Download Just One Nucleotide! Exploring the Effects of Random

Just One Nucleotide!
Exploring the Effects of Random Single Nucleotide Mutations
By Beatriz Gonzalez
[email protected]
Associate Professor, Santa Fe College, Gainesville, Florida
In this exercise, students will explore the effects of single nucleotide mutations. This exercise has
been used successfully with undergraduate biology students – majors and nonmajors, graduate
biomedical engineering students, and in-service teachers of grades 6-12.
Reasons for developing resource:
The Central Dogma of molecular biology is key to every general biology course. After
going over the unit on gene expression, I was surprised when my students were unable to
determine the protein sequence coded by a DNA sequence. Students were able to answer
correctly standardized test questions related to transcription and translation, but were not able to
generate a short peptide sequence when provided with a DNA sequence and a codon chart! I
realized that meant they truly did not understand the concepts. As I implemented the earlier
version of this resource, I uncovered several misconceptions my students had. Examples of
misconceptions and details that were unclear are: confusion between transcription and
translation; assuming the Start and Stop codons relate to transcription and not translation;
starting a new protein every time they see the codon for methionine (AUG); inability to
differentiate between codons and amino acids; realizing that mutations are changes in the DNA
sequence, not the mRNA sequence, and that they are permanent; that amino acids make up
proteins and are covalently bonded; how can different codons code for the same amino acid.
When facilitating this activity, teachers should pay attention to keep the exercise moving
along (as playing with dice often serves as a distraction!) Students must be provided with this
handout where they will record their. The teacher can provide dice, or if no physical dice are
available, a virtual die could be used.
Learning Objectives:
1. Given a coding DNA sequence, determine the mRNA, and based on the transcribed mRNA,
predict the resulting protein sequence
2. Become proficient in using the universal codon chart to determine which codons code for
which amino acids
3. Recognize the importance of the START and the STOP codons
4. Students will review the base complementary rules in DNA and RNA
5. Students will be doing the steps in the central dogma of molecular biology:
DNA è RNA è Protein
6. The exercise will address misconceptions regarding transcription and translation
7. Predict the effect that different types of mutations will have on the protein expressed
8. Students will be able to work in groups
Dr. Beatriz Gonzalez
In-Class Worksheet
Name: __________________________
Just One Nucleotide!
Exploring The Effects of Random
Single Nucleotide Mutations
Learning Objectives:
•
Given a coding DNA sequence, determine the mRNA
•
Based on the transcribed mRNA, predict the resulting protein sequence
•
Become proficient in using the codon chart to determine which codons code for which amino acids
•
Recognize the importance of the START and the STOP codons
•
Predict the effect that different types of mutations will have on the protein expressed
Introduction
The Central Dogma of molecular biology is the concept that cells are ruled by a cellular chain of
command that flow from DNA to RNA to protein. The information is housed in the DNA, transcribed
into a RNA molecule and translated into a protein. Therefore, protein synthesis occurs by means of
transcription and translation. Transcription occurs in the nucleus and produces RNA pairing
complementary bases to the coding DNA strand. This RNA is modified and processed in eukaryotes and
then goes to the cytoplasm where translation takes place (either in polyribosomes or in ribosomes
attached to the rough endoplasmic reticulum). Here the mRNA code is converted into a protein, a chain of
amino acids.
Activity 1: Review of base-pair rules
1. Fill out the following table to review the complementary base-pair rules during the processes of DNA
replication vs. transcription:
DNA Replication
If DNA template has
Newly made DNA
this base:
will have:
A
Transcription
If DNA template has mRNA will
this base:
have:
A
C
C
G
G
T
T
1 Activity 2: Transcription: Making mRNA
In this simple exercise, you will “transcribe” the coding DNA sequence into an mRNA. This particular
region does not contain introns.
1. Using the following coding DNA sequence, determine the resulting mRNA.
DNA sequence: (provided sequence shown 3’→5’) nt = nucleotide
# 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25
nt T T C A T A C G A C G T C T A C G T A A C T G C T
mRNA sequence: (5’→3’)
Activity 3: Translation: mRNA Universal Codon Chart
Translation is the process that takes the information that was passed from DNA into the
messenger RNA and turns it into a linear sequence of amino acids covalently joined by peptide bonds. It
really is a translation from one code, nucleotide sequence, to another code, amino acid sequence.
1. Name the three different types of RNA. Mention their functions.
2. Where are ribosomes made and what are they made of? How do they get to their final destination?
2 3. Refer to the universal codon chart below. The AUG codon, codes both for methionine and serves as
an initiation site; the first AUG in an mRNA's coding region will be the site where translation (not
transcription) into protein begins.
Universal Codon Chart
Table 1 : Codon table. This table illustrates the 64 possible codon triplets.
2nd base
U
UUU Phenylalanine
UUC Phenylalanine
U
UUA Leucine
UUG Leucine
CUU Leucine
CUC Leucine
C
CUA Leucine
1st base CUG Leucine
AUU Isoleucine
AUC Isoleucine
A
AUA Isoleucine
1
AUG Methionine
GUU Valine
GUC Valine
G
GUA Valine
GUG Valine
C
A
G
UCU Serine
UCC Serine
UCA Serine
UCG Serine
UAU Tyrosine
UAC Tyrosine
UAA Stop
UAG Stop
UGU Cysteine
UGC Cysteine
UGA Stop
UGG Tryptophan
CCU Proline
CCC Proline
CCA Proline
CCG Proline
ACU Threonine
ACC Threonine
ACA Threonine
ACG Threonine
GCU Alanine
GCC Alanine
GCA Alanine
GCG Alanine
CAU Histidine
CAC Histidine
CAA Glutamine
CAG Glutamine
AAU Asparagine
AAC Asparagine
AAA Lysine
AAG Lysine
GAU Aspartic acid
GAC Aspartic acid
GAA Glutamic acid
GAG Glutamic acid
CGU Arginine
CGC Arginine
CGA Arginine
CGG Arginine
AGU Serine
AGC Serine
AGA Arginine
AGG Arginine
GGU Glycine
GGC Glycine
GGA Glycine
GGG Glycine
a) What is a “start” codon? How many are there? Name the codon and the amino acid it codes for:
b) Name all the amino acids that have only one codon:
c) Name all the amino acids that have multiple codons:
d) What does it mean when a codon translates into STOP? Name the three STOP codons.
3 Activity 4: Translation: Determining the Protein Sequence
Using the following coding DNA sequence, determine the mRNA and the polypeptide chain coded by
this region of the DNA. (You determined this sequence earlier in activity 2)
DNA sequence: (provided sequence shown 3’→5’) nt = nucleotide
# 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25
nt T T C A T A C G A C G T C T A C G T A A C T G C T
mRNA sequence: (5’→3’) (the same as in activity 2)
Amino acid sequence (polypeptide):
Activity 5: Exploring Point Mutations
Procedure:
1. Mutate nucleotide #10 in the DNA sequence provided according to the rules in table 1.
2. Your instructor will provide you with rubber dice so you can simulate what happens when the
DNA sequence is mutated – if the number you roll does not result in a change, keep rolling until
it changes.
3. Every student in your group should roll the die to mutate their own DNA. In this way, there will
be more outcomes to compare.
4. Write down your newly mutated DNA sequence.
5. Determine and record the mRNA and the protein sequence coded by the mutated DNA sequence.
Table 1: Rules for determining which kind of mutation will take place
If you toss a … Then you must …
1
Substitute your nucleotide with an A
2
Substitute your nucleotide with a C
3
Substitute your nucleotide with a G
4
Substitute your nucleotide with a T
5
Delete the nucleotide
6
Insert a nucleotide right after (toss again until you get 1–4 to determine
which letter nucleotide to insert)
4 DNA sequence: (provided sequence shown 3’→5’) nt = nucleotide
# 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25
nt T T C A T A C G A C G T C T A C G T A A C T G C T
Write complete new DNA sequence with mutation at nucleotide 10 position:
(Depending on the mutation, you will end up with a 24-nt, 25-nt, or 26-nt DNA sequence.)
mRNA sequence from mutated DNA:
Amino acid sequence (polypeptide): Circle any differences from original protein
Activity 6: More Mutations!
Keeping the mutated nucleotide, mutate nucleotide #16 following the procedure outlined in activity 5.
Write the resulting DNA, mRNA, and protein sequences
Write complete DNA sequence (now with two mutations: one at nt 10 position, and the second at
the nt 16 position):
mRNA sequence with both mutations:
Amino acid sequence (polypeptide): Circle any differences from original protein
5 Activity 7: Thought Questions
1. Write the definition of the term mutation.
2. If a mistake is made during transcription, will that mistake be permanent? During translation? Why or
why not? Will it be passed on to the next generation of cells? Explain your answers.
3. Why do you think you used a die to determine the mutations? Why did you keep the first mutation
when mutating the sequence a second time? In other words, why didn’t you “fix” it?
4. Did everyone in your group get the same mutation(s)? Explain. What are the odds of two people rolling
the same number? Of rolling the same mutation?
5. Deletions and insertions are also called _______ - ________ mutations.
6. What is a point mutation? Differentiate between the following types of point mutations:
a) Substitution
b) Deletion
c) Insertion
d) Missense
e) Nonsense
7. Explain the statement: "A mutation causes a change in the genotype, but that change does not always
cause a change in the phenotype".
Reference: Gonzalez, B.Y. and J. H. van Oostrom 2009. Using Dice to Explore the Consequences of DNA
Mutations, Journal of College Science Teaching 38 (5): 56-59
6 Dr. Beatriz Gonzalez
In-Class Worksheet
Name: _Key________________________
Just One Nucleotide!
Exploring The Effects of Random
Single Nucleotide Mutations
Learning Objectives:
•
Given a coding DNA sequence, determine the mRNA
•
Based on the transcribed mRNA, predict the resulting protein sequence
•
Become proficient in using the codon chart to determine which codons code for which amino
acids
•
Recognize the importance of the START and the STOP codons
•
Predict the effect that different types of mutations will have on the protein expressed
Introduction
The Central Dogma of molecular biology is the concept that cells are ruled by a cellular chain of
command that flow from DNA to RNA to protein. The information is housed in the DNA, transcribed
into a RNA molecule and translated into a protein. Therefore, protein synthesis occurs by means of
transcription and translation. Transcription occurs in the nucleus and produces RNA pairing
complementary bases to the coding DNA strand. This RNA is modified and processed in eukaryotes and
then goes to the cytoplasm where translation takes place (either in polyribosomes or in ribosomes
attached to the rough endoplasmic reticulum). Here the mRNA code is converted into a protein, a chain of
amino acids.
Activity 1: Review of base-pair rules
1. Fill out the following table to review the complementary base-pair rules during the processes of DNA
replication vs. transcription:
DNA Replication
If DNA template has
Newly made DNA
this base:
will have:
A
T
Transcription
If DNA template has mRNA will
this base:
have:
A
U
C
G
C
G
G
C
G
C
T
A
T
A
7 Activity 2: Transcription: Making mRNA
In this simple exercise, you will “transcribe” the coding DNA sequence into an mRNA. This particular
region does not contain introns.
1. Using the following coding DNA sequence, determine the resulting mRNA.
DNA sequence: (provided sequence shown 3’→5’) nt = nucleotide
# 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25
nt T T C A T A C G A C G T C T A C G T A A C T G C T
mRNA sequence: (5’→3’)
AAGUAUGCUGCAGAUGCAUUGACGA
NOTE: Depending on the level and background of the course, the teacher might want to omit the
notation denoting the DNA and RNA orientations (3’→5’and 5’→3’, respectively) especially if the
chemistry of the nucleic acids is not a requisite for the course.
Activity 3: Translation: mRNA Universal Codon Chart
Translation is the process that takes the information that was passed from DNA into the
messenger RNA and turns it into a linear sequence of amino acids covalently joined by peptide bonds. It
really is a translation from one code, nucleotide sequence, to another code, amino acid sequence.
1. Name the three different types of RNA. Mention their functions.
Messenger RNA (mRNA) – copy of the DNA sequence. This transcript of the DNA sequence will go to the
cytoplasm where it will be translated. Has codons. The universal codon chart is based on the mRNA
codons.
Transfer RNA (tRNA) – brings the appropriate amino acid to the ribosome. Has anticodons that are
complementary to the mRNA codons. On one of its ends has a site where a specific amino acid is
covalently bonded so it can brig it to the ribosome, where it will transfer it to the protein being translated.
Ribosomal RNA (rRNA) – there are several rRNAs. Their main function is structural, as a component of
the ribosome. Ribosomes are composed of protein and rRNA. One of these rRNA has enzymatic
capabilities and it is actively involved in translation. RNAs that have enzymatic properties are called
ribozymes.
2. Where are ribosomes made and what are they made of? How do they get to their final destination?
Ribosomes are made in the nucleolus of the nucleus. They are made out of protein and rRNA. They
consist of two subunits that are transported to the cytoplasm by going out of the nuclear pores. Once in
the cytoplasm, they assemble into a functional ribosome once they find an mRNA.
8 3. Refer to the universal codon chart below. The AUG codon, codes both for methionine and serves
as an initiation site; the first AUG in an mRNA's coding region will be the site where translation (not
transcription) into protein begins.
Universal Codon Chart
Codon table. This table illustrates the 64 possible codon triplets.
2nd base
U
UUU Phenylalanine
UUC Phenylalanine
U
UUA Leucine
UUG Leucine
CUU Leucine
CUC Leucine
C
CUA Leucine
1st base CUG Leucine
AUU Isoleucine
AUC Isoleucine
A
AUA Isoleucine
1
AUG Methionine
GUU Valine
GUC Valine
G
GUA Valine
GUG Valine
C
A
G
UCU Serine
UCC Serine
UCA Serine
UCG Serine
UAU Tyrosine
UAC Tyrosine
UAA Stop
UAG Stop
UGU Cysteine
UGC Cysteine
UGA Stop
UGG Tryptophan
CCU Proline
CCC Proline
CCA Proline
CCG Proline
ACU Threonine
ACC Threonine
ACA Threonine
ACG Threonine
GCU Alanine
GCC Alanine
GCA Alanine
GCG Alanine
CAU Histidine
CAC Histidine
CAA Glutamine
CAG Glutamine
AAU Asparagine
AAC Asparagine
AAA Lysine
AAG Lysine
GAU Aspartic acid
GAC Aspartic acid
GAA Glutamic acid
GAG Glutamic acid
CGU Arginine
CGC Arginine
CGA Arginine
CGG Arginine
AGU Serine
AGC Serine
AGA Arginine
AGG Arginine
GGU Glycine
GGC Glycine
GGA Glycine
GGG Glycine
a) What is a “start” codon? How many are there? Name the codon and the amino acid it codes for:
A “start” codon is the codon that signals the beginning of translation. There is only one, AUG, and it
codes for methionine.
b) Name all the amino acids that have only one codon:
Methionine and tryptophan (the question asks for the amino acid, not the sequence of the codons)
c) Name all the amino acids that have multiple codons:
All except methionine and tryptophan. There are 20 amino acids, so 18 have multiple codons.
d) What does it mean when a codon translates into STOP? Name the three STOP codons.
STOP means that translation will cease. The ribosome complex disassembles and the mRNA and
newly made protein are released.
9 Activity 4: Translation: Determining the Protein Sequence
Using the following coding DNA sequence, determine the mRNA and the polypeptide chain coded by
this region of the DNA. (You determined this sequence earlier in activity 2)
DNA sequence: (provided sequence shown 3’→5’) nt = nucleotide
# 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25
nt T T C A T A C G A C G T C T A C G T A A C T G C T
mRNA sequence: (5’→3’) (the same as in activity 2)
AAGUAUGCUGCAGAUGCAUUGACGA
Amino acid sequence (polypeptide):
Starting on the first mRNA nucleotide on the left (the 5’ end), students should slide to the right (towards
the 3’ end) until they find the START nucleotide – AUG. After recording “methionine” they should look
up the next 3 nucleotides (the code does not overlap) in the codon chart and continue until they find a
STOP codon. The word STOP should not be part of the protein sequence. The amino acids are joined by a
hyphen, to symbolize the peptide bond that covalently bonds them.
Methionine – leucine – glutamine – methionine – histidine
Activity 5: Exploring Point Mutations
Procedure:
6. Mutate nucleotide #10 in the DNA sequence provided according to the rules in table 1.
7. Your instructor will provide you with rubber dice so you can simulate what happens when the
DNA sequence is mutated – if the number you roll does not result in a change, keep rolling until
it changes.
8. Every student in your group should roll the die to mutate their own DNA. In this way, there will
be more outcomes to compare.
9. Write down your newly mutated DNA sequence.
10. Determine and record the mRNA and the protein sequence coded by the mutated DNA sequence.
Table 1: Rules for determining which kind of mutation will take place
If you toss a … Then you must …
1
Substitute your nucleotide with an A
2
Substitute your nucleotide with a C
3
Substitute your nucleotide with a G
4
Substitute your nucleotide with a T
5
Delete the nucleotide
6
Insert a nucleotide right after (toss again until you get 1–4 to determine
which letter nucleotide to insert)
10 DNA sequence: (provided sequence shown 3’→5’) nt = nucleotide
# 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25
nt T T C A T A C G A C G T C T A C G T A A C T G C T
Write complete new DNA sequence with mutation at nucleotide 10 position:
(Depending on the mutation, you will end up with a 24-nt, 25-nt, or 26-nt DNA sequence.)
Example: If the student rolls a 4, then the C in nt 10 is replaced by a T. This will be the resulting mutated
DNA nucleotide sequence:
TTCATACGATGTCTACGTAACTGCT
mRNA sequence from mutated DNA:
AAGUAUGCUACAGAUGCAUUGACGA
Amino acid sequence (polypeptide): Circle any differences from original protein
Methionine – leucine – glutamine – methionine – histidine
No difference in nucleotide sequence since both codons code for leucine. In this mutated DNA sequence, a
substitution in nt 10 will not cause a change in the DNA sequence. However, if student rolls a 5 or 6,
there will be a shift in the reading frame and major changes will take place.
Activity 6: More Mutations!
Keeping the mutated nucleotide, mutate nucleotide #16 following the procedure outlined in activity 5.
Write the resulting DNA, mRNA, and protein sequences
Write complete DNA sequence (now with two mutations: one at nt 10 position, and the second at
the nt 16 position):
Example: student rolls a 3, so nt is changed from C to G.
TTCATACGATGTCTAGGTAACTGCT
mRNA sequence with both mutations:
AAGUAUGCUACAGAUCCAUUGACGA
Amino acid sequence (polypeptide): Circle (or underline) any differences from original protein
Methionine – leucine – glutamine – isoleucine – histidine
11 Activity 7: Thought Questions
1. Write the definition of the term mutation.
A change in the genetic sequence of a gene (in the DNA for living organisms and in RNA for
retroviruses). Often occurs during replication of the DNA or due to external factors (mutagens such as
radiation). It is important that students understand that mutations are in the DNA. Often they think that a
mistake in transcription or translation is
2. a) If a mistake is made during transcription, will that mistake be permanent? During translation? Why
or why not?
b)Will the mistake be passed on to the next generation of cells? Explain your answers.
a) No, as long as the DNA is not mutated, the mistake will not be permanent. Imagine 100 mRNA are
produced and one of them is wrong, due to a mistake during transcription. Since the other 99 mRNA are
correct, the bulk of the proteins produced will be correct. The same will happen if a mistake occurred
during translation. Many mRNA are transcribed from each gene and mRNAs are reused many times.
b) If a defective protein is made, it will stay in the cell until it is degraded. However, if many other copies
are made that are not defective, chances are that the defective copy will have no or negligible effect on
the cell’s functions. So the defective protein might persist in the cell, but since the DNA is not mutated,
new copies should not be defective.
3. Why do you think you used a die to determine the mutations? Why did you keep the first mutation
when mutating the sequence a second time? In other words, why didn’t you “fix” it?
Mutations are random and they accumulate. Certain sequences are more prone to specific kinds of
mutations, but there is no guarantee that the mutation will or will not occur.
4. Did everyone in your group get the same mutation(s)? Explain. What are the odds of two people rolling
the same number? Of rolling the same mutation?
Odds of two people rolling the same number 1/6 x 1/6 = 1/36.
Odds of two people rolling the same mutation 1/5 x 1/5 = 1/25 because one of the numbers stands for
what is already in the sequence and that will not be a mutations. Example: if you have a C and you roll a
2, the rules say to place a C, but you already have a C, therefore that is not a mutation.
5. Deletions and insertions are also called frame-shift mutations.
6. What is a point mutation? Differentiate between the following types of point mutations:
a) Substitution – changes one nucleotide for another
b) Missense – substitution that codes for a different amino acid
c) Nonsense – substitution that codes for a STOP codon
d) Deletion – deletes one nucleotide
e) Insertion – inserts one nucleotide
7. Explain the statement: "A mutation causes a change in the genotype, but that change does not always
cause a change in the phenotype".
As seen in the example in activity 5, a substitution will cause a change in the DNA sequence (genotype)
but will not result in a change in the amino acid sequence (phenotype).
Reference: Gonzalez, B.Y. and J. H. van Oostrom 2009. Using Dice to Explore the Consequences of DNA
Mutations, Journal of College Science Teaching 38 (5): 56-59
12