* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Lac A
Cancer epigenetics wikipedia , lookup
Expanded genetic code wikipedia , lookup
Genomic imprinting wikipedia , lookup
Human genome wikipedia , lookup
Epitranscriptome wikipedia , lookup
Non-coding DNA wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Skewed X-inactivation wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
History of genetic engineering wikipedia , lookup
Primary transcript wikipedia , lookup
Oncogenomics wikipedia , lookup
Population genetics wikipedia , lookup
Gene expression profiling wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Y chromosome wikipedia , lookup
Saethre–Chotzen syndrome wikipedia , lookup
Epigenetics of human development wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Genome evolution wikipedia , lookup
Designer baby wikipedia , lookup
Genome (book) wikipedia , lookup
Gene expression programming wikipedia , lookup
Helitron (biology) wikipedia , lookup
X-inactivation wikipedia , lookup
Neocentromere wikipedia , lookup
Genetic code wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Microevolution wikipedia , lookup
Frameshift mutation wikipedia , lookup
GENETIC CODE FILE 8: POINT MUTATIONS 1. In a mRNA sequence (wt) there is a triplet UUU. After a mutation, the triplet changes in UUA. What kind of mutation happened and which effects have the mutation on the protein encoded by the gene? To switch from UUU to UUA is necessary a mutation in the DNA From TTT to TTA AAA AAT This is a Transversion: it refers to the substitution of a purine for a pyrimidine or vice versa, in deoxyribonucleic acid (DNA). The aminoacid Phenylalanine encodes for UUU will be substitute with Leucine (UUA). This is a Missense mutation. The effect on the protein function is not predictable. 2. This is a sequence of wt mRNA 5’- AUG AGA CCC ACC…. What kind of effects has a mutation the substitute the fifth base from G to U? 5’– AUG AUA CCC ACC… In the second triplet the mutation changes the codon and the aminoacid encoded: Arg (Encoded by AGA) to Ile (encoded by AUA). What kind of effects has a deletion of the sixth base? 5’– AUG AUA CCC ACC… The deletion causes a frameshift of the codon code. All the aminoacids after will be different. Compare the two previous mutations: First case: Probably the protein will be active (Missense mutation) Second case: the protein is totally different from the original protein and probably will not be active. (FrameShift Mutation). 3. A nucleotide sequence below 5 5' 3' 10 15 20 25 30 35 ATTCGATGGGATGGCAGTGCCAAAGTGGTGATGGC TAAGCTACCCTACCGTCACGGTTTCACCACTACCG 3' 5' a) Knowing that the transcription of this sequence is from left to right (5’->3’), write the resulting mRNA sequence: 5’ AUUCGAUGGGAUGGCAGUGCCAAAGUGGUGAUGGC b) Knowing that this mRNA sequence contains the translation start codon, identify the starting codon and indicate the amino acid sequence of the resulting peptide. Met- Gly- Trp-Gln-Cys- Gln- Ser-Gly- Asp- Gly 5' 3' ATTCGATGGGATGGCAGTGCCAAAGTGGTGATGGC TAAGCTACCCTACCGTCACG GTTTCACCACTACCG 3' 5' C) Find which consequences will have on the amino acid sequence: - a transition of the T base pair in position 18; In the DNA sequence: switch from TA to CG; In the mRNA sequence there is a switch between U and C thus between the triplet UGC (Cys) to CGC (Arg) that causes a MIS-SENSE mutation. 5' 3' ATTCGATGGGATGGCAGTGCCAAAGTGGTGATGGC TAAGCTACCCTACCGTCACG GTTTCACCACTACCG 3' 5' - a transversion of the CG base pair in position 20; Case 1: from CG to GC mRNA: switch between C to G From UGC (Cys) to UGG (Trp) MIS-SENSE MUTATION: protein with one different aminoacid Case 2: from CG to AT mRNA: switch between C to A From UGC (Cys) to UGA (STOP) NON SENSE MUTATION thus a truncated protein 5' 3' ATTCGATGGGATGGCAGTGCCAAAGTGGTGATGGC TAAGCTACCCTACCGTCACGGTTTCACCACTACCG 3' 5' - an insertion of a base pair after pair 11 (AT) +1 AUG GGA NUG GCA GUG CCA AAG UGG UGA UGG C Met-Gly-aaX-Ala-Val-Pro-Lys-Trp-Stop After the insertion all the aminoacids will be different: frame-shift. The frame-shift creates a stop codon. d) How can we abolish the insertion mutation in position 11? If in a position near the first insertion a deletion happens, we can restore the correct frame of aminoacids. For example in position 15 (intragenic suppressionsuppressor mutation) +1 AUG-GGA-NUG-GAG-UGC-CAA-AGU-GGU-GAU-GGC Met-Gly-aaX-Glu-Cys-Gln-Ser-Gly-Asp-Gly The second mutation restore the correct reading frame. Only the aminoacids located between the two mutations will be different. DNA with insertion and subsequent suppressor mutation: 5’ ATTCGATGGGANTGGAGTGCCAAAGTGGTGATGGC 3’ 3’ TAAGCTACCCTNACCTCACGGTTTCACCACTACCG 5’ This is a polypeptidic sequence of a protein. Wild type and mutant sequences are compared. What type of mutations did happen? WT : Met-Arg-Phe-Thr… Mutant 1: Met-Ile-Phe-Thr… Mutant 2: Met-Ser-Ile-Tyr We compare mutant 1 with the wt: the second aminoacid is different Arg could be encoded by CGU, CGC, CGA, CGG, AGA, AGG Ile could be encoded by AUU, AUC, AUA It is probable that the codon encoding Arg could be AGA, and a mutation occoured orginating AUA Phe could be encoded by UUU/UUC and Thr by ACU/ACC/ACA/ACG, The possible DNA sequence will be: Sequence of wt: AUG – AGA – UUPy – ACN Sequence of mutant 1: AUG – AUA – UUPy – ACN - WT : Met-Arg-Phe-Thr… Mutant 1: Met-Ile-Phe-Thr… Mutant 2: Met-Ser-Ile-Tyr We compare mutant 2 with wt: all the amicoacids after the Methionine are different. A frameshift mutation caused by an insertion. AUG – AGA – UUPy – ACN – Ser is encoded by UCN or AGU-AGC , We can hypotesize the sequence: AUG –AGN–AUU-PyACWith N=U/C The third codon AUU = Ile The fourth codon will be UAC = Tyr 5An Escherichia coli mutant auxotroph for tryptophan (Trp-) has an amino acid substitution in tryptophan-synthetase: Glycine at position 210 is replaced by an Arginine. On the basis of the genetic code, find which kind of mutation (on the DNA) you think has caused the amino acid replacement Gly Codons : GGU GGC GGA GGG Arg Codons We can hypothesize a single base substitution First base G could switch to C or A GGU->CGU; GGC->CGC; GGA->CGA; GGG->CGG; GGA->AGA; GGG->AGG : CGU CGC CGA CGG AGA AGG In the Escherichia coli metA gene a base substitution occurred. Because of this mutation, in the mRNA a UAA codon is present inside the gene. - Which consequence will this mutation have on protein synthesis? The triplet UAA is a stop codon, Thus the protein synthesis will be interrupted. The primary transcript of chicken ovalbumin RNA is composed by 7 introns (white) and 8 exons (black): If the Ovoalbumin DNA is isolated, denaturated and hybridized to its cytoplasmic mRNA, which kind of structure do we expect? Exon INTRON mRNA Structure with loops corresponding to introns. if a deletion of a base pair occurs in the middle of the second intron, which will be the likely effects on the resulting polypeptide? We don’t have any effect if the mutation is not in the splicing site. if a deletion of a base pair occurs in the middle of the first exon, which will be the likely effects on the resulting polypeptide? We have a frame-shift effect or a truncated protein. FILE 9 A man has the chromosome 21 translocated on the 14. Draw the karyotype (only the chromosomes involved in the mutation). What kind of gametes will be produced by this person? Which will be the consequences on the progeny, if this man has a child together with a normal woman? 14 21 14 21 14-21 Karyotype 21 Pairing of homologous chromosomes during meiosis 14-21 21 14 GAMETES 14 14-21 14-21 Parent with translocation Normal Parent Normal Gamete Gametes (First parent) Gametes (First parent) 14-21 21 14 14-21 14 21 Trisomy : Down’s Syndrome 2 chromosomes 14, 3 chromosomes 21 21 Monosomy : not compatible with life 2 chromosomes 14, 1 chromosomes 21 14 Trisomy : not compatible with life 3 chromosomes 14, 2 chromosomes 21 Monosomy 14 n:ot compatible with life 1 chromosome 14, 2 chromosomes 21 21 Zigote healthy carrier: normal phenotype 14 21 14-21 Normal Zigote: normal phenotype 2 chromosomes 14, 2 chromosomes 21 2 chromosomes 14, 2 chromosomes 21 Which will be the consequences on the progeny, if this man has a child together with a normal woman? 1/6+1/6+1/6: ZIGOTEs not compatible with life 1/6 1/6 1/6 2In humans trisomy of chromosome 21 is responsible of the Down syndrome. - which gametes originated an affected person? - draw a scheme of the meiotic stages that can give rise to the mutated gamete and indicate the name of this process. - Chromosomes are distributed to gametes incorrectly - The gametes either are missing or have an extra chromosome 21 - It is caused by the NONDISJUNCTION of chromosome 21 during meiosis. 3. A man carries a heterozygous paracentric inversion. A B C D E F G H a b c d g f e h Draw a scheme of homologous chromosomal pairing during meiosis F E ABCD Draw only one cromatide for each chromosome. f e g G H h abcd Which gametes are produced (in particular which gametes are missing)? Explain why. Parental gametes A B C D E F G H a b c d g f e h Verranno prodotti i GAMETI PARENTALI ma mancheranno i gameti che hanno subito un evento di ricombinazione all’interno della regione invertita. F RECOMBINATION (CROSSING-OVER) E ABCD f e g G H h abcd A B C D RECOMBINANT GAMETES h E f g e F G d c b a H Effect: a DICENTRIC CHROMOSOME (TWO CENTROMERES) and a ACENTRIC FRAGMENT CHROMOSOME (lost). Does the presence of the mutation change the fertility of this man? No, if duplication is not extended. 4. Deletion of a small region on Y chromosome in humans can prevent the individual development as a male. How can you explain this result? The deletion is on a locus of Y chromosome where the SRY gene (Sex determining Region Y) is located. It encodes for the TDF, Testis Determining Factor. Missing of this gene prevent the development as a male, thus the individual develops as a FEMALE 6how can a triploid organism originate? Draw a scheme of meiosis process in a triploid cell with n = 3. From the cross between a gamete n + gamete 2n. Chromosomes A, B e C gamete 2n= AABBCC gamete n = ABC individual 3n=AAABBBCCC In a triploid cell which gametes are produced? BB (1/2) CC (1/2) C (1/2) AABBCC (1/8) AABBC (1/8) B (1/2) CC (1/2) C (1/2) AABCC (1/8) AABC (1/8) BB (1/2) CC (1/2) C (1/2) ABBCC (1/8) ABBC (1/8) B (1/2) CC(1/2) C (1/2) ABCC (1/8) ABC (1/8) AA (1/2) A (1/2) 2/8 are gametes that could generate an individual 6/8 are not compatible with life 7Asiatic cotton and American cotton have both 26 chromosomes. The cultivated cotton, that is derived from the previous species by alloploydia, has 52 chromosomes. Explain, with a scheme, how it originates. We hypotize that both species 2n = 26 ASIATIC COTTON (A) = 13 chromosomes AMERICAN COTTON (B) = 13 chromosomes If in the hybrid a doubling of chromosomes occours, we have an alloploid that is fertile because each chromosome has its homologous. 2 A + 2 B = 26 + 26 = 52 Chromosomes FILE 10 1. In Escherichia coli, the lac (lactose) operon, is made of the following genes and sites. Specify what is the function of the ones indicated below: - promoting site - operator site - repressor gene - structural genes. PROMOTER DNA site where RNA polymerase sits to start transcription. REPRESSOR gene that encodes for a protein that negatively regulates transcription. OPERATOR DNA locus where the repressor could bind to stop transcription. STRUCTURAL GENES Genes that are usefull for a cellular function; for example metabolism of lactose. 2. What would be the result of a base substitution that inactivates the following genes: LacZ- Since the gene encodes for b-galattosidase enzyme, a mutation in this gene probably inactivates the function of the gene. LacIThis gene encodes for the repressor of lactose operon. The mutation will have different effects depending on the protein domain where it occours: a) If the mutation inactivates the protein (frame-shift, stop codon, missense), we have the absence of the repressor and costitutive transcription of the structural genes (recessive mutation LacI-) b) If the mutation alters the allosteric domain of the protein where the inducer binds, we have constitutive repression of the structural genes because the repressor is bound to its site and is not influenced by the presence of lactose. (dominant mutation, LacIs) 3. What would happen if a base deletion occurs in the operator region? OPERATOR is the DNA locus bound by the repressor to stop transcription. After the mutation in the operator, the repressor could be unable to recognize the locus. Thus, we have the constitutive expression of the genes. The mutant in operator constitutive lacOc (cis DOMINANT) 4. Which of the following genotypes will be able to produce β-galactosidase and/or permease in the presence of lactose? bgal perm. Genotype 1 Lac I+ Lac P+ Lac O+ Lac Z+ Lac Y+ Lac A+ + ….. + …… Genotype 2 Lac I+ Lac P+ Lac O+ Lac Z+ Lac Y- Lac A+ + ….. …… Genotype 3 Lac I- Lac P+ Lac O+ Lac Z+ Lac Y+ Lac A+ + ..…. + …… Genotype 4 Lac I+ Lac P+ Lac Oc Lac Z+ Lac Y+ Lac A+ + …… + …… Genotypes 3 and 4 -> constitutive transcription of Lac operon (no repression) 4. If the lactose is not present, in which mutants the expression of genes change? bgal perm. Genotype 1 Lac I+ Lac P+ Lac O+ Lac Z+ Lac Y+ Lac A+ - -….. …… Genotype 2 Lac I+ Lac P+ Lac O+ Lac Z+ Lac Y- Lac A+ - ….. …… Genotype 3 Lac I- Lac P+ Lac O+ Lac Z+ Lac Y+ Lac A+ + ..…. + …… Genotype 4 Lac I+ Lac P+ Lac Oc Lac Z+ Lac Y+ Lac A+ + …… + …… Genotypes 1 and 2 will not express the genes (REPRESSION) 5. What does it mean that the Oc mutation is dominant in cis? How can I demonstrate it? CIS dominant mutation: it expresses the dominant phenotype but it affects only the expression of genes on the same DNA molecule where the mutation occurs. LacOc, affects only neighbouring genes (plasmid) We construct an heterozygote with: The mutation lacZ- located in cis to lacOc (no production of b-galattosidase) The gene lacZ+ in trans (plasmid) Phenotype in absence of induction: mutation is cis-dominant -> no b-gal activity mutation is trans-dominant -> b-gal activity 7. Two bacteria have a Trp- phenotype, cioe? The Trp- bacteria are unable to synthesize Tryptophan How do I verify whether the two mutations are in the same gene? I complement them: I produce bacteria carrying both mutations one on a plasmid, the other on the chromosome. To analyze the phenotype I plate them on a medium without Tryptophan CASE 1: If bacterias grow, the two mutations complement each other, because they affect two different genes. CASE 2: If bacterias don’t grow, the two mutations do not complement each other, because they affect the same gene.