* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download DNA
DNA paternity testing wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Epigenetics wikipedia , lookup
Human genome wikipedia , lookup
Designer baby wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Genetic engineering wikipedia , lookup
DNA barcoding wikipedia , lookup
Molecular Inversion Probe wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
DNA sequencing wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Metagenomics wikipedia , lookup
DNA profiling wikipedia , lookup
DNA polymerase wikipedia , lookup
Point mutation wikipedia , lookup
Primary transcript wikipedia , lookup
Genomic library wikipedia , lookup
Microevolution wikipedia , lookup
DNA vaccination wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
DNA nanotechnology wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Genealogical DNA test wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Non-coding DNA wikipedia , lookup
Epigenomics wikipedia , lookup
Molecular cloning wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Genome editing wikipedia , lookup
DNA supercoil wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Microsatellite wikipedia , lookup
History of genetic engineering wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
SNP genotyping wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Genotypic Microbiological Methods Can be used to determine genetic composition of organisms: Identify organisms (diagnostics) Identify distinct groups of organisms (taxonomy/systematics) by examining similarity between organisms Examine temporal or spatial variation of populations Study genes function and regulation Assess viability of cells Overview of Molecular (DNA) Methods • Restriction Enzyme Digestion – RFLP DNA “fingerprinting” – PFGE • Labeled Probes • PCR based methods • DNA sequencing • DNA microarrays Combination of methods e.g. ribotyping DNA isolation • • • • Grow cells to stationary phase (for maximum yield) Lyse cells with heat, enzyme, or detergent Digest proteins with proteinase K enzyme Separate DNA from other molecules by solubility, charge, size etc..( methods vary) Commercially available methods Use centrifuge to pass cell lysate through filter, DNA binds to filter Add solvent to filter and centrifuge DNA out into clean tube Gel Electrophoresis DNA samples added to wells in matrix - Gel made of translucent, porous matrix + DNA migrates at a rate inversely related to log10 of amplicon size Gel electrophoresis EtBr binds to DNA as it travels through the gel EtBr fluoresces under UV light When viewed in the dark UV light, the DNA appears as bright bands Larger fragments of DNA remain near the top and smaller ones migrate to the bottom Hybridization and Annealing of Nucleic Acids Complimentary sequences of ssDNA will bind together to form dsDNA Temperature at which dsDNA remains together depends on percent of matching and GC content Does not yield the DNA sequence of organisms, just the sequence similarity between organisms Total genomic hybridization can be used to estimate overall genetic similarity between organisms Oligonucleotide primers and probes can be designed to detect and ID genes Labeled Probes Oligonucleotide-short piece of DNA Complementary-has corresponding nucleotide base sequence (ATCG- TAGC) Target- specific region of organism’s DNA to be probed Labels- a molecule that is attached to the probe and can be observed by some direct (fluorescent) or indirect means (immunodetection) TATGCATT TAACGCCGAGGTATGCATTGCATGCCTGACTGAATCGA ….ATTGCGGCTCCATACGTAACGTACGGACTGACTTAGCT…….. RFLP RFLP-restriction fragment length polymorphisms Organism B Organism A DNA RE cuts wherever it recognizes specific site _ + Gel electrophoresis Separation and visualization DNA fragments _ Large pieces of DNA Small pieces of DNA + L 1 2 3 4 5 6 7 8 9 10 11 12 13 14 L Ribotyping cells DNA EcoRI Transfer to nylon membrane (Southern Blot) Bind labeled 16S rDNA Probe Anti-probe Ab and enzyme-linked color reaction 1% Agarose Gel + Gel electrophoresis PFGE (Pulse Field Gel Electrophoresis) + + Agarose gel - - Repeatability and Discrimination Trial 1 Trial 2 PCR polymerase chain reaction • Invented by Kary Mullis in 1983 • Now widely used for many types of scientific research and medical diagnostics • Works by amplifying target region of DNA using: – synthetic oligonucleotides called primers – Taq polymerase enzyme – Temperature cycling Concept • Amplify small quantities of DNA by in vitro DNA replication Target DNA PCR Copies of Target DNA (amplicons) Generalized PCR cycle repeated ca. 40 times 94 degrees Celsiusdenaturation 72 degrees Celsiusextension Ca.45-60 degreesprimer annealing Taq Target sequence Primers 3’…GTATTATGGTATGCTTGCCTCTGAATGAGAATATGGCACCATCGAAA… 5’TACGAACGG primers 3’CCATCGAAA 5’…TATCGAACGGAGACTTACTCTTATACCGTGGTAGCTTTGTAATGATATT… Specificity of PCR depends on the sequence to which they bind Extension (polymerization) 3’…GTATTATGGTATGCTTGCCTCTGAATGAGAATATGGCACCATCGAAA… 5’TACGAACGG Taq Taq 3’CCATCGAAA 5’…TATCGAACGGAGACTTACTCTTATACCGTGGTAGCTTTGTAATGATATT… PCR Primers anneal to both strands of target sequence New strands of DNA are added (5’ to 3’) from the primers In subsequent cycles, primers can bind to amplicons in addition to the original DNA Amplicons increase exponentially with each cycle Single copy of dsDNA target 1st Cycle 2nd Cycle 3rd Cycle Factors that influence specificity • Stringency of conditions – Degree of primer sequence match to target sequence – Primer length – Annealing temperature • Uniqueness of target sequence – Primers will bind wherever there is a complementary target sequence Factors that influence sensitivity • Presence of necessary components – Taq – dNTPs – Magnesium – Target sequence – Primers • Presence of inhibitory chemicals • Primer hairpins and self dimers Can be used to generate qualitative or quantitative data L 1 2 3 - Positive Charge Negative Charge L 1 2 3 - fluorescence Real Time PCR Time Can be used to estimate the starting concentrations of DNA Reverse Transcriptase PCR • RNA converted to cDNA by reverse transcriptase enzyme • cDNA used to perform PCR • Used to detect specific RNA viruses • Used to test viability of cells DNA sequencing • DNA usually in the form of PCR amplicon • One strand at a time • Most thorough method of studying variation in DNA and assessing DNA similarity • Relatively expensive and time consuming (however, this is constantly improving) • Can now sequence entire genomes of organisms Extension (polymerization) 3’TAGCTTGCCTCTGAATGAGAATATGGCACCATCGAAA… 5’ATCGAACGGAGACTTACTCTTA T Taq dNTPs are randomlyincorporated into new strand until a ‘stop’ is added T A A G A C A G T C T A 3’TAGCTTGCCTCTGAATGAGAATATGGCACCATCGAAA… 5’ATCGAACGGAGACTTA Taq Possible fragments A G C T T A G T If there is contradictory info, it will be read as ‘N’ Sequence Trace DNA microarrays (Gene Chips) Labeled complementary nucleic acid binds and stimulates chip ~1cm Microarray Chip containing thousands of blocks Each block is affixed with numerous copies of a nucleic acid sequence