* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Transcriptional Activation I
Copy-number variation wikipedia , lookup
History of RNA biology wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Epigenetics in learning and memory wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Pathogenomics wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Minimal genome wikipedia , lookup
Gene expression programming wikipedia , lookup
Epigenomics wikipedia , lookup
Transposable element wikipedia , lookup
Gene therapy of the human retina wikipedia , lookup
Gene nomenclature wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Short interspersed nuclear elements (SINEs) wikipedia , lookup
Genome (book) wikipedia , lookup
Genomic library wikipedia , lookup
RNA silencing wikipedia , lookup
Genetic engineering wikipedia , lookup
Epigenetics of diabetes Type 2 wikipedia , lookup
Gene therapy wikipedia , lookup
Gene expression profiling wikipedia , lookup
Epitranscriptome wikipedia , lookup
Human genome wikipedia , lookup
Point mutation wikipedia , lookup
Gene desert wikipedia , lookup
Long non-coding RNA wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Transcription factor wikipedia , lookup
Non-coding RNA wikipedia , lookup
History of genetic engineering wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Non-coding DNA wikipedia , lookup
Microevolution wikipedia , lookup
Genome evolution wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Designer baby wikipedia , lookup
Genome editing wikipedia , lookup
Helitron (biology) wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
CS173 Lecture 7: Transcriptional activation I MW 11:00-12:15 in Beckman B302 Prof: Gill Bejerano TAs: Jim Notwell & Harendra Guturu http://cs173.stanford.edu [BejeranoWinter12/13] 1 Announcements •Piazza is getting livelier. Thank you :) • HW1 due this coming Monday. All well? http://cs173.stanford.edu [BejeranoWinter12/13] 2 ATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA TATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTC TAATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTC TGCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACT CTTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTAACGAATCAAATTAACAACCATAGGATG AATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGGAA GCTGCATAACCACTTTAACTAATACTTTCAACATTTTCAGTTTGTATTACTTCTTATTCAAATGTCATAAAAGTATCAACAAAAAAT TTAATATACCTCTATACTTTAACGTCAAGGAGAAAAAACTATAATGACTAAATCTCATTCAGAAGAAGTGATTGTACCTGAGTTCAA CTAGCGCAAAGGAATTACCAAGACCATTGGCCGAAAAGTGCCCGAGCATAATTAAGAAATTTATAAGCGCTTATGATGCTAAACCGG TTTGTTGCTAGATCGCCTGGTAGAGTCAATCTAATTGGTGAACATATTGATTATTGTGACTTCTCGGTTTTACCTTTAGCTATTGAT TGATATGCTTTGCGCCGTCAAAGTTTTGAACGATGAGATTTCAAGTCTTAAAGCTATATCAGAGGGCTAAGCATGTGTATTCTGAAT TTAAGAGTCTTGAAGGCTGTGAAATTAATGACTACAGCGAGCTTTACTGCCGACGAAGACTTTTTCAAGCAATTTGGTGCCTTGATG CGAGTCTCAAGCTTCTTGCGATAAACTTTACGAATGTTCTTGTCCAGAGATTGACAAAATTTGTTCCATTGCTTTGTCAAATGGATC ATGGTTCCCGTTTGACCGGAGCTGGCTGGGGTGGTTGTACTGTTCACTTGGTTCCAGGGGGCCCAAATGGCAACATAGAAAAGGTAA GAAGCCCTTGCCAATGAGTTCTACAAGGTCAAGTACCCTAAGATCACTGATGCTGAGCTAGAAAATGCTATCATCGTCTCTAAACCA ATTGGGCAGCTGTCTATATGAATTAGTCAAGTATACTTCTTTTTTTTACTTTGTTCAGAACAACTTCTCATTTTTTTCTACTCATAA TTAGCATCACAAAATACGCAATAATAACGAGTAGTAACACTTTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGA ATGTTTTCAATGTAAGAGATTTCGATTATCCACAAACTTTAAAACACAGGGACAAAATTCTTGATATGCTTTCAACCGCTGCGTTTT ATACCTATTCTTGACATGATATGACTACCATTTTGTTATTGTACGTGGGGCAGTTGACGTCTTATCATATGTCAAAGTTGCGAAGTT TGGCAAGTTGCCAACTGACGAGATGCAGTAACACTTTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGT TCAATGTAAGAGATTTCGATTATCCACAAACTTTAAAACACAGGGACAAAATTCTTGATATGCTTTCAACCGCTGCGTTTTGGATAC ATTCTTGACATGATATGACTACCATTTTGTTATTGTACGTGGGGCAGTTGACGTCTTATCATATGTCAAAGTCATTTGCGAAGTTCT GCAAGTTGCCAACTGACGAGATGCAGTTTCCTACGCATAATAAGAATAGGAGGGAATATCAAGCCAGACAATCTATCATTACATTTA CGGCTCTTCAAAAAGATTGAACTCTCGCCAACTTATGGAATCTTCCAATGAGACCTTTGCGCCAAATAATGTGGATTTGGAAAAAGA ATAAGTCATCTCAGAGTAATATAACTACCGAAGTTTATGAGGCATCGAGCTTTGAAGAAAAAGTAAGCTCAGAAAAACCTCAATACA TCATTCTGGAAGAAAATCTATTATGAATATGTGGTCGTTGACAAATCAATCTTGGGTGTTTCTATTCTGGATTCATTTATGTACAAC GGACTTGAAGCCCGTCGAAAAAGAAAGGCGGGTTTGGTCCTGGTACAATTATTGTTACTTCTGGCTTGCTGAATGTTTCAATATCAA CTTGGCAAATTGCAGCTACAGGTCTACAACTGGGTCTAAATTGGTGGCAGTGTTGGATAACAATTTGGATTGGGTACGGTTTCGTTG GCTTTTGTTGTTTTGGCCTCTAGAGTTGGATCTGCTTATCATTTGTCATTCCCTATATCATCTAGAGCATCATTCGGTATTTTCTTC TTTATGGCCCGTTATTAACAGAGTCGTCATGGCCATCGTTTGGTATAGTGTCCAAGCTTATATTGCGGCAACTCCCGTATCATTAAT TGAAATCTATCTTTGGAAAAGATTTACAATGATTGTACGTGGGGCAGTTGACGTCTTATCATATGTCAAAGTCATTTGCGAAGTTCT GCAAGTTGCCAACTGACGAGATGCAGTAACACTTTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTT AATGTAAGAGATTTCGATTATCCACAAACTTTAAAACACAGGGACAAAATTCTTGATATGCTTTCAACCGCTGCGTTTTGGATACCT TCTTGACATGATATGACTACCATTTTGTTATTGTTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTT AATGTAAGAGATTTCGATTATCCTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGA TTTCGATTATCCTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTA CTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCTTATAGTT TACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCTTATAGTTCATACATGCTT ACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCTTATAGTTCATACATGCTTCAACTACTTAA http://cs173.stanford.edu [BejeranoWinter12/13] 3 AATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGT Gene Products long non-coding RNA reverse transcription microRNA rRNA, snRNA, snoRNA 4 Gene Regulation Different cells in our body hold copies of (essentially) the same genome. Yet they express very different repertoires of proteins and non-coding RNAs. How do cells do it? A: like they do everything else: using their proteins & ncRNAs… http://cs173.stanford.edu [BejeranoWinter12/13] 5 Gene Regulatory Switches • Gene = genomic substring that encodes HOW to make a protein. • Genomic switch = genomic substring that encodes WHEN, WHERE & HOW MUCH of a protein to make. [0,1,1,1] B H Gene Gene N B N H Gene Gene [1,0,0,1] http://cs173.stanford.edu [BejeranoWinter12/13] [1,1,0,0] 6 Transcription Activation http://cs173.stanford.edu [BejeranoWinter12/13] 7 RNA Polymerase • Transcription = Copying a segment of DNA into (non/coding) RNA • Gene transcription starts at the (aptly named) TSS, or gene transcription start site • Transcription is done be RNA polymerase, a complex of 10-12 subunit proteins. • There are three types of RNA polymerases in human: – RNA pol I synthesizes ribosomal RNAs – RNA pol II synthesizes pre-mRNAs and most microRNAs – RNA pol III synthesizes tRNAs, rRNA and other ssRNAs TSS RNA Polymerase http://cs173.stanford.edu [BejeranoWinter12/13] 8 RNA Polymerase is General Purpose • RNA Polymerase is the general purpose transcriptional machinery. • It generally does not recognize gene transcription start sites by itself, and requires interactions with multiple additional proteins. general purpose context specific http://cs173.stanford.edu [BejeranoWinter12/13] 9 Terminology • Transcription Factors (TF): Proteins that return to the nucleus, bind specific DNA sequences there, and affect transcription. – There are 1,200-2,000 TFs in the human genome (out of 20-25,000 genes) – Only a subset of TFs may be expressed in a given cell at a given point in time. • Transcription Factor Binding Sites: 4-20bp stretches of DNA where TFs bind. – There are millions of TF binding sites in the human genome. – In a cell at a given point in time, a site can be either occupied or unoccupied. http://cs173.stanford.edu [BejeranoWinter12/13] 10 Terminology • Promoter: The region of DNA 100-1,000bp immediately “upstream” of the TSS, which encodes binding sites for the general purpose RNA polymerase associated TFs, and at times some context specific sites. – There are as many promoters as there are TSS’s in the human genome. Many genes have more than one TSS. • Enhancer: A region of 100-1,000bp up to 1Mb or more upstream or downstream from the TSS that includes binding sites for multiple TFs. When bound by (the right) TFs an enhancer turns on/accelerates transcription. – Note how an enhancer (E) very far away in sequence can in fact get very close to the promoter (P) in space. http://cs173.stanford.edu [BejeranoWinter12/13] promoter TSS gene 11 Terminology • Gene regulatory domain: the full repertoire of enhancers that affect the expression of a (protein coding or non-coding) gene, at some cells under some condition. promoter – Gene regulatory domains do not have to be contiguous in genome sequence. – Neither are they disjoint: One or more enhancers may well affect the expression of multiple genes (at the same or different times). TSS enhancers for different contexts http://cs173.stanford.edu [BejeranoWinter12/13] 12 Imagine a giant state machine Transcription factors bind DNA, turn on or off different promoters and enhancers, which in-turn turn on or off different genes, some of which may themselves be transcription factors, which again changes the presence of TFs in the cell, the state of active promoters/enhancers etc. Proteins DNA transcription factor binding site Gene DNA http://cs173.stanford.edu [BejeranoWinter12/13] 13 One nice hypothetical example requires active enhancers to function functions independently of enhancers http://cs173.stanford.edu [BejeranoWinter12/13] 14 The State Space Discrete, but very large. All states served by same genome(!) 1 cell http://cs173.stanford.edu [BejeranoWinter12/13] 1012 cells 15 Transcription Activation: Some measurements and observations http://cs173.stanford.edu [BejeranoWinter12/13] 16 Transcription Factor Binding Sites (TFBS) • An antibody is a large Y-shaped protein used by the immune system to identify and neutralize foreign objects such as bacteria. • Antibodies can be raised that instead recognize specific transcription factors. • Chromatin Immunoprecipitation: Take DNA (region or whole genome) bound by TFs, crosslink DNA-TFs, shear DNA, select DNA fragments bound by TF of interest using antibody, get rid of TF and antibody, sequence pool of DNA. Obtain genomic regions bound by TF. http://cs173.stanford.edu [BejeranoWinter12/13] 17 TFBS Position Weight Matrix (PWM) Note the strong independence assumption between positions. Holds for most transcription binding profiles in the human genome. http://cs173.stanford.edu [BejeranoWinter12/13] 18 Transcription Factors have Large “fan outs” We could have had one TF regulate two TFS, each of which regulates two other TFs, etc. and each of those contributing to the regulation of a modest number of target genes (that do the real work). Instead TFs reproducibly bind to thousands of genomic locations almost anywhere we’ve looked. Gene regulation forms a dense network. http://cs173.stanford.edu [BejeranoWinter12/13] 19 Transfections As far as we’ve seen, enhancers work “the same” irrespective of distance (or orientation) to TSS, or identity of target gene. enhancer reporter gene minimal promoter in cellular context of choice • Which enhancers work in what contexts? • What if you mutate enhancer bases (disrupt or introduce binding sites) and run the experiment again? • What if you co-transfect a TF you think binds to this enhancer? • What if you instead add siRNA for that TF? http://cs173.stanford.edu [BejeranoWinter12/13] 20 Synergy / non-linear additivity Gene DNA http://cs173.stanford.edu [BejeranoWinter12/13] 21 Transgenics enhancer reporter gene minimal promoter Observe enhancer behavior in vivo. Qualitative (not quantitative) assay. Can section and stain to obtain more specific cell-type information. http://cs173.stanford.edu [BejeranoWinter12/13] 22 BAC transgenics: necessity vs sufficiency You can take 100-200kb segments out of the genome, insert a reporter gene in place of gene X, and measure regulatory domain expression. You can then continue to delete or mutate individual enhancers. http://cs173.stanford.edu [BejeranoWinter12/13] 23 Gene Regulation: Enhancers are modular and additive limb neural tube brain Sall1 Temporal gene expression pattern “equals” sum of promoter and enhancers expression patterns. http://cs173.stanford.edu [BejeranoWinter12/13] 24 Genome Engineering Technologies are in fact constantly improving that allow us to edit the nuclear genome itself. Edit the genome of an embryonic stem cell, breed homozygous modified animals. http://cs173.stanford.edu [BejeranoWinter12/13] 25 Chromosome conformation capture (3C) People are also developing methods to detect when two genomic regions far in sequence are in fact interacting in space. Ultimately this will allow to determine experimentally the regulatory domain of each gene (likely condition dependent). http://cs173.stanford.edu [BejeranoWinter12/13] 26 Gene Regulation is HOT Despite its complexity gene regulation is currently one of the hottest topics in the study of the human genome. Large projects are pouring tons of money to generate huge descriptive datasets. The challenge now is to glean logic from these piles. To be continued… http://cs173.stanford.edu [BejeranoWinter12/13] 27