Download Chapter 7 Notes: DNA Profiling

Forensic Science
Chapter 7: DNA Profiling
•
•
•
DNA Profiling - use of molecular genetic methods to determine the exact genotype of a DNA sample to
distinguish one human being from another
– Crime scenes, missing persons, mass disasters, paternity testing, exonerate the innocent (Innocence
Project), solve cold cases, resolve historical mysteries, etc.
– Can link suspects to a scene or exclude them
~ 3 billion bases in the human genetic blueprint
– greater than 99.5% do not vary among human beings
– Small percentage of the human DNA sequence (<.5%) differs (polymorphic)
DNA sequences used for forensic typing are “anonymous”
– derived from regions of our chromosomes (also called loci) that do not control any known traits and
have no known functions
History of Forensic Analysis
• First genetic evidence to be collected for investigative work was use of blood group typing
• DNA Fingerprinting - has been the mainstay of forensic analysis for nearly 20 yrs
– RFLP – restriction fragment length polymorphism
• PCR (Polymerase Chain Reaction) - Utilize very small samples of DNA
– Revolutionized research and forensic analysis
• STR Analysis (Short Tandem Repeats) - Shorter repeating bases than what was previously used
– More easily recovered from limited quantity of DNA typically found in evidence
CODIS – collects, analyzes, and communicates criminal DNA information
• 1998 – FBI launched the National DNA Index System (NDIS)
– Database of DNA profiles of individuals who were either arrested or were convicted of a serious crime
– Used for establishing identity of unknown crime scene DNA
– NDIS is now a part of CODIS
– 2014: CODIS had 11.1 million offenders’ DNA profiles and 1.9 million arrestee DNA profiles; more than
257,000 hits assisting in more than 246,000 investigations
DNA - No two individuals share the same DNA (with the exception of identical twins)
• Half from mom and half from dad!
• Exists in the nucleus of every cell in the body except red blood cells
– Also inside mitochondria (mtDNA)
• Contains genetic code for the production of proteins
– Cell can replicate its DNA and carry on all life functions using these proteins!
• all DNA found in human cells makes up the human genome
– Only .5% of DNA (15 million nucleotides) determines the difference between
individual people!
• can be extracted from hair, blood, saliva, semen, bone, or other body tissue
DNA Structure – polymer (nucleic acid) made of repeating monomers (nucleotides)
• Nucleotides: contain a 5-carbon sugar, phosphate group, and nitrogenous base
• four nitrogenous bases: Adenine (A), Thymine (T), Guanine (G), Cytosine (C)
– Order of these bases makes up the genetic code that specifies what proteins a
cell produces, when they are produced, and how much is produced
– DNA of every organism on Earth is made of the same 4 bases!
• James Watson & Francis Crick received the Nobel Prize (1953)
– Described the structure of DNA as a double helix (twisted ladder)
–
–
Sides consist of alternating sugar and phosphate molecules
Steps (rungs) are made up of pairs of complementary base
pairs
• Approximately 6 billion base pairs in human body cells
• A-T, C-G
• Ex: one side of the ladder is CGTCTA…what would the other strand be? _________
Chromosomes - DNA is wound around proteins (histones) and condensed
during cell division into chromosomes
– Anywhere from 50 - 500 million nucleotides make up a
chromosome
– 46 in each cell, 23 from mom and 23 from dad (Exception: sex
cells! Formed in meiosis)
– Homologous pairs: chromosomes containing same genes from
mom and dad
– 22 pairs of autosomes (chromosomes 1-22) and 1 pair of sex
chromosomes (chromosome 23: X & Y)
Genes & Alleles
• Section of DNA on a chromosome that codes for a protein
• Average around 3,000 base pairs, but can be composed of many thousands of base pairs
• Humans have 30,000 genes in their 46 chromosomes
– Human Genome Project: mapping the human genome, where genes are located, what proteins they
code for
• Locus (loci): location of a gene on the chromosome
• Allele: alternative forms/versions of a gene
– i.e. blood type: A allele, B allele, O allele – different combinations produce different blood types
(remember…one from each parent)
Exons & Introns
• Coding regions are only 5% of DNA in human genome!
– much of the genome is made up of noncoding sequences (95%)
• Function is unclear; proposed that they may perform regulatory
functions or act as genetic “on-and-off switches.”
• Deleted after a cell transcribes the DNA into messenger RNA
– Exons – genes, regions of DNA that are expressed as proteins
– Introns – noncoding regions of DNA
Male
Female
Human Karyotypes
DNA Replication
• Necessary for cell division!
• Must have a high degree of specificity and accuracy
– the enzymes involved use the information already contained in the existing
strands to make new DNA copies
– DNA is copied from a template
• This is the basis for PCR technology!
•
Evidence Collection
• Proper collection, documentation, storage, and processing of DNA must follow
precise protocols in order to be accepted as reliable evidence in court
• PCR has allowed for trace samples of DNA to be amplified (copied) so that
adequate amounts of DNA evidence are available for testing
– Proper collection and avoiding contamination is still necessary! Will
amplify contamination
Keep evidence dry & cool during transportation and storage
– Moisture compromises DNA evidence because humidity encourages mold growth
– Prolonged direct sunlight and warm conditions are also harmful
Avoiding Contamination
• Wear disposable gloves (change them often)
• Disposable instruments
• Avoid touching the area where DNA may exist
• Avoid talking, sneezing, and coughing on evidence
• Avoid touching your face when collecting and packaging evidence
• Air-dry evidence thoroughly before packaging
• If wet evidence cannot be dried, it may be frozen, refrigerated, or placed in a paper bag
• Put evidence into new paper bags or envelopes
Personal Identification
• 1987 – Dr. Alec Jeffries (U. of Leicester, U.K.) conducted the first forensic personal identification of a suspect
based on a technique he called DNA fingerprinting
– We now call DNA Profiling or DNA Typing, and it has been improved utilizing newer technology
• Polymorphisms are used to distinguish one person from another (regions in the DNA of high variability)
– Located within the noncoding regions of DNA, consist of repeating base sequences of DNA that repeat
one after the other (in tandem)
– Number of polymorphisms differs among individuals and results in a different DNA profile (pattern) for
each individual
– 99.5% of all human DNA is same, so only need to examine that 0.5% region of variability instead of the
entire DNA
DNA Fingerprinting - Examine regions of high variability within the noncoding regions of DNA to establish the identify of
a person
– DNA is isolated and cut using restriction enzymes
• Act like molecular scissors and makes cuts at specific sequences of a base
• Sits on a DNA molecule and slides along the helix until it recognizes specific sequences of base
pairs that signal the enzyme to stop sliding
– then cuts or chemically separates the DNA molecule at that site (restriction site)
• create fragments of DNA called restriction fragments
– Each person’s DNA is different, so each person's length and number of DNA restriction fragments differs
• RLFP (Restriction Fragment Length Polymorphism)
– Separated by size on a gel when an electric field is applied
–
–
• Smaller pieces travel further in the gel
Radioactive probes bond to the highly variable regions
• Creates a unique band pattern that can be used to identify a person
PCR amplification – allows analysis of minute quantities of DNA in shorter time
Gel Electrophoresis - use agarose gel & electricity
• Separates DNA fragments by size (relative # of base pairs)
• DNA is loaded into an agarose gel slab, placed into a chamber filled
with a conductive buffer solution
• Direct current is passed between wire electrodes at each end of the
chamber
• DNA is negatively charged, so drawn toward positive pole (anode)
when placed in an electric field
• Matrix of gel acts as a molecular sieve through which smaller DNA
fragments can move more easily than larger ones
• Smaller fragments (fewer base pairs) move more quickly than larger
ones (more base pairs)
• Smaller DNA fragments will travel farther than larger ones
• Fragments of the same size stay together and migrate in single bands
of DNA (will be seen in the gel after DNA is stained)
Making DNA visible
• DNA is colorless, so fragments cannot be seen during electrophoresis
• Loading buffer is added to the DNA samples
– makes it easier to load the samples and monitor the progress of the DNA electrophoresis
– dye fronts migrate toward the positive end of the gel, just like the DNA fragments
Reading the Gel
• Lane 1: DNA size standards
• Number from top left (so load right to left)
• See if any suspects’ bands match those of the DNA found at
the crime scene
• DNA evidence places the suspect at the scene, but other
evidence may be needed to prove him or her guilty
• In actual DNA fingerprinting, larger segments of DNA are
analyzed and many more bands and lanes are produced
Parental Identification
• When reading a gel for parental identification, the child’s bands should match
with one of the parents. Remember, half of the alleles come from mom and half from
dad, so their alleles should be present in one of the parents.
•
•
Reliability
• Two major factors affecting reliability: population genetics and genetic
statistics
• Humans have thousands of RFLP loci or DNA segments that can be selected
and used for fingerprinting analysis
Can depend on demographic factors such as ethnicity or geographic isolation
Humans only differ in about 1-5 bp in 1000
– Need to examine variable regions
– Some populations show much less variation in particular DNA segments than others
•
•
– Degree of variation will affect the statistical odds of more than one individual having the same
Different populations show different patterns in their genotypes due to the contributions made to their
individual gene pools over time
Statistically, how many people in a population have the same pattern as that taken from a crime scene: 1 in
1,000,000? 1 in 10,000? Or 1 in 10?
PCR - Polymerase Chain Reaction – utilizes the mechanisms of the cell during DNA replication to amplify (copy) small
samples of DNA
• 1983 – developed, Nobel Prize 1993 (Kary Mullis)
• Tremendous impact on biotechnology: gene mapping, cloning, DNA sequencing, gene detection, DNA profiling
• Prior to PCR, DNA analysis was cost prohibitive or sometimes impractical
• PCR produces exponentially large amounts of a specific piece of DNA from trace amounts of starting material
(template)
• Template can be any form of double-stranded DNA and generates millions of copies of a desired DNA fragment
• Ability to amplify the precise sequence of DNA that a researcher wishes to study or manipulate
• Can then run these sequences using gel electrophoresis or other technology
Short Tandem Repeats (STRs)
• 1991 – new and improved method of analyzing variable regions of DNA
– Shorter repeating bases, consisting of fewer than 50 bases
– More easily recovered from often-degraded and limited quantities of DNA typically found in evidence
– Has replaced DNA fingerprinting in modern-day DNA profiling
• DNA sequences used in forensic DNA profiling are non-coding regions that contain segments of short tandem
repeats
– Very short DNA sequences that are repeated in direct head-to-tail fashion
– Example (shows a locus known as TH01 actually used in forensic DNA profiling): the DNA sequence at
this locus contains four repeats of TCAT
…CCCTCATTCATTCATTCATTCA…
• For the TH01 STR locus, there are many alleles that differ from each other by the number of
TCAT repeats present in the sequence
• Although more than 20 different alleles of TH01 have been discovered in people worldwide,
each of us still has only 2 of these (from mom & dad!)
13 Core STRs
• FBI uses 13 core STRs for identification of Americans
– Notice TH01 is on chromosome 11
– D18S51 is one of the more highly variable core STR
markers (repeats AGAA and varies from 7 repeats to 40
repeats)
• Sex chromosomes (X * Y) have a non-STR locus (AMEL) that is used
to identify the DNA source as male or female
• samples examined at 13 different loci using genotyping software to
interpret the results from products amplified by PCR
• More loci analyzed improves the power of discrimination of the
testing
– ability of the typing to discriminate between different
individuals
STR Analysis
• Amplification of the copies present in the small amounts of evidentiary DNA by polymerase chain reaction (PCR)
• Using primers specific to the DNA sequences on either side of the STR, billions of copies of each of the 2 original
alleles in any one person’s DNA type ore synthesized in the reaction
–
•
•
Copies contain the same number of STRs present in the original DNA copies and can be separated by size
using agarose gel electrophoresis
– Comparison with size standards that correspond to the known sizes of the specific alleles, the sizes of
the amplified copies can be determined
– One locus may be able to tell the difference between one out of 1,000 people, 2 1/10,000…the larger
the number of loci typed, the more powerful the ability to discriminate
Performed by automated machines and computers
Commercial kits and analyzers are used that can amplify multiple STR markers simultaneously
– Add fluorescent dyes to the PCR and identify different STR markers
– Signal recorded as peaks in a graphic display (electropherogram)
– STR alleles are identified by size and color on the graphic display
Inheritance of STRs
• Alleles for different traits are assorted independently as sex cells are developed during meiosis
– Example: if mother inherits a repeat of 9 at a locus from one parent and a repeat of 12 at the same locus
from the other parent, she will only pass one of these on in her egg to her offspring (½ of her eggs will
have 9 repeats and ½ of her eggs will have 12); same for male (i.e. allele of 14 and an allele of 15)
• Independent assortment provides four different allele combinations found in their offspring:
(9,14), (9,15), (12,14), and (12,15)
• 2 of the same alleles for a particular STR (i.e. 5, 5) – homozygous
• 2 different alleles for a particular STR (i.e. 9, 14) - heterozygous
DNA STR Profiles
• DNA profile usually includes the alleles for all 13 core STR loci plus the non-STR indicator for the sex
chromosomes (AMEL)
– The more loci used the greater the probability that the DNA profile came from the individual identified
and not someone else
STR Allele Frequencies
• Allele frequency: calculation of how often a particular allele appears within a given population
– Equals the number of times an allele is observed in a given population divided by the total alleles
observed in the population
– Differ among different populations (important that the data is taken from the correct population)
• Calculations using STR allele frequencies are made to determine the probability that a random person in the
population would have the same DNA profile as the suspect in a crime
Y STR & mtDNA
• Many STRs are being used besides the FBI’s core 13
• STRs located on the Y chromosome are used to trace ancestry through the male line
• mitochondrial DNA is used to trace ancestry traced through the maternal line
– mtDNA can be analyzed when nuclear DNA is not present or is degraded
– No STRs, but has two noncoding base sequences that are variable regions
• Both are class evidence because only link familial lines (paternal and maternal)
Civil Liberty Concerns
• There are concerns that civil liberties of innocent people are being threatened because of familial testing
– Sometimes family members are tested to help with identification
– People who have done nothing wrong but are related to criminal suspects can be investigated
–
th
Violation of the 4 amendment right that protects the individual from improper search and seizure?
Cases: Romanovs, Kirk Bloodsworth, Steven Avery, Grim Sleeper