) are separate proteins that act independent of each other while in some, the two
activities occur as separate subunits / domains of a larger, combined R-M enzyme.
Restriction enzyme or Endonuclease is an enzyme that cuts double stranded DNA. Precisely,
it cleaves the sugar-phosphate backbone of DNA without damaging the bases. A restriction
endonuclease works by scanning the length of DNA molecule and once it encounters its
particular specific recognition sequence; it will bind to the DNA and makes one incision in
each of the two sugar- phosphate backbones of the double helix. Thus, rather than cutting
DNA indiscriminately, a RE cuts only at a particular nucleotide sequence, termed as
Recognition sequence. Therefore, scientists could cut the DNA molecule in a predictable and
reproducible way. Restriction enzymes are traditionally classified into 3 types on the basis of
subunit composition, cleavage position, sequence specificity and requirement for cofactors.
4
Type I
Complex, multisubunit, cut DNA at random, far from their recognition sequences. They may
have biological significance but have a very little practical value since they do not produce
discrete restriction fragments.
Type II
Cut DNA at very precise and defined positions close to or within the recognition sequences.
It is the only class of restriction endonuclease used in the laboratory for DNA analysis and
gene cloning. They require only Magnesium for activity and corresponding model of
enzymes require only s-adenosyl methionine (SAM). They are smaller with subunits in the
range of 200-350 amino acids. The most common are the ones which cleave within
symmetric recognition sequence. e.g. Hha I, Hind III and Not I. Next common of Type II, the
ones which cleave outside their Recognition sequence to one side. They are intermediate in
size with 400-650 amino acids and recognize sequences that are continuous and asymmetric.
Third major type II Restriction enzymes are referred to as Type IV, are large, 850-1250
amino acids, where two enzymatic activities reside in the same protein chain, cleave outside
the recognition sequence and others those recognize discontinuous sequences and cleave on
both sides releasing a small fragment containing recognition sequence.
Type III
Large, cleave outside the recognition sequence and require two sequences in opposite
orientations within the same DNA molecule to accomplish cleavage. They rarely give
complete digests. They have basically no practical requirement and there is none so available
commercially.
Source and site of Action
Patterns of DNA cutting
Restriction Endonuclease recognizes short, specific palindromic sequences of DNA and
cleaves them. Some restriction enzymes symmetrically leave blunt ends without overhangs
like Sma I as shown below while others cleave DNA backbones in positions that are not
directly opposite to each other. e.g EcoR I. Arrows show the site of cleavage. Once the cuts
have been made, the resulting fragments are held together only by the relatively weak
hydrogen bonds holding complimentary bases with each other. These enzymes generate
either of two types of ends, 5‫ ׳‬or 3‫׳‬, called overhangs or sticky ends.
5
(Generates blunt ends)
(Generates 5’ overhangs)
5’
5’ CCCGGG 3’
3’
3‫ ׳‬GGGCCC 5’
GAATTC
3’
CTTAAG
5’
EcoR I
Sma I
5’ G
5’ CCC
GGG 3’
3’ CTTAA
3‫ ׳‬GGG
CCC 5’
5’ GGTACC 3’
5’ GGTAC
3’ C
AATTC
3’
G
5’
C 3’
CATGG 5’
3’ CCATGG 5’
Kpn I
(generates 3’ overhangs)
Nomenclature
Restriction endonucleases are named based on bacteria from which they are isolated in the
following manner
E
Co
R
I
Escherichia (Genus)
Coli (Species)
RY13 (Strain)
First Identified order (Id) in Bacteria
Name of RE
Organism from which isolated
Recognition Sequence
EcoR I
BamH I
E.coli
Bacillus
amyloliquefaciens
Haemophilus
influenzae
Arthobacter
luteus
Nocardia olitidiscaviarum
GAATCC
GGATCC
6bp cutter, leaves 5’ overhangs
6bp cutter, leaves 5’ overhangs
AAGCTT
6bp cutter, leaves 5’ overhangs
AGCT
4bp cutter, Leaves blunt end
Hind III
Alu I
Not I
GCGGCCGC 8bp cutter, 5‫ ׳‬overhangs
6
Recognition Sequence typically is only 4-12 nucleotides long. Thus probability that they are
found in chromosomes of any organism is quite possible and frequent. Thus, if there is 25%
probability for a specific base at any given site (because 4 bases, A/T/G/C), then the
frequency with which different RE site will occur in a gene will be 4n, where n is nucleotide
specificity. Eg. Alu I is a 4bp cutter, therefore, (4)4 = 256. Therefore, on an average, any DNA
will contain an Alu I site after every 0.25 kilobases, whereas Not I site occurs once about
every 65.5 kilo bases (48). Thus Not I generates bigger fragments while Alu I would be
expected to digest DNA into many small fragments. Thus, length of Recognition sequence
dictates how frequently the enzyme will cut in a random DNA sequence.
Isochizomers
Isochizomers are different Restriction endonucleases having same recognition site. In some
cases, they cut identically within their recognition site, but sometime they do not. They have
different optimum reaction conditions, stabilities and cost that give us an option of what to
purchase. Some Restriction endonucleases recognizes only one sequence but never other,
called as Ambiguous Recognition Sequence. Eg. BamH I recognize GGATCC, while Hinf I
recognizes a 5bp sequence, with an eligibility of sequence starting with GA and ending with
TC and having any base in between GANTC. Some REs recognition site has a site for
cleavage by other Restriction Endonuclease. e.g: BamH I site GGATCC have site recognized
and cleaved by Sau3A I GATC. Thus all BamH I sites can consequently be cut by Sau3A I.
Conditions and requirements that influence Enzyme Activity
One unit activity:- is defined as amount of enzyme required to digest 1µg of reference DNA
in 60 minutes at 370C. Usually reference DNA is λ phage DNA.
Buffer:- The most critical determinant of the enzyme activity is the ionic concentration
(NaCl content) of the buffer. There are commercially 3 buffer systems available for the
activity, low salt buffer (20mM), medium (100mM) or high (250mM) NaCl buffers. The
buffer is usually 10mM Tris-HCl, pH 8.0, supplemented with Magnesium salt (often 50mM
MgCl2), a reducing agent (usually 1mM DTT), and some enzymes require BSA (100µg/ml)
and salt (NaCl). The reaction does not require ATP.
Quality of DNA :- Preparation of DNA that has to be cleaved should be free of contaminants
such as phenol, CHCl3, alcohol, EDTA, detergents, excessive salts, protein, RNA, all of
which can pose a hindrance to the enzyme’s activity.
Stopping a Reaction:- To terminate Restriction enzymes activity, heat inactivation is a way
but for the enzymes which it does not work, phenol / CHCl3 extraction is another means of
inactivation of Restriction enzymes.
Incubation Temperature and Time: - Recommended temperature for most of the
Restriction enzymes is 370C except for the ones which are isolated from thermophilic
bacteria which require higher temperature ranging from 50-650C. While some restriction
enzymes have short ½ lives at 370C and for those lower temperatures are required. Incubation
time as per the unit definition is 1 hour but it can be manipulated. Example, it may be
shortened if more units of Restriction enzyme is added or longer times are used to allow a
reaction to proceed to completion with fewer enzymes units.
7
Cleavage near ends :- When Recognition sequences are located at or very close to the ends
of the linear fragments, most enzymes require few bases on either side of Recognition
sequence in order to bind and cleave. Thus there is some specificity on end requirement for a
variety of enzymes.
DNA methylation :- Almost all strains of E.coli used for propagating cloned DNA contain 2
site-specific DNA methylase:Dam Methylase
Adds a –CH3 group to A in separate GmATC
Dcm Methylase
Adds methyl group to internal cytosine CmC
(A/T)GG
Importance of this phenomenon lies in the fact that a number of Restriction enzymes will not
cleave methylated DNA. Eg. Mbo I and Sau3A I are isochizomers recognizing sequence
GATC. Dam methylase methylates it to GmATC, while Mbo I does not cleave it, Sau3A I is
unaffected by the sequence methylation.
Relaxed or Altered activity of Restriction enzymes - Star activity
If non standard conditions are used for DNA digestion, cleavage can occur at sites different
from canonical recognition sequence. This aberrant non specific DNA cleavage is called as
star activity. Some non standard conditions that contribute to this star activity are as follows:¾
¾
¾
¾
¾
¾
High pH (>8)
Low ionic strength of buffer (<25mM)
>5% glycerol concentration (Enzymes are stored in 50 % glycerol)
High enzyme concentration (>100U for 1µg DNA)
Presence of organic solvents in DNA preparation Eg. DMSO, Ethylene Glycol
Substitution of Mg+2 with other divalent cations like Mn+2, Cu+2, Co+2, Zn+2
Thus, to avoid star activity, fewer units should be used which not only prevents over
digestion but reduces final glycerol concentration in the reaction. High ionic strength should
be used provided enzyme is not inhibited by high salt. pH should be lowered accordingly.
Restriction Mapping:A restriction map is a profile of restriction endonuclease cleavage in a piece of DNA.
Generation of restriction map is the first step in characterizing an unknown DNA for the
presence of recognition sequences. Restriction Endonucleases which are infrequent cutters
are used for generating the maps. Fragments of varying lengths using various combinations of
enzymes are generated and then analyzed on agarose gel. Single digestions are used to
determine which fragments are in the unknown DNA, and double digest to predict the order
and orientation of fragments. Success in using this technique relies on obtaining complete
digestion of the DNA with each of the enzymes used since partial digest will yield false
fragments which will lead to confusion.
DNA Modifying Enzymes
1. DNA Ligase
Ligases are vital enzymes required for physiological cellular processes such as DNA
replication, repair of damaged DNA and recombination. This enzyme facilitates formation of
8
phosphodiester bonds between adjacent 3’OH and 5’ phosphate termini, thereby joining the
nicks in double strandeded DNA. There are 2 categories of ligase depending on the
requirement for cofactors. Eukaryotic and virally encoded enzymes are ATP dependant,
whereas most prokaryotic enzymes require NAD+ for their activity as a cofactor.
ATP dependant DNA ligase
Ligase isolated from bacteriophage T7 is a 41Kda monomer and is found to form a complex
with ATP. The structure involves an N terminal ATP binding domain and a C terminal
domain which is the DNA binding domain. The N-terminal DNA is itself an active ligase but
with the reduced ligase activity. Both domains are able to bind to single stranded DNA but
smaller C terminal domain is only able to bind double stranded DNA. The affinity for nicked
DNA comes only from reconstitution of these two domains. This enzyme also catalyses
covalent joining of two segments to one uninterrupted strand in a DNA duplex, provided that
no nucleotides are missing at the junction (repair reaction). For its catalytic activity, the
enzyme requires ATP and Mg+2. DNA which does not have phosphate residues can be
rendered capable of ligation by Phosphorylation with Kinase.
3’
5’ ACTT-OH
3’ TGAAGA
CTTCGTLigation of DNA with complementary cohesive
termini.
+
AGCA-5’
ATP/Mg2+ and ligase
51 - ACTTCTTCGT – 3’
31 – TGAAGAAGCA – 5’
Repair Reaction:3’
5’
C
G
P
5’
G T A
C A T
P OH P
P
3’
+ ATP and Mg2+ and ligase
P 3’
5’
C G T
G C A
5’ P P
A
T
P
P
P 3’
Bacteriophage T4 DNA ligase is a polypeptide with a Molecular weight of 68000 Daltons.
Mg+2 ions in 10mM concentration sulfhydryl agents (DTT, 2-mercaptoethanol) are also
required for its catalytic activity. High NaCl concentration can be inhibitory. For
intermolecular ligations, PEG (Polyethylene glycol) (1-10%) enhances the efficiency of
ligation reaction. Addition of PEG can also facilitate blunt end ligation, whose efficiency is
as such lower. Since there is no base pairing to hold fragments together temporarily,
concentration of DNA and ligase must be high. The reaction which is driven by ATP is often
carried out at 100C to lower the kinetic energy of molecules, and so reduce the chances of
9
base paired sticky ends parting before they have been fixed by ligase. But, then long reaction
times are needed to compensate for the lowered activity of DNA ligase at lower temperatures.
NAD+ dependent DNA ligase
Isolated from E. coli, is quite different from ATP dependent T4 DNA ligase. In this, there are
two domains with the larger N-terminal domain retaining full activity while the C terminal
domain having all the DNA binding activity. Thus, the scenario is different, in the context
that, there both the domains contribute to the enzyme activity.
Units of Ligase Activity
Weiss unit: - is defined as the amount of ligase that catalyzes the exchange of 1nanomole of
P32 from inorganic pyrophosphate to ATP in 20min at 370C.
2. DNA Polymerases
E.coli DNA polymerase I
E. coli DNA polymerase I is a single polypeptide chain of 109000Da, encoded by E. coli pol
A gene and requires magnesium as a cofactor. Polymerase I carry out three enzymatic
reactions that are performed by three distinct functional domains of the holoenzyme.
Proteolytic deletions can be generated to study the function of each domain in terms of the
activity performed. The domains of E. coli polymerase I are summarized below in a table
which mentions the function of each subunit separately.
Domain
Catalytic Activity
C-terminal (46 kDa)
5’-3’ DNA Polymerase
Central Domain (22 kDa)
3’-5’ exonuclease
-NH2 terminal
5’-3’ exonuclease
Characteristic Function
Addition of nucleotide residue to
3’ –OH termini of RNA/DNA
primes
Cleavage of nucleotide residue
from 3’ –OH, generating 3’ recess
Cleavage of nucleotide from base
paired 5’ termini
3’-5’ exonuclease domain
3’-5’ exonuclease domain
DNA polymerase I
Polymerase domain
Holoenzyme
Treated with Subtilisin
Large Klenow fragment
Polymerase domain
5’-3’ exonuclease domain
5’-3’ exonuclease domain
(5’-3’)
Small fragment
10
Polymerase I on mild cleavage with subtilisin releases two fragments, the larger one, known
as Klenow fragment, carries both DNA polymerase and 3’-5’ exonuclease while the smaller
one possesses 5’-3’ exonuclease activity of the holoenzyme. The exonuclease activity
performs a proof reading function by rejecting DNA, which is mismatched.
Units of DNA polymerase
One unit of DNA polymerase is the amount of enzyme required to catalyze the conversion of
10 nanomoles of total dNTPs to an acid-insoluble form in 30minutes at 37 0C using poly d
[A-T] as the template primer. Mg+2 ions are preferred for accurate replication, whereas Mn+2
if present, increases the frequency of errors and mismatches.
Application of Klenow fragment in Molecular Biology
1.
Synthesis of double stranded DNA from single stranded template
The primary function of DNA polymerase is to synthesize complimentary strands during
DNA replication. DNA polymerase requires a primer to provide 3’–OH group to which newer
nucleotides can be added. The primers used are generally 6-20 bases in length, termed as
oligonucleotides, which are complimentary to a specific region of template DNA. Shown
below is the display of the catalytic activity carried out by the enzyme.
GCTAC
AGGC
AAGTCCGATGCCAATTGCGGATCCGATT
Klenow fragment
dNTPs of each kind
GCTACGGTTAACGCCTAGGCTAA
AAGTCCGATGCCAATTGCGGATCCGATT
2.
Filling in recessed 3’ends of DNA fragments
Klenow fragment is also used to create blunt ends on fragments created by restriction
enzymes that leave 5’ overhangs.
5’AGGCAG3’
3’TCCGTCGAACT5’
Klenow and dNTPs of
each kind
5’AGGCAGCTTGA3’
3’TCCGTCGAACT5’
3.
Digestion of Protruding 3’ overhangs
This is another way of producing blunt ends on a DNA, which is created by restriction
enzymes that produce 3’ overhangs. Removal of nucleotides from 3’ ends will continue, but in
the presence of nucleotides, the polymerase activity balances the exonuclease activity,
yielding blunt ends.
4.
Generating novel cohesive ends
The DNA digested with restriction enzymes generates cohesive ends that can be end-filled.
The end-filling reaction can be controlled by omitting one, two or three of the four dNTPs
from the reaction and thereby generate partially filled termini.
11
3. T4 Bacteriophage polymerase
T4 Bacteriophage polymerase is similar to E. coli DNA polymerase I larger subunit, Klenow
fragment. Thus, it has 5’-3’ DNA polymerase, 3’-5’exonuclease activities but 5’-3’
exonuclease activity is missing. It is also used for similar type of work like creating blunt
ends in a DNA with 5’ or 3’ overhangs. The functional difference between the two enzymes
which have practical significance is as follows:1.
3’-5’ exonuclease of T4 is 200 times more potent than that of Klenow which is a
sluggish enzyme, making it a preferred enzyme for generating blunt ends in a DNA
with 3’ overhangs.
2.
Like Klenow displace downstream oligonucleotides with 5’-3’ exonuclease activity as
it extends the chain, T4 polymerase does not. This makes it a preferred choice for
oligonucleotides directed mutaqenesis.
Use of Polymerase I- Nick Translation
Labelling of DNA by nick translation
Enzyme binds to a nick or gap in duplex DNA. The 5’-3’ exonuclease activity of Polymerase
I remove nucleotide from one strand and create a template for the growing chain. The original
nick is therefore translated along the DNA molecule by the combined action of 5’-3’
exonuclease and 5’-3’ polymerase. This is the oldest method of nucleic acid labeling and is
still used commonly. The DNA preparation to be labeled is treated with DNase I for a very
short time; this induces nicks in the DNA molecule at random positions. A nick is a point in a
DNA duplex where the phosphodiester bond is broken and has a free 3’ OH group. The
nicked DNA is subjected to E. coli DNA polymerase I which successively adds new
nucleotides to the free 3’OH group. As the new bases are synthesized, the existing strand is
displaced progressively and is digested away by the enzyme 5’-3’ exonuclease activity of the
polymerase enzyme. In this reaction, usually one of the deoxynucleoside triphosphates is
radiolabel led or even all the four can be labeled, thus incorporating labeled nucleotides into
the newly synthesized segment. Since this segment is synthesized by complimentary basepairing, it has the same sequence as the strand it replaces. This process is called ‘nick
translation’ because there is a movement (translation) of the nick along the DNA duplex due
to the activities of DNA polymerase I.
5’
31
3’
5’
3’
51
dNTPs / E.coli
DNA Polymerase
5’
3’
3’
5’
Polymerization
5’
3’
Nick translation is usually carried out at
lower temperature to reduce the synthesis of
snap back DNA, which is produced when 3’OH terminus of growing strand loops back
on itself
3’
5’
12
4. T7 DNA Polymerase
The T7 DNA polymerase from T7 bacteriophage has 3’-5’ exonuclease and DNA polymerase
activity but lacks 5’-3’ exonuclease domain, which is similar to T4 DNA polymerase. The
processivity of this enzyme is quite good that is, the average length of DNA synthesized
before the enzyme dissociates from the template, is considerably greater than for other
enzymes. Thus, the average length of DNA synthesized by a single molecule of
bacteriophage T7 polymerase is much greater than that of DNAs synthesized by other DNA
polymerases. The binding and polymerization domain is occupied by the carboxy terminus
while the potent 3’-5’exonuclease activity resides on the amino terminus.
The exonuclease activity is completed inactivated by incubating the enzyme with a reducing
agent, molecular oxygen, and low concentrations of ferrous ions, for several days. Over 99%
of the exonuclease activity is abolished without affecting the polymerization activity by these
agents, which cause mutations and site specific modifications. The resulting chemically
modified enzyme is marketed under the trade name Sequenase is ideal for determining the
sequence of long tracts of DNA by the dideoxy mediated chain termination method.
5. Thermostable DNA polymerase
Taq DNA polymerase:Taq DNA polymerase is a DNA dependent DNA polymerase, first isolated from the hot
spring bacterium, Thermus aquatics in 1976 and in 1989. Due to its wide use in molecular
biology (primarily PCR), it is termed as ‘Molecule of the Year’. This thermophilic DNA
polymerase encodes an 832-amino acid, 94 kDa protein, which consists of two domains.
1. -NH2 domain: Similar to 5’-3’ exonuclease domain of members of polymerase I
family of DNA polymerase
2. -C terminal domain contains a catalytically inactive 3’-5’ exonuclease and a
polymerase sub domain, similar to klenow of DNA polymerase I.
The thermal stability of Taq DNA polymerase is attributed to its hydrophobic core and stable
electrostatic interactions and high density of proline residues on the surface of the enzyme.
The optimal activity is at 75-800C temperature and at 600C, the activity is reduced by a factor
of 2 and at 370C, its activity is reduced to only 10%. To initiate DNA synthesis, like other
DNA polymerases, it also requires a primer that is annealed to the template strand and caries
an extensible 3’-OH group. Taq DNA polymerase requires Mg2+ for its optimal activity.
Phosphate buffers inhibit Taq DNA polymerase and therefore should be avoided. The
reaction is usually carried out in the presence of Tris buffer at pH 8.3. Because of the lack of
a proofreading function, the rate of misincorporation of dNTPs is high in PCR reactions
which are catalyzed by Taq polymerase (or any other DNA polymerase that does not have
editing domains). Several mutant forms of native polymerases, are also available like Pfu
And vent. Both of them have proofreading activities contributed by 3’-5’ exonuclease. Pfu
polymerase is therefore known to generate lowest errors while vent is probably intermediate
between Taq and Pfu.
Pfu polymerase is isolated from Pyrococus furiosus
Vent is isolated from Thermococcus litoralis (also known as Tli polymerase)
13
6. Reverse Transcriptase (RT)
Reverse Transcriptase is a RNA dependent DNA polymerase, encoded by reteroviruses,
where there is a requisite of converting viral RNA genome into DNA, prior to its integration
into the host cells. Reverse transcriptase has two independent functional activities in two
separate domains.
1. DNA polymerase activity: As its native function, Reverse Transcriptase copies only
RNA, but in vitro, it can transcribe both single stranded RNA and single stranded
DNA templates with equivalent efficiency. And in both cases, RNA or DNA primer is
required to initiate synthesis.
2. RNaseH activity: Ribonuclease that degrades RNA from RNA-DNA hybrids. The
products generated includes ribonucleotides which are 4-20 nucleotides in length and
contain 5’phosphates and 3’ OH terminus
Reverse transcriptase is used chiefly to transcribe mRNA into double stranded cDNA that can
be inserted into prokaryotic vectors. Reverse transcriptase lacks 3’-5’ exonuclease activity
which acts as an editing function in E. coli DNA polymerase I, and is therefore more prone to
errors
Usually Reverse Transcriptase for laboratory purposes is isolated from one of the following
reteroviruses, either by purification from virus i.e the native host or from heterologous hosts
as a recombinant protein.
a.) Moloney Murine leukemia virus - Single polypeptide
b.) Avian myelobalstosis virus- Two polypeptide chains
Both of these differ from one another in a number of aspects. Mo-MLV Reverse
Transcriptase contains two non overlapping domains, larger –NH2 domain with DNA
polymerase activity, while C-terminal domain encompasses a comparatively weak RNaseH
activity which has an advantaqe over the avian form, when synthesizing cDNAs
complimentary to long mRNAs. Because at the beginning of cDNA synthesis, there is a
competition between degradation of template mRNA and initiation of DNA synthesis. The
presence of RNaseH activity leads to premature termination of RNA-DNA duplex. Therefore,
certain mutants are made that retains DNA polymerase activity but lacked RNase H activity.
Serendipitously, it has been found that due to these mutations, the enzyme can work at
elevated temperatures, as high as 500C, whereas RNase H deficient mutant forms of Avian
enzyme can be used at 600C while the murine enzyme is rapidly degraded at these
temperatures. These mutated thermostable forms of Reverse Transcriptase facilitated their
use in RT PCR which itself has myriad applications in Molecular Biology. The avian enzyme
works more efficiently at pH 8.3 than at pH 7.6, at which the murine enzyme works.
14
7. Nucleases
Enzyme
Characteristic Feature (Activity catalyzed)
Nuclease S I
Heat stable, isolated from fungi Asperigillus oryzae ,works optimally at
high ionic strength, low pH (~4.2) in the presence of Zn+2, degrades
single stranded DNA / RNA, chief product is 5’ mononucleotide
Exonuclease VII Single strand specific DNase that hydrolyses denatured DNA, Single
stranded regions extending from the termini of duplex DNA, chief
product is oligonucleotide (2-25 nucleotides), does not require divalent
ions, has several applications
Mung bean
To eliminate primers from completed PCRs, isolated from mung bean
Nuclease
sprouts, degrades Single stranded DNA / RNA generating 5’ mono and
oligonucleotides, very specific for single stranded DNA but if used in
high concentration or with long incubation time, can cleave double
stranded DNA also. Used to convert protruding termini on double
stranded DNAs to blunt ends. It is easier to control than SI nuclease. SI
will cleave the DNA strand opposite to a nick while mung bean nuclease
will attack the nick only when it is enlarged to a gap of several
nucleotides, prefers to remove nucleotide from 5’ end of the substrates
and therefore not useful when DNA carries 3’ overhangs
BAL 31
Isolated from marine bacterium Alteromonas espejiana , Ca+2 dependent
exonuclease, has 3’-5’ exonucleolytic activity that removes
mononucleotides from double stranded DNA, a 5’-3’ exonuclease
activity for single stranded DNA. The combination of both exonuclease
causes both stands of double stranded DNA to be shortened from both
the ends. It is used to generate uni and bi-directional deletions from the
duplex DNA cloned in any vector.
Exonuclease III Isolated from E.coli removes 5’ mononucleotides from 3’- OH of duplex
DNA, leaving protruding 5’ termini. Preferred substrate is DNA with
blunt or 5’ protruding ends. It has several applications :a) Generating single stranded templates for sequencing
b) To produce unidirectional sets of progressive deletions in
populations of linear DNA molecules with one resistant (3’)
terminus and one susceptible (blunt or 5’) terminus, inactive on
single stranded DNA.
Ribonuclease T1 Isolated from Aspergillus, endonuclease that cleave RNAs at 3’–(p) of G
residues, producing oligo nucleotide terminal guanosine 3’ phosphates. It
is used to remove unannealed regions of RNA from RNA-DNA hybrids.
Ribonuclease A Endoribonuclease that cleave single stranded RNA at 3’ pyrimidine
residues, generating 3’ phosphorylated mononucleotides and
oligonucleotides.
Deoxyribonuclease Endonuclease which cleaves double stranded or single stranded DNA
preferentially adjacent to pyrimidine (c or T) residues generating 5’phosphorylated di, tri and tetra nucleotides, works optimally in the
presence of Mg2+ cleaving duplex DNA independently, while in the
presence of Mn+2, the enzyme cleaves both the strands of the DNA at
approximately same site, producing blunt ends or fragments with 1-2
base overhangs. It doesn’t work on RNA.
15
8. Alkaline Phosphatase (AP)
Alkaline Phosphatase is an important tool in molecular biological processes like cloning. It
removes 3’- phosphate groups from a variety of substrates. Although in laboratory, it is used
to catalyze the removal of terminal 5’-(P), residues from single stranded or double stranded
DNA and RNA. The resulting 5’-OH termini can no longer take part in ligation reactions,
thus prevents self religation of vectors, reducing the background of transformed bacterial
colonies that carry empty plasmids. This enzyme works optimally at alkaline pH (range of 89 in the presence of low Zn+2 concentrations) and hence derived the name.
Alkaline Phosphatase is isolated from various sources:a) Bacterial Alkaline phosphatase
Secreted in monomeric form into the Periplasmic space of E.coli, where it form dimers and
gets catalytically activated. It’s a remarkably stable enzyme and is resistant to inactivation by
heat and detergent. Thus, bacterial alkaline phosphatase is the most difficult to destroy in the
reaction mix.
b) Calf Intestinal Phosphatase
Calf intestinal phosphatase is a dimeric glycoprotein isolated from bovine intestine. This has
much more practical significance than bacterial alkaline phosphatase, since it can be readily
inactivated from the reaction mixture using proteinase K or by heating at 650C for 30 minutes
or 750C for 15 minutes in the presence of 10mM EGTA.
c) Shrimp alkaline phosphatase
Extracted from cold water shrimp, can be inactivated readily by heating at 650C for 15 min.
9. Terminal Deoxy Nucleotidyl Transferase
Terminal transferase is an unusual DNA polymerase found only in prelymphocytes and in
early staqes of lymphoid differentiation. Synthesis of single stranded tails at the 3’ ends of
either single stranded DNA or double stranded DNA with protruding 3’ termini, by the
enzyme Terminal Deoxy Nucleotidyl Transferase, is called tailing, can be used to generate
protruding ends of defined sequence to facilitate cloning of fragments. It can be used to
generate protruding ends of defined sequence, e.g poly A tails on the 3’ ends of the DNA
insert and poly T tails on 3’ ends of the vector. Thus, the protruding ends of the DNA insert
and vector will base pair under appropriate annealing conditions. Mg2+ cation is preferred
when the nucleotide to be added is a purine while Co2+ is preferred for the addition of
pyrimidines. The enzyme strongly prefers DNA with protruding 3’ terminus, although blunt
or recessed 3’ termini are also used, but less efficiently, in buffers of low ionic strength with
Co2+, Mg2+ or Mn2+ as bivalent cations. As many as thousands of deoxynucleotides can be
incorporated using this enzyme on a template of DNA. Single nucleotide can be added to the
3’ termini of DNA if modified bases like dideoxynucleotides or cordycepin triphosphates are
used instead of natural deoxynucleotide triphosphates.
Polymerase Chain Reaction (PCR)
PCR is a robust, speedy and flexible method, conceived by and put in practice by Kary Mullis
in 1985. It is used to generate microgram quantities of DNA (up to billions of copies) of the
desired DNA (or RNA), from a single copy in few hours. The PCR process has been
16
completely automated and compact thermal cyclers are available in markets. The
fundamental of PCR reaction with its components are as follows:
1.
A thermostable DNA polymerase to catalyze template dependent synthesis of DNA
For routine purpose, Taq polymerase is the enzyme of choice. However, when great
fidelity is required, when working with larger lengths of target amplicons, mutant forms
of Taq, having proof reading exonuclease activity are used to generate faithful copies of
a gene or else cocktail of both enzymes are used to compensate for the low processivity
of proof reading enzymes. eg. A mixture of Taq & Pfu polymerase has desirable features
of both high processivity (a feature of Taq polymerase) and fidelity which is contributed
by Pfu in one Reaction mixture, one can generate high yield of accurate amplified
products up to 35 kb.
2.
A pair of synthetic oligonucleotides to prime DNA synthesis.
Appropriate designing of primers is essential for accurate. Appropriate designing of
primers is essential for accurate amplification avoiding unwanted sequence
accumulation. The concentration of primer is also crucial. Lower concentrations can
limit the reaction while high concentrations favor mispriming & non-specific
amplification.
3.
dNTPs
Equimolar amounts of all the four nucleotides, dATP/ dTTP/ dCTP/ dGTP are required
to carry out a PCR Reaction.
4.
Divalent cations
Divalent cations are required by all thermostable polymerases for their optimal activity.
The most routinely used Taq Polymerase required Mg+2.
Since dNTPs &
oligonucleotides are known to sequester Mg+2 ions, the molar concentrations of
phosphate groups of dNTPs & primers should be standardized. Thus optimal
concentration of ions for each primers combination & template is crucial.
5.
Monovalent cations
Standard PCR buffers are supplemented with 50 mM KCl.
6.
Buffer
Tris-HCl of pH 8.3 and 8.8 is included in standard PCR reaction at a ionic strength of 10
mM. When incubated at 72oC, a temperature at which Taq Polymerase carries out
polymerisation reaction, the pH of Reaction mixture drops by more than 1 unit,
producing a buffer of pH 7.2.
7.
Template DNA
A template is the DNA containing target sequence to be amplified. The preferred
substrate for DNA amplification is linear DNA rather than closed circular DNA
template. The size is not an important parameter but working with large size DNA may
pose some obstruction. Ideally, one single copy is enough to initiate a PCR reaction but
several thousand copies are seeded while putting a PCR Reaction. The recommended
amounts of template DNA in case of yeast DNA, bacterial DNA and plasmid DNA that
should be used per reaction are 10ng, 1ng & 1 pg respectively.
17
PCR Iterative programming
A PCR cycle comprises of basically three repeated reaction including denaturation of the
template DNA followed by primer annealing to target sequence & extension of the primers
by DNA polymerase.
DNA denaturation
The optimum temperature for DNA denaturation is determined by the % GC content of each
particular template DNA. The more is the proportion of GC, higher temperatures are
required to denature the parental duplex strands. At lower temperature, only A-T regions
start melting. Longer DNA templates require longer denaturation time to separate them
completely. Routinely 950C is the temperature used for denaturation, since it is the maximum
temperature at which Taq Polymerase can exhibit its activity. For GC rich DNA,
thermostable polymerase isolated from Archae that can sustain even much higher
temperature, without any deleterious effects, are preferred.
Annealing
The temperature which is required to anneal primers to the template DNA is critical. It
should not be too high to avoid poor annealing and even not too low which facilitate
nonspecific annealing, resulting in accumulation of unwanted sequences. As such there is no
proper formula to calculate annealing temperature. Conditions are optimized by performing
several hit & trial PCRs at temperature ranging from 2-100C below the melting temperature,
calculated from the oligonucleotide primer sequence. The most commonly used formula to
determine the Tm from primer sequence is: 4(G+C) + 2(A+T), where G/C/A/T denotes,
number of times these bases are present. When the temperature is lowered to carry out
annealing Reaction, there are chances of renaturation of template DNA.
Extension
Extension reaction is usually carried out at temperature favorable to the themostable
polymerase used in the Reaction. For Taq polymerase 72-780C is the optimum temperature.
In 1st two cycles, polymerase extends beyond the sequence complementary to the binding site
of the primer but after the 3rd cycle, only sequence that is defined & limited by the binding of
primers are accumulated in a geometrical progression. As a thumb rule, for every 1000 base
pair, 1 minute is used.
No. of cycles
Number of cycles that are to be used to amplify a particular region from the target DNA
depends on the initial concentration of template present and the efficiency of primer
extension and amplification.
Variations from the conventional PCR
Hot start PCR
It a general modification in the protocol followed for setting a conventional PCR to maximize
the yield of desired amplified product and simultaneously to suppress any non specific
amplification. This is accomplished by withholding an essential component that plays a
critical role in the reaction e.g DNA polymerase. It is not added until the temperature is raised
high enough that inhibits non specific priming or oligomerisation of primers. Then to the
preheated mixture, Taq DNA polymerase is supplemented to facilitate the extension reaction.
Initial methods also involve use of monoclonal antibodies against polymerase. As the
temperature rises, the antibody dissociates from the enzyme & renders it active. Another
18
method is the use of enzyme ‘Ampli Taq Gold’ which requires heating to 930C for 10
minutes to become fully active.
Figure 1: Because both strands are copied during PCR, there is an exponential increase of
the number of copies of the gene. Suppose there is only one copy of the desired gene before
the cycling starts, after one cycle, there will be 2 copies, after two cycles, there will be 4
copies, and three cycles will result in 8 copies and so on. Thus, Polymerase chain reaction
(PCR), is a common method of creating copies of specific fragments of DNA. PCR rapidly
amplifies a single DNA molecule into many billions of molecules. In one application of the
technology, small samples of DNA, such as those found in a strand of hair at a crime scene,
can produce sufficient copies to carry out forensic tests.
19
The exponential amplification of the desired gene in a PCR reaction
Touch down PCR
It is another variation of conventional PCR that is followed to optimize yields of specific
amplified DNA when the Tm of hybrids between oligonucleotides (primers) and their target
sequences is not known with certainty. In this, a range of annealing temperature is utilized
in PCR. The annealing temperature during the 1st two cycles of amplification is set to 30C
above the calculated Tm of a perfect hybrid between most GC rich oligonucleotide in the
Reaction & its target DNA. Then the annealing temperature is reduced by 10C each cycle.
When appropriate temperature is encountered, amplification of target sequence begins. But
lowering of temperature continues till the temperature at which nonspecific priming can also
occur, but till that time, the desired product will be in hegemony.
Nested PCR
It is used to amplify specific sequences of DNA from a large complex DNA. It utilizes two
pairs of PCR primers for amplification of a single locus. The first pair amplifies the locus as
done by any PCR. The second pair of primers called as nested primers bind within the 1st
PCR product & produces a second PCR product that will be shorter than the first one. The
advantage of using nested PCR is, if wrong locus were amplified by mistake, the probability
of inaccurate second amplification will be low.
Anchored PCR
When sequence of only one end of the desired segment or gene is known, the primer
complimentary to the 3’ end is used to produce several copies of only one strand of the gene.
Now a poly G (or any other homopolymer) tail is added to the 3’ ends (the end for which the
primer is not available) of the single stranded DNA copies produced by PCR. This allows the
use of complimentary homopolymer poly C, to be used as primer for copying the DNA
generated by PCR, and give rise to the complete DNA duplex that can be amplified.
Asymmetric PCR
It is used to generate single stranded copies of DNA sequence which can be directly used for
DNA sequencing. To achieve this, the quantities of two primers for the 3’ end are so adjusted
20
in the reaction mixture that one of them is exhausted before the termination of PCR reaction.
As a result, in the last cycles, only a single strand of DNA is copied which are the ideal
starting materials for DNA sequencing.
Inverse PCR
Inverse PCR is used to clone sequences flanking a known sequence. Flanking sequences are
digested and ligated to make a circular DNA. PCR primers pointing away from the known
sequences are used to amplify the flanking sequences. Inverse PCR (IPCR), described by
Ochman et al in 1988, is a method for the rapid in vitro amplification of DNA sequences that
flank a region of known sequence. The method uses the polymerase chain reaction (PCR), but
it has the primers oriented in the reverse direction of the usual orientation. Inverse PCR has
many applications in molecular genetics, for example, the amplification and identification of
sequences flanking transposable elements.
Degenerate PCR
Degenerate PCR is in most respects identical to ordinary PCR, but with one major difference.
Instead of using specific PCR primers with a given sequence, you use mixed PCR primers.
That is, if you do not know exactly the sequence of the gene you are going to amplify, you
insert "wobbles" in the PCR primers where there is more than one possibility. Degenerate
PCR primers used to amplify unknown DNA sequences based on similar known sequences.
Primers which have a number of options at several positions in the sequence so as to allow
annealing and amplification of a variety of related sequences.
Introduction of restriction endonuclease sites in the PCR product
In another variation, the recognition sequence for a given restriction endonuclease are added
to the 5’ ends of both the primers used in the PCR amplification of the desired DNA segment.
The recognition sequence will remain as single stranded tails when the primers are annealed
to the original template DNA. This results in amplification of desired segments of DNA
along with inbuilt endonuclease sites which are used during subsequent cloning of the
amplified segment in different vectors.
PCR to introduce mutations at specific sites- Site Directed Mutagenesis
PCR can be used to induce desired mutations at specified sites in any gene. The sequence of
the site where mutations has to be created is used to make oligonucleotide primers. The
mutations in the desired gene segment are introduced by designing primers with desired
changes in their base sequence. These modified primers are used in PCR amplification of the
desired gene. Thus, the new copies of the gene so generated, carry the appropriate mutations
at specific sites, which are their in the base sequence of primers.
Vectors
Plasmids
The word “plasmid” was introduced by ‘Joshua Lederberg’ in 1952 and is defined as an
extrachromosamal circular DNA molecule which are not part of the bacterial genome. A
plasmid is an independent, circular, self replicating DNA molecule that carries few genes
only. A plasmid is usually not essential for the host cellexcept under some specific
conditions. The numbers of plasmids within a cell generally remains constant from
generation to generation and have evolved mechanisms to partition plasmid molecules
accurately to daughter cells during replication. Plasmids are usually dependent on host
synthesized enzymes and proteins for their replication and transcription. Their size ranges
21
from 1-2000 kilo base pairs and they carry additional functions that are advantageous to the
host such as they produce enzymes which degrade antibiotics or heavy metals or complex
organic compounds or produce colicins, enterotoxins etc or produce restriction and modifying
enzymes. Replication of plasmid DNA is coupled with the host replication machinery in two
different ways:
Stringent control: in which one or two plasmids are made during every round of host DNA
replication
Relaxed control: where 10-200 copies of the plasmid is made during each round of bacterial
replication.
The three most widely studied types of plasmids are:
1. F plasmids: responsible for conjugation
2. R plasmids: carry genes for resistance to antibiotics
3. Col plasmids: code for colicins, the proteins that kill sensitive E.coli cells and also
carry genes that provide immunity to the particular colicin
Plasmid incompatibility
Plasmid incompatibility arises when two different plasmids share same replication
machinery. Then the two plasmids compete with each other during replication and
subsequent step of portioning into daughter cells. Thus, plasmids carrying the same replicon
belong to the same incompatibility group. These plasmids have to be maintained by using
antibiotics as selection pressure.
Plasmids as cloning vector
A vector is any DNA that can take foreign DNA by ligation using complementary site in the
plasmid. These sites are generated by digesting the DNA & vector with the same Restriction
enzymes. It should be ensured that the restriction enzymes used for cloning purpose should
be present only once in the plasmid so that a single linear molecular can be generated and
sites should not be present in the foreign DNA to be inserted. Vectors contain genetic
markers that confer strong growth advantages under selective conditions. The plasmid DNA
containing foreign DNA as insert is usually introduced artificially by transformation.
Selection is then carried out by screening for the colonies those have acquired the plasmid
and hence grow on Antibiotic containing plates. Routinely used Antibiotics include
Ampicillin, Kanamycin, chloramphenicol, carbenicillin & tetracycline.
Most versatile cloning vectors should have small size, high copy number and are able to
accept fragments of foreign DNA generated by cleavage with a wide variety of Restriction
enzymes. Smaller size of plasmid facilitates better stability and higher efficiency of
transformation. Earlier used plasmids in cloning, either replicate poorly or carried unsuitable
selectable markers and very few restriction sites. The first plasmid with all desirable features
was pBR322 that has relaxed mode of replication with high copy number, ampicillin &
tetracycline as selectable markers with important restriction enzyme sites. Pst I and Pvu I are
located within ampicillin resistance gene and BamH I and Sal I are located within tetracycline
resistance gene. The presence of restriction sites within the antibiotic markers tetracycline
and ampicillin permits an easy selection for cells transformed with pBR322. insertion of
foreign DNA fragment into the plasmid using restriction enzymes Pst I or Pvu I, places the
DNA insert within ampicillin resistance gene and makes it non functional. Bacterial cells
22
containing such a recombinant will be unable to grow in the presence of ampicillin but grow
well on tetracycline containing plates. Similarly when BamH I or Sal I is used, the DNA
insert is placed within the tetracycline resistance gene making it non functional. Such
recombinants grow well on ampicillin but not on tetracycline. Thus it allows an easy way of
selection of a single bacterial cell having recombinant pBR322 from 108 other wild type
pBR322 containing cells. The name PBR denotes the following: p signifies plasmid, B is
from Boliver and R is from Rodriguez, the two scientists who developed pBR322. Nowadays,
it is the most widely used cloning vehicle and many descendant forms are extracted from it.
Another series of vectors, pUC vectors (derived its name from the place where it was
developed, University of California) revolutionized the cloning strategies. The number of
restriction enzyme sites was expanded. Moreover, it is the first plasmid to contain a series of
synthetic cloning sites, termed as polylinkers, MCS (Multiple Cloning Sites) or polycloning
sites eg. pUC19 has an array of 13 restriction enzyme sites which are very unique and can be
used efficiently for cloning.
Advantages of pBR322 over pUC series of vector
pBR322 carried two different selectable markers, tetracycline and ampicillin. Insertion of
foreign DNA sequences into one of these sites inactivates either of the two markers. The
recombinant plasmids can therefore be distinguished from the empty parental vector by virtue
of its ability to grow only one Antibiotic. This phenomenon is called as Insertional
inactivation which is not possible in pUC vectors which carry only one Antibiotic resistance
gene, usually for Ampicillin and a clustered set of MCS. But pUC series of vector
demonstrate a phenomenon called as α complementation. The recombinant plasmids can
readily be distinguished from parental pUC plasmid by visualizing the color of bacterial
colonies. PUC vectors and their derivatives carry a short segment of E.coli DNA that has
regulatory sequences of lacz gene and code for –NH2 termini of β-galactosidase (called as α
fragment). The fragment expressed by pUC vector (α), when introduced in E.coli strains that
contain inactive C- terminal fragment (ω-fragment), complements for the β-galactosidase
activity. But if a segment of foreign DNA is cloned into the site of pUC vector, carrying α
fragment, the coding region gets disrupted and α complementation is abolished. Thus,
bacterial colonies containing recombinant plasmids are therefore ampicillin resistant but
contain no β –galactosidase activity. Contrary, to this, the parental plasmid carrying colonies,
will also be ampicillin resistant but are able to hydrolyze chromogenic substrate X-gal (5bromo-4-chloro-3-indole- β –D-galactoside) by cleavage of β –galactoside bond. Thus, the
plate will contain two visually distinct colonies: The parental non recombinant deep blue
colonies and recombinant white colonies.
Plasmid vectors with origin of replication derived from single stranded Bacteriophages
M13 or f1 are single stranded filamentous bacteriophage. Many routinely used vectors
contain origin of DNA replication derived from these bacteriophages. Such vectors are often
called phagemids. They confer advantage of two separate modes of replication, one as
conventional double stranded DNA and other as a template to produce single stranded copies
of one of the phagemid strand. Thus single strands of DNA can be packed into the phage
particles. The production of single stranded DNA is induced when bacteria carrying
phagemid are infected with a helper bacteriophage that can supplement for the genes required
for production of virions in trans. The orientation of the origin determines which of the two
strands will be encapsulated in the virus particles. There are many plasmid vectors that carry
promoters derived from bacteriophages like T3, T7 or SP6, adjacent to the MCS. Hence, the
23
foreign DNA so inserted can be transcribed in vitro in the presence of specific RNA
polymerase and Ribonuclease precursors. Presence of bacteriophage promoters on both sides
of MCS allows either of the stands to be transcribed.
Expression plasmid vectors
There is an array of plasmid vectors that can generate large amounts of mRNA in vivo from
cloned foreign genes. The requisite features of a plasmid to serve as an expression vector
are:
a)
Minimal level of basal expression under repressed condition.
b)
Shine Dalgarno sequence upstream of ATG initiation codon.
c)
Presence of tags which are recognized by specific antibodies. Epitope tagged
proteins thus can be visualized by probing with antibodies directed against tags
and can be purified from rest of the host protein using affinity chromatography.
d)
An appropriate system for fast induction of expression of cloned gene.
Cloning
PCR Mediated Gene Cloning
There are three strategies for cloning PCR products1) T/A cloning is the easiest cloning method. T/A cloning takes advantage of the terminal
transferase activity of Taq polymerase and other non-proofreading DNA polymerases
which adds a single 3'-A overhang to each end of the PCR product. The resulting PCR
product is then ligated into a linear vector with a 3´ terminal 'T' or 'U' at both ends.
2)
Directional cloning. A restriction enzyme target site is introduced into each of the PCR
primers. The resulting PCR product and cloning vector are digested with the restriction
enzymes to generate complementary ends at the PCR product and the vector which are
then ligated.
3)
Blunt-end cloning. Blunt-end PCR product generated by proof-reading polymerase
such as the Pfu DNA Polymerase can also be cloned into a blunt-end vector.
The cloning of PCR-amplified fragments into a linear vector is typically a rapid and efficient
process. However, not all PCR fragments will clone with the same efficiency into the same
vector. These differences may be due to fragment size, insert toxicity, and the complexity of
the insert. The size of the fragment being cloned is a primary contributor to the overall
cloning efficiency. Large fragments of DNA (≥ 5 kb) are amenable to cloning in high-copy
number vectors, yet at a much lower efficiency. Optimization of molar concentration ratios of
the vector to insert is critical to ensure efficient cloning. Successful cloning ratios may range
from 1:1 to 1:10. For example, if the vector is 3 kb and the insert is 1 kb, one-third the
amount of insert needs to be added to attain a 1:1 molar ratio.
Cloning using plasmid vectors
Cloning in brief is cleaving closed circular plasmid DNA with one or more Restriction
enzymes and ligating it in vitro to foreign DNA bearing compatible terminus. This is then
transformed into an appropriate E.coli strain and the transformants are then screened for
24
recombinants by either PCR using gene specific primers or restriction enzyme digestion to
check for the presence of desired gene fragment in the vector.
Cloning of DNA with overhangs
Restriction enzymes are known to cleave the DNA within their recognition sequences but
asymmetrically and thus generate 1-6 base pair long overhangs or protruding ends. When the
ends protruding from foreign DNA fragment and the vector are compatible, they can anneal
by hydrogen bonding and form a circular recombinant plasmid that can be easily transformed.
Annealing reaction involves bringing of 5’ phosphate and 3’ –OH residues together and
finally formation of a phosphodiester bond catalyzed by the enzyme DNA ligase.
Directional cloning
1. Both ends cohesive (protruding) and separately matched
This situation arises when the foreign DNA fragment is produced by digestion with two
restriction enzymes having different Recognition sequences. Hence the foreign DNA
fragment will be non complementary and unable to ligate to each other. But it will ligate to
the plasmid vector which is cleaved with the same two restriction enzymes. This will
generate circular recombinants containing a single insert in a predefined orientation. Also in
this situation, only the recombinant vector, containing the insert, will circularize since the
ends of the vectors are non compatible to ligate to each other, as they are generated by cutting
with two different restriction enzymes. The scheme of directional cloning is shown below in
Figure2.
2. Both ends cohesive and compatible
This situation arises when both vector and insert are cleaved using the same restriction
enzyme. Both the vector DNA and the foreign DNA are mixed under annealing conditions
which allow pairing between cohesive ends of the vector and the insert DNA. The DNA
insert can go in either of the two orientations. The orientation of the inserted DNA is
significant when the expression of the insert is required. In addition to the formation of
recombinant vector few undesirable products will also be formed like: the cohesive ends of
the vector will itself pair to form unaltered circular vector. Similarly, the two ends of the
insert DNA can also join to form concatemers, which may not pose a problem since it lacks
an origin of replication and will therefore dilute out. The generation of re-circularized vector
DNA can be prevented by treating the digested vector with alkaline phosphatase which
removes 5’ phosphate present at the ends of the vector.
Cloning blunt ends
Ligation of foreign DNA to a linearized plasmid, both carrying blunt ends, is comparatively
an inefficient reaction. Only at high concentrations of vector, insert and enzyme, blunt ended
molecules can be ligated and phosphodiester bonds can be made between these residues. The
DNA insert will get ligated in either of the orientation. Usually PEG 8000 at the
concentration of 5 % is used to increase macromolecular crowding.
25
EcoR I
BamH I
GAATTC
CTTAAG
GGATCC
CCTAGG
Plasmid
Cut with EcoR I and BamH I restriction enzymes at the respective sites shown, arrows indicate the base at
which the enzyme cuts the DNA molecule
5’ (P)
G
CTTAA 3’OH
3’ OH
AATTC----G
G---CCTAG
GATCC
5’ P G
Plasmid (vector digested with BamH I and EcoR I)
Ligated to
EcoR I
G GAATC
CTTAA G
GGATCC
CCTAGG
BamH I
Cut foreign DNA with BamH I and EcoR I
Figure2
Methods for Selection and/or Screening of Desired Recombinants
Selection refers to applying conditions that allow the desired cells or phages (containing
vector or vector and insert) to replicate while preventing others from replicating. Typical
selections include:
ƒ antibiotic sensitivity and resistance;
ƒ nutrient requirements;
ƒ plaque formation.
Screening allows all cells to grow, but tests the resulting clones for particular properties.
Often these are indicative of the presence of an insert in the vector. Screening properties used
include:
ƒ antibiotic sensitivity and resistance;
ƒ nutrient requirements;
ƒ plaque type;
ƒ blue-white selection ( -galactosidase activity);
ƒ specific (by nucleic acid hybridization, PCR with gene specific primers or
antibodies).
26
Screening of Clones
By PCR
This is the fastest way to screen bacterial colonies. A primer pair is chosen which has a
sequence derived from vector (flanking primer) and a gene specific primer. This allows going
to the replica agar plate on the same day and setting up miniprep cultures of the likely
candidate colonies.
By Hybridization with radiolabeled probe
1.
2.
3.
Lysis of Colonies and Binding of DNA to Nitrocellulose Filters
The colonies are lifted from agar plates onto nitrocellulose membranes, lysed and
neutralized and baked with the bacterial DNA fixed to the membranes.
Labeling of DNA-Probe with 32P
Using DNA polymerase, templates, and primers in combination with radiolabeled
nucleotide (either [a-32P]dATP or [a-32P]dCTP), a radioactive probe is synthesized. The
procedure works with either exact size templates or any (random or specific) primers or
with templates within a vector and specific primers.
Hybridization to Nitrocellulose Filters Containing Replicas of Bacterial Colonies
After the DNA has been fixed to the filters by baking, wash step removes bacterial
debris off the filter surface. Filters then are prehybridized to block binding sites, and the
radiolabeled probe added thereafter will compete for specific binding sites. After
washing, the air died filters are exposed to an X-ray film which shows positive colonies.
Host vector relationship in cloning of the genes
Any DNA cloning procedure consists of:
Generation of DNA fragment for cloning: the source can be genomic DNA, cDNA generated
from mRNA or chemically synthesized gene fragment.
Modification of the termini of DNA and vector to make them compatible with each other
Ligation of the DNA fragment and vector
Introduction of the recombinant DNA into a suitable host
Selection and screening of the recombinant transformants
Cloning can be viewed from two different aspects:
Homologous gene cloning: cloning of a gene into the host from which the genetic
information was derived
Heterologous gene cloning: cloning of a gene into a new host strain
Following are the hosts that are widely used for cloning of genes:
- Bacteria (E. coli)
- Yeast (S. cerevisiae)
- Insects (D. melanogaster)
- Plants (Arabadopsis thaliana)
- Mammals (Mus musculus)
A cloning host must:
- be easy to handle and propagate
- have a defined genotype
- accept a range of vectors
27
DNA cloning requires a bacterial host strain with high transformation efficiency, which does
not cleave the recombinant DNA, provides good yields of high quality plasmid or phage
DNA, and consists of components for various vector screening systems. An expression strain,
on the other hand, must have the appropriate regulatory proteins for expression of cloned
genes—a requirement that may not be compatible with attributes of cloning strains. To
improve yields of expressed proteins from the cloned genes, expression strains are often
deficient in some proteases. For the pET system, expression hosts are λDE3 lysogens, which
have the inducible gene for T7 RNA polymerase.
E. coli is often used as the host cell for expression of foreign genes because the control of
gene expression has been studied most extensively and the organism is most easy to grow and
manipulate. The inclusion of regulatable promoters in expression vectors allows the
expression of foreign gene products that are even toxic to the cells/host. The expression of the
eukaryotic genes in E. coli requires that the coding region should be placed downstream from
a strong E. coli promoter since eukaryotic promoters are not easily or weakly recognized by
the E. coli RNA polymerase. Few strong promoters which are used generally for the
expression of foreign genes in E. coli are bacteriophage lambda PL, bacteriophage lambda PR,
lac, trp, tac (trp-lac hybrid). Few limitations of using E. coli for the expression of foreign
genes are:
No enzyme to process eukaryotic introns in prokaryotes and therefore only cDNAs
and intronless genes can be expressed in bacterial cells
No post translational modification like glycosylation and phosphorylation and any
protein which requires these modifications for its biological activity will be virtually
inactive.
Bacterial cells lack proteolytic enzymes found in eukaryotic cells that are able to
process the precursor peptides and release mature form of the proteins.
A number of features have been incorporated into E. coli DNA cloning strains to facilitate
transformation of the initial ligation reactions, screening for recombinants, stability of the
recombinant plasmid, and high quality plasmid DNA preparations.
Genetic features to look for are:
1. lacZDM15 encodes an enzymatically inactive b-galactosidase lacking amino acids 1141. Some cloning vectors encode the deleted b-galactosidase amino acids (lacZa or
lacZ´), which, when expressed, can associate with the inactive protein in the host to
generate active enzyme. The combination of host strain and vector allow blue/white
screening for recombinant plasmids by a-complementation.
2. recA encodes a protein essential for homologous recombination in E. coli. Plasmids in
host strains deficient in recA are less likely to incur deletions or other rearrangements.
Plasmid DNA prepared from these strains contains monomer circles and lack the
multimers common in preparations from RecA+ strains.
3. endA encodes a thermostable DNase that can degrade plasmid DNA during
purification. Host strains deficient for endA allow higher yields of plasmid DNA.
4. hsdRMS encodes the enzymes responsible for the Eco restriction-modification system.
For transformation with unmodified recombinant plasmid DNA, strains must be
restriction minus.
5. mcrAB encode enzymes that restrict foreign DNA.
28
Bacteriophage vectors
A phage (also called bacteriophage) is a small virus that infects only bacteria . Like viruses that
infect eukaryotes , phages consist of an outer protein coat and the enclosed genetic material
(which consists of double-stranded DNA in 95% of the phages known and few have RNA as
the genetic material) of 5-650 kbp (kilo base pairs ) with a length of 24-200 nm . The vast
majority of phages (95%) have a tail which has the ability to bind to specific molecules on
the surface of their target bacteria and thus inject their genetic material into the host. Phages
were discovered independently by Frederick Twort in 1915 and by Felix d’ Herelle in 1917.
Phages infect only specific bacteria. Some phages are virulent, that is upon infecting a
bacterial cell, they immediately start reproducing, and within a short time, lyse (destroy) the
bacterial cell, releasing new phage particles. These young phages burst from the host cell
(killing it) and infect more bacteria. These types of phages are called as Lytic phages. Some
phages (so-called temperate phages) can instead enter a relatively harmless state, either
integrating their genetic material into the chromosomal DNA of the host bacterium (much
like endogenous retrovirus in animals) or establishing themselves as plasmids. These
endogenous phages, referred to as prophages, are then copied with every cell division
together with the DNA of the host cell. They do not kill the cell, but monitor (via some
proteins they code for) the status of their host. When the host cell shows signs of stress, the
endogenous phages become active again and start their reproductive cycle, resulting in the
lysis of the host cell. An example is phage λ of E. coli . Sometimes, prophages even provide
benefit to the host bacterium while they are dormant, by adding new functions to the bacterial
genome , a phenomenon called Lysogenic Conversion . A famous example is the harmless
Vibrio bacteria strain, which is turned into Vibrio cholerae by a phage, causing cholera.
Phages play an important role in molecular biology as cloning vectors to insert DNA into
bacteria.
Lambda-Replacement Vector
Bacteriophage λ with its large and complex genome, for use as a vector, would seem to be
impossible. Wild type DNA has multiple sites for most useful restriction enzymes but they
are located in the genomic DNA essential for lytic growth of virus. Initially it was thought,
that since bacteriophage λ particles will not accommodate DNA larger than the viral genome,
therefore suitable only for small foreign fragments. Methods have developed large number of
vectors that can accept and propagate fragments of foreign DNA generated by a variety of
different Restriction enzymes. The λ genome remains linear inside the phage head but
circularizes as soon as bacteriophage DNA goes inside the host E.coli. The single stranded
protruding ends of 12 bases, called as cohesive site, (Cos site), anneal to form a closed
circular molecule necessary for replication. The sealed cohesive ends are the sites of cleavage
during packaging of mature DNA into phage heads. The λ DNA must be greater than 38kb
and smaller than 52kb to be packaged into phage head. The genes for lysogeny are located in
this segment which is removed to make high capacity vectors which can accommodate larger
size of foreign DNA.
Vectors that have a pair of cloning sites flanking a segment of non-essential DNA are known
as replacement vectors. Removal of the central non essential stuffer fragment reduces the size
of vector to a size that cannot be packaged into bacteriophage particles. Particles can be
packed only by ligating a segment of foreign DNA. The range of DNA that can be packaged
lies between 8kb–24 kb. If one wants to clone longer DNA fragments, deletion of essential
bacteriophage genes, is required, which then have to be supplied in trans. Cloning in
bacteriophage vectors is advantageous since for successful packaging, there should be enough
29
DNA. No infectious particles are obtained that lack an insert or contain an insert that is below
the lower size limit for a particular vector. Inserts with DNA too large are also not
successfully cloned. Therefore packaging into phage heads of the vector DNA after DNA
insertion offers an efficient selection strategy for recombinant vectors. Thus, the size of the
vector and insert DNA should be carefully adjusted for an effective selection. Few examples
of vectors that employ this strategy are bacteriophage λ vectors EMBL3 and EMBL4.
Cloning in bacteriophage vectors
The vector contains a restriction site (e.g.,an EcoRI site) for insertion of cloned DNA. In addition, cos sites
which are required for packaging DNA into phage particles, are present on both ends of the vector DNA. Insert
DNA is ligated to the vector, and the recombinant molecules are packaged into phage particles when mixed
with phage proteins. The recombinant phages are then used to infect E. coli. Each recombinant phage, which
carries a unique insert of cloned DNA, forms a single plaque in the infected bacterial culture. Progeny phage
carrying unique DNA inserts can then be isolated from individual plaques and grown in large quantity.
This type of vector has a loading capacity of 10-23 kb and consists of a full length lambdamolecule with two identical restriction sites flanking a non-essential region called stuffer
fragment. The idea behind it is that the stuffer fragment is deleted and replaced by foreign
DNA. Again a selection system is required to differentiate between wild type and
recombinant phage.
30
This is done by placing relevant genes onto the stuffer fragment the loss of which gives rise
to a detectable phenotypic signal. Two examples are given:
1. LacZ inactivation: This is done by inserting the lacZ gene onto the stuffer fragment. Loss
of the fragment and therefore lacZ can be monitored by the blue/white colour
discrimination.
2. Spi-phenotype: In this case the stuffer fragment carries the phage genes red and gam
necessary for lambda-DNA replication. Whereas the wild type lambda is not capable of
infecting a E.coli P2 lysogen due to the presence of red and gam (Spi phenotype in short
for sensitive towards P2 prophage inhibition), loss of red and gam in all recombinant
phage particles results in plaque formation on a E.coli P2 lysogen; hence all plaques
should contain recombinant phage molecules! The most popular lambda-replacement
vector for library construction is EMBL3A with Sal I, BamH I and EcoR I sites flanking the
stuffer fragment.
Insertion Vectors
Vectors that have a single target site for insertion of foreign DNA are known as insertion
vectors. 20% DNA that is not required for lytic growth is removed and therefore insertion of
foreign DNA resumes the size back to something like its full length and can be packaged in
vitro. Maximum size of DNA that can be accommodated varies from 9- 11 kb.
For DNA of larger sizes, high capacity vectors are designed like:Vector
Capacity
Origin of replication
Host
Cosmid
BAC
YAC
30-45 kb
120-300
250-400
Col E1 Replicon
Foreign
ARS
E. coli
E. coli
Yeast
Cosmids
Smallest capacity for foreign DNA, contain one or two copies of small region of
bacteriophage λ that is the cohesive end site (Cos), containing all the cis-acting elements
required for packaging of viral DNA into virions. The vector also contains sequences
required for terminase so that it can bind and cleave and under appropriate conditions the
DNA is packaged into empty λ phage particles. It should have unique restriction sites, a
replication origin and selectable markers. In vectors such as supercos-1, two cos sites are
there within Xba I site. The cosmid vectors are opened up by appropriate restriction enzymes
and then mixed with the DNA inserts prepared by using same enzymes under annealing
conditions. Long concatemers so generated are products for packaging into the λ heads. This
selects the DNA to be inserted since for packaging in λ particles, the distance between two
cos sites must be between 38 to 52 kb. Cosmids can accommodate up to 45 kbp long DNA
inserts. Cosmids infect the host cells like λ particles but once inside the host, it will replicate
and propagate as a plasmid. They have been developed in the late 1970s and have been
improved significantly since. They are predominantly plasmids with a bacterial origin, an
antibiotic selection marker and a cloning site, but they carry one, or more recently two cos
sites derived from bacteriophage lambda. The loading capacity of cosmids varies depending
on the size of the vector itself but usually lies around 40-45 kb. The cloning procedure
involves the generation of two vector arms which are then joined to the foreign DNA.
31
Selection against wild type Cosmid DNA is simply done via size exclusion. The strategy used
for cloning in Cosmid vectors is shown below:
Cloning using Cosmid vectors
The cosmid is cut at a Bgl II site next to the cos site. Donor genomic DNA is cut using
Sau3A, which gives sticky ends compatible with Bgl II. A tandem array of donor and vector
DNA results from mixing. Phage is packaged in vitro by cutting at the cos site. The cosmid
with inserts recircularizes once it is inside the bacterial cell.
Bacteriophage Artificial Chromosomes (BACs)
These plasmids are circular DNA molecules carrying conventional antibiotic resistance
marker, origin of replication derived from the F factor of E.coli, an ATP driven helicase
(repE) to facilitate DNA replication and three loci (parA, parB and parC) for proper
partitioning of the plasmid to daughter cells. BAC vectors have no packing constraints and
there is no fixed limit to the size of genomic DNA that they accept. Usually the size of DNA
is approximately 120-kilo base pairs.
32
Yeast Artificial Chromosome (YACs)
These are linear DNA molecules similar to yeast chromosome. Recombinant YACs are made
by ligating large fragments of genomic DNA and then the resultant plasmid is introduced into
yeast by transformation. The vector carries selection marker, DNA sequences called as
telomere, so that the product can be stabilized inside the yeast cell, an origin of replication
called autonomous replication origin, ARS. Large size of DNA can be inserted into YAC
vectors, usually between 250kilobases to 400kilobasepairs. Large size of mammalian
genomic libraries is also made with approximately 1 megabasepairs of foreign inserts.
Insertion of foreign DNA into the cloning site inactivates a mutant expressed in vector DNA
and formation of red rather than white colonies by yeast strain is observed. Thus
transformants are identified as red colonies, which grow in yeast that is mutant for TRP1 and
URA3, which ensure that the cell has received an artificial chromosome and with both the
telomeres since it is complimented for both the mutations. And the colony also contains
foreign DNA because it is red in color.
TEL
TEL
TRP1
ARS1
SUP4
CEN4
URA3
EcoR I
Digest with ECOR I and treated with phosphatase and ligation with restriction digested genomic DNA
TEL
EcoR I
TRP1
ARS1
EcoR I
50-2000kb fragment
TEL
SUP4
URA3
Shuttle vectors
Cloning of foreign DNA is usually carried out primarily in E.coli since the organism is most
thoroughly studied. But subsequent work often requires the foreign segment to be delivered
to different host cells like eukaryotes. A number of vectors are devised to satisfy this
requirement. These vectors are termed as shuttle vectors. These vectors have origins of
replication of various hosts. The also contain fragments of eukaryotic viruses to facilitate
entry into the cell or expression or integration in the cell itself. Thus shuttle vectors allow
DNA to be transferred between two different species where it can be propagated by utilizing
both the origins of replication. Usually the origins of replication are derived from bacterial
and eukaryotic systems. Shuttle vectors also carry antibiotic resistance genes, which are
functional in eukaryotes e.g. Neomycin (G418), Hygromycin, Methotrexate etc. All the DNA
manipulation and characterization are done in prokaryotic system and then the manipulated
DNA is introduced into the eukaryotic systems for protein expression and functional analysis.
Eukaryotic host systems are better for expression of protein for few reasons:
1. Proper folding of the protein to attain functional activity
33
2. Posttranslational modification of proteins for which prokaryotes does not possess any
machinery. The most conventional and convenient model system for expression of
eukaryotic proteins is yeast, Pichia pastoris, which is both genetically and
physiologically well characterized.
Plant Vectors
A vector is a circular DNA molecule capable of independent existence and replication within
a host cell. In case of plants, Ti and Ri are the two most commonly used plasmids which are
used as vectors. Plant cells as such do not possess any endogenous plasmids. But two
plasmids called pTi and pRi, are present naturally in the bacteria, Agrobacterium tumefaciens
and Agrobacterium rhizogenes, respectively. These plasmids provide a naturally occurring
transformation system. A part of the plasmid DNA, called as T-DNA, is transferred into the
genomes of most dicot and some monocot plants. pTi stands for tumor inducing plasmid and
pRi stands for root inducing plasmid. The infection of Agrobacterium tumefaciens is
mediated by transfer of a segment of pTi called as T-DNA into the plant cell. Various
bacterial chromosomal genes, such as chvB, exo genes, cell genes, are concerned with the
biosynthesis of cell attachment polysaccharides due to which the bacterial cells adhere firmly
to the plant cells. While two chromosomal genes are expressed constitutively in bacterial
cells that is expressed at all the times inside a cell, which are responsible for virulence
associated aspects, Agrobacterium tumefaciens Ti plasmid produces tumor like growth from
which roots / shots may sometimes be produced. The infected cells are able to grow in culture
on a medium devoid of any growth regulator while uninfected normal plant cells need
exogenous auxin or cytokinin. These plasmids also carry genes for IAA (Indole Acetic Acid auxin) and cytokinin production which is the reason for indefinite growth on a growth
regulator free culture medium. When pTi is introduced into Rhizobium trifolii, it gains the
ability to produce galls and to utilize opines. The crown gall root cells also synthesize unique
nitrogenous compounds called opines, which are not produced by normal plant cells, which
are not infected, nor are they utilized. The infected cells use opines as their carbon and
nitrogen source. The type of opine produced depends on the bacterial strain. Agrobacterium
tunefaciens strain produces either octopine or nopaline which the Agrobacterium rhizogenes
produce either agropine or mannopine.
Ti plasmid
Ti plasmid is a large mega plasmid conjugative plasmid of ~200kb. pTi is lost when
Agrobacterium is grown above 28oC, such cured bacteria do not induce crown galls that is,
they become avirulent. pTi and pRi, although do not share sequence homology but are unique
in following respects:a) They contain some genes, which are located within their T-DNA which has regulatory
sequences recognized by plant cells, while their remaining genes have prokaryotic
regulatory sequences. As a result, the former are expressed only in plant cells but not
in the Agrobacterium, while the latter are only expressed in the bacterium.
b) These plasmids naturally transfer a part of their DNA, called as T-DNA, into host
plant cells. The T-DNA usually contains following important functional regions.
1. T-DNA contains oncogenes and opine synthesis genes and is transferred into
host plant.
2. Vir region which regulates the transfer of T-DNA
3. Opine catabolism genes for utilization of opines.
34
4. Origin of replication for propagation in Agrobacterium.
The T-DNA contains a 24bp direct repeat border sequence and contains the genes necessary
for tumor / possess gene for auxin and cytokinin biosynthesis. All the genes present in TDNA have eukaryotic regulatory sequences. As a result, these genes are expressed only in
plant cells but never express in Agrobacterium. The vir region mediates the transfer of TDNA into plant genomes and hence is essential for virulence. The genes of vir region are not
transferred but induce the transfer of T-DNA. Also, the genes present in T-DNA are not
responsible for its transfer, but the 24 bp direct repeat at both the left and right ends of TDNA is essential for the transfer. The exact mechanism of transfer of T-DNA is not known
clearly known but is brought by the vir region. The phenols produced by wounded plant
tissue initiates the transfer process. The T-DNA is transferred into the plant cells as single
stranded DNA, which increases the efficiency of its transformation. But, as soon as it enters
into the plant cell, it is immediately converted into a double stranded form. This form
integrates at random sites in the host plant genome by a phenomenon called illegitimate
recombination, which are due to sequence of homology in short segments of the host DNA.
This integration is usually in low copy numbers. Few vectors are derived from pTi (wild
type) due to some problems posed by wild type plasmid eg. The presence of oncogenes
causes a disorganized growth, their large size and lack of cloning sites within the T-DNA,
which are needed for the insertion of DNA segments that has to be cloned.
Disarming
Disarming is the removal of oncogenes from T-DNA and it has resolved many problems.
This disarmed plasmid can still transfer its T-DNA into plant cells. But the cells containing
this modified T-DNA will be non tumorous, produce opines and generate plantlets. Only the
border sequences are necessary for the transfer of any DNA insert placed between them. Thus
pTi and pRi which are disarmed are more in use for gene transfer experiments. But in some
plants, the efficiency of transformation by disarmed pTi is much lower than the wild type
pTi.
Introduction of DNA into plant cells without the involvement of a biological agent like
Agrobacterium leading to a stable transformation is known as Direct Gene Transfer. The
spontaneous uptake of DNA is quite low. The various methods those are utilized for direct
gene transfer are:
1. Chemical methods like PEG, Calcium phosphate
2. Electroporation
3. Particle gun delivery
4. Lipofection
5. Microinjection and Macroinjection
35