* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Molecular biology Tools
Designer baby wikipedia , lookup
Gene expression profiling wikipedia , lookup
Genealogical DNA test wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Microevolution wikipedia , lookup
Long non-coding RNA wikipedia , lookup
History of RNA biology wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Messenger RNA wikipedia , lookup
Protein moonlighting wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Non-coding RNA wikipedia , lookup
Cancer epigenetics wikipedia , lookup
DNA supercoil wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Genomic library wikipedia , lookup
Molecular cloning wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Point mutation wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
SNP genotyping wikipedia , lookup
Non-coding DNA wikipedia , lookup
Epitranscriptome wikipedia , lookup
DNA vaccination wikipedia , lookup
History of genetic engineering wikipedia , lookup
Epigenomics wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Helitron (biology) wikipedia , lookup
Microsatellite wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Mir-92 microRNA precursor family wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
TACKLING OSTEOARTHRITIS -Research Tools At Our Disposal Mahita Kadmiel July 21, 2005 OSTEOARTHRITIS • Arthritis -most common medical problem • No. 1 cause of disability in America. • arthron = joint itis = inflammation. arthritis = joint inflammation. • osteoarthritis, is the most common form of arthritis • affects nearly 21 million people in the United States MENISCUS The Meniscus: Shock Absorber for the Knee Meniscal Tears • Traumatic tears From a sudden load being applied to the meniscal tissue which is severe enough to cause the meniscal cartilage to fail and let go. Ex. Twisting injury • Degenerative meniscal tears Failure of the meniscus over time. The meniscus becomes less elastic and compliant May fail with only minimal trauma Ex. Just getting down into a squat *Degenerative meniscal tears can lead to osteoarthritis* Healthy meniscus Torn meniscus The expression of genetic material in the meniscus dictates it Central Dogma of Life Reverse Transcription Proteins make a cell what it is Staining to find -how the cells look (anatomy) (TARA) TISSUE CELLS Staining to find -if cells are dead or alive (viability) (TUMUL) Histology Cell Biology Proteins Biochemistry Western Blotting -To detect proteins DNA ELISA -To quantify proteins Enzyme Assays -To measure enzyme activity Southern Blotting -To find copy number of genes RNA Northern Blotting RT-PCR Real-Time PCR -To study gene expression (TUMUL, BASIA & MYSELF) Genome Sequencing Tools used in our lab RT-PCR Real-Time PCR -To study gene expression ELISA -To quantify proteins Preparation of cDNA or first strand RT Reverse Transcription 5’ GACCCAAUUGGUCAGCUAAAAAAA 3’ 5’ GACCCAAUUGGUCAGCUAAAAAAA 3’ Reverse transcriptase ……TTTTTTT 5’ A, T, G, C dNTPs Reverse Transcription 3’ CTGGGTTAACCAGTCGATTTTTTT 5’ 1ST strand cDNA (complementary DNA) mRNA PCR : Polymerase Chain Reaction Reverse TranscriptasePolymerase Chain Reaction -Exponential amplification End of 35 cycles 236 = millions of copies PCR products RT Marker RNA 22 4 copies 23 8 copies 24 16 copies 32 copies Real-Time PCR SYBR Green Dye PCR products Single stranded Double stranded DNA PCR product SYBR Green fluoresces brightly only when bound to double stranded DNA Ethidium Bromide Real-Time PCR Quantitative method Most reliable for mRNA (gene) expression Small amounts of RNA required / tissue Amplification monitored by fluorescence in real-time 96 well plate AMOUNT OF DNA Theoretical and Ideal AMOUNT OF DNA 1 2 4 8 16 32 64 128 256 512 1,024 2,048 4,096 8,192 16,384 32,768 65,536 131,072 262,144 524,288 1,048,576 2,097,152 4,194,304 8,388,608 16,777,216 33,554,432 67,108,864 134,217,728 268,435,456 536,870,912 1,073,741,824 1,400,000,000 1,500,000,000 1,550,000,000 1,580,000,000 10000000000 1000000000 100000000 10000000 1000000 100000 10000 1000 100 10 1 0 5 10 15 20 25 30 35 PCR CYCLE NUMBER Practical !!!!! 1600000000 AMOUNT OF DNA CYCLE NUMBER 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 1400000000 1200000000 1000000000 800000000 600000000 400000000 200000000 0 0 5 10 15 20 25 PCR CYCLE NUMBER 30 35 SERIES OF 10-FOLD DILUTIONS Standard curve generated using serial dilution Melting / Dissociation Curve primer dimer E L Enzyme Linked I S Sorbent A Assay Immuno Protein molecule that performs a chemical reaction Linking an enzyme to an assay/test Attachment of antibodies Test to find out something Technique based on antigen-antibody reaction Examples: HIV tests &PGE2 Well with antibodies Well with antibodies and BSA added antigen binding sites Well with antibodies, BSA, and test sample Well in a microtiter plate Antibody structure Well after washes with wash buffer Well after adding substrate Color developed due to the formation of a substrate Secondary antibody linked to an enzynme is added to the well Well after removing excess antibody Other Techniques • Genome Sequencing – To find out » the base composition (A, T, G, C) » The order in which the bases are arranged • • • Northern Blotting ( mRNA expression) Southern Blotting (copy number) Western Blotting ( protein expression) Southern / Northern Blotting Western Blotting IL-1 TNF iNOS RT-PCR ELISA Colorimetric Assays NO MMP Degrades tissue COX-2 PGE2 (GAG) IL-1 iNOS COX-2 MMP PGE2 GAG Nitrate & Nitrite Questions???????