Download Microarray Lessons Packet - McCarter Biology

Homework – DNA Chips/Microarray
Name ______________________________ Per # ______
1. Watch the animation at http://www.bio.davidson.edu/courses/genomics/chip/chip.html (or follow the link
from the class website) and answer questions #2-10 below. You may need to watch the animation more than
once to fully understand it. “Google” some of the answers if you can’t find them on the animation.
2. What is one common use for DNA chips?
3. What are “aerobic and anaerobic conditions”?
4. What piece of laboratory equipment is the scientist using to spin the test tubes?
5. What are the major steps used to conduct a microarray experiment? List these in order. Write a #1 next to
the step that happens first and so on.
_____Scan the results by viewing the different colors on the microarray.
_____Collect the tissue to be studied (ex- from normal and from cancerous lung tissue).
_____Apply fluorescently labeled cDNAs to the gene sequences printed on the slide. Complementary sequences will
bind to each other (G with C / A with T).
_____Prepare labeled cDNA from each of these mRNA samples.
_____Analyze the results and identify which genes to isolate for further study.
_____Isolate mRNA.
6. What four colors are seen in most microarrays used in scientific research?
_______________________________
7. What is a housekeeping gene? Give one example. ___________________________________________
______________________________________________________________________________________
What color would the spot of a housekeeping gene be on a microarray? _________________
Chris McCarter; [email protected]; mccarterbiology.edublogs.org
Page 1
8. For each of the situations below, describe what color you expect the gene spot to be on a microarray
(Note: it will either be green, yellow, red or black):
GENE DESCRIPTION
COLOR OF SPOT ON
MICROARRAY
a gene was expressed (transcribed) more
in lung cancer cells than in normal lung cells
a gene was transcribed the same in both
cells
a gene wasn't transcribed at all in either
cell
a gene was expressed (transcribed) more
in normal lung cells than in lung cancer
cells
Homework day 2:
1. This website from the University of Utah Genetics Science Learning Center has an excellent tutorial and a
great virtual lab on microarrays. http://learn.genetics.utah.edu/content/labs/microarray/ .Complete the tutorial
and take careful notes and answer the questions below.
2. What is “genomics”? ____________________________________________________________________
3. What does it mean that a gene is “turned on” or “turned off”? _____________________________________
________________________________________________________________________________________
4. What is a “gene chip”?___________________________________________________________________
5. How is cancer related to genes? ___________________________________________________________
6. What is a “poly-A tail”? __________________________________________________________________
7. What color fluorescent dye is used to “tag” the healthy and the cancerous DNA?
______________________________________________________________________
8. What is cDNA? ___________________________________________________
9. What is hybridization of DNA? ____________________________________________________________
Chris McCarter; [email protected]; mccarterbiology.edublogs.org
Page 2
10. What color is the microarray spot when both green and red cDNAs hybridize to the microarray DNA?
_____________
11. What do the “dark spots” on the scanned microarray tell about the gene?__________________________
____________________________________
12. What does a yellow spot tell us about that gene? ____________________________________________
13. Besides cancer, what other gene(s) might be of interest to study using microarrays? Why would that gene
be important to study? Who might be especially interested in the study results? (You don’t have to limit yourself
to human genes!)
Adapted by Chris McCarter from:
Zanta, C. A. (2006). Using Gene Chips to Study the Genetics of Lung Cancer: A DNA Macroarray Lab.
http://www.bio.davidson.edu/people/macampbell/LRSD/Full_Handout.doc
Chris McCarter; [email protected]; mccarterbiology.edublogs.org
Page 3
How Can Microarrays Be Used to Personalize Medicine?
Name ___________________________________ per# _________
Objectives:



Explain how DNA, gene expression, and enzyme production relate.
Use a paper DNA microarray to determine the function of gene variants for the enzyme cytochrome
P450 in 3 different “patients”.
Evaluate how the genes each patient inherited will affect their level of codeine detoxification and
conclude whether or not the patient should be prescribed codeine.
Materials per group
• One “microarray”
• One or more envelopes of “patient complementary DNA” (cDNA)
• Clear plastic sleeves, one per group
• Envelopes, one per patient cDNA (at least two per group)
Background
The sequencing of the human genome has paved the way for the new field of pharmacogenomics, or
personalized medicine. The raw material of evolution is random mutation at the DNA level. These mutations
(variation) may result in an improvement of “fitness” to the environment, may be of no consequence, or may be
detrimental to an organism. In some cases, variations in DNA can have serious ramifications for the
development and treatment of disease.
Cytochrome P450’s are a huge family of enzymes that are involved in detoxification of foreign chemicals.
There are 18 related “families” of cytochromes, and over 57 distinct genes have been discovered so far – and
each of these genes has many variations, known as variants. This activity is based on the activity of a
cytochrome enzyme called “CYP2D6”.
Individual variation in the cytochrome genes can have a dramatic impact on the metabolism of drugs,
making the drugs ineffective or even dangerous. Commonly prescribed antidepressants (Prozac, and Paxil
among them), heart medications, and pain relievers such as codeine are among this enzyme’s substrates.
For codeine to exert its pain-relieving effect, it must be converted to morphine by the body. If an individual
possesses genes that overproduce the enzyme, or does not produce sufficient amounts, administration of
codeine could be disastrous.
Literally hundreds of combinations of gene variants exist, and the test is designed to identify all currently
known variants. This test is particularly useful to screen candidates for antidepression medications. Often,
patients do not respond well to certain antidepressants, trying different ones for years, or they may have
adverse reactions to certain drugs. For example, it is lethal to administer certain chemotherapy drugs on a
childhood leukemia patient who has inherited a particular gene variant. Wouldn’t you like to know if your child
has inherited that variant BEFORE he/she gets the chemotherapy?? Many of these situations are due to
variations in cytochromes. With the microarray test, a person’s CYP2D6 genotype can be determined,
and they can be prescribed medications that do not require CYP2D6 activity if necessary.
Chris McCarter; [email protected]; mccarterbiology.edublogs.org
Page 4
**The number of CYP2D6 genes you have and/or the variant of the gene you inherited will affect how you
metabolize medicines. Predict how a patient might metabolize codeine based on the pop beads demo you just
witnessed.

“Wild type” gene or one wild type and one normal variant. ____________________________________________

Two nonfunctional copies of the CYP2D6 gene _____________________________________________________

A duplication of active genes. ___________________________________________________________________

A person with a functioning gene and a defective ___________________________________________________
Procedure:
1. In our simulation, we will begin by showing the results for two individuals who have normal gene
expression (Control #1 and Control #2). For illustration purposes, we are showing only two cDNA’s, (reversed
transcribed from expressed isolated mRNA of the patient), one from each of the (usually) two copies of the
CYP2D6 gene.
2. PATIENT SCENARIOS
Patient A
“Jane Doe”, a 9 year old diagnosed with sickle cell anemia, presented at the hospital with a pain crisis (when
the circulation of blood vessels is blocked by sickled red blood cells, causing tissue death). She was given the highest
dose of codeine recommended for her age and weight, but received no relief.
According to the microarray, what enzyme activity is associated with Jane’s genotype?
______________________________________________________________________________________
How does this explain why Jane is getting no relief from the pain although she was given the proper dose of
codeine? ______________________________________________________________________________
What do you suggest the doctor do? _________________________________________________________
Patient B
“John Doe”, a 45 year old man experienced weakness, coughing, wheezing, and slight fever. His doctor
diagnosed pneumonia, and prescribed appropriate medications, including a low dose of codeine to ease the
cough. Four days later, John was rushed to the hospital in an unresponsive state. He was given supportive
therapy but remained in a coma. After two days he regained consciousness, became fully alert 12 hours later,
and fully recovered from pneumonia in two weeks.
How does John’s genotype explain why the codeine put him into a coma?
______________________________________________________________________________________
What about Patient C? Would you recommend that he be given codeine? Explain.
Adapted from:
Karen Kalumuck, Exploratorium Teacher Institute
DRAFT 2009
Chris McCarter; [email protected]; mccarterbiology.edublogs.org
Page 5
How Can Microarrays Be Used to Discover Cancer Genes?
Name ______________________________________ Date ___________________Per # ___________
Pre-lab: You are part of a research group studying human genes involved in cancer. You have identified genes using a
genetic database comparison (like the NCBI website we used in chapter 12) and other computer analyses. However,
there are many sequences with unknown functions. Your research group believes that many of these unknown genes
play a role in either the prevention of cancer in normal cells (much like the TP53 gene we studied in chapter 10) or the
excess growth of cancer cells in abnormal tissues.
What is an oncogene? ____________________________________________________________________________
What is a proto-oncogene? ________________________________________________________________________
What is a tumor suppressor gene?___________________________________________________________________
What is a housekeeping gene? _____________________________________________________________________
Your group has decided to use microarrays to study genes expressed in normal cells vs.
abnormal cancerous cells. Your goal is to identify which genes are most important to study
and which ones should be studied first.
1. Each research group will work with two different tissue samples (normal and cancerous).
 First, you must extract the mRNA from each tissue sample. A problem with mRNA is that it is very
unstable.
 The mRNA must be converted into cDNA (complimentary DNA). cDNA is made in a process similar to the
transcription of mRNA from DNA. However, in this process, the DNA is copied from the mRNA template,
and it is called “reverse transcription”.

In preparation for microarrays, the cDNA is labeled with different fluorescent nucleotides (either blue
dye or red dye). Which color will be used to signify the cancer cDNA? ______________________
To review the process of converting mRNA to cDNA, complete the following problem in the space provided. You
extracted the following mRNA sequence (among thousands of other mRNAs) from cancerous cells:
What is the cDNA sequence that would be synthesized from this mRNA?
5’ CCUGGCGCAAGCAUUGGAAUCGG 3’
Chris McCarter; [email protected]; mccarterbiology.edublogs.org
Page 6
Procedure I – Learning Technique:
2. Your group has done an excellent job carefully extracting mRNA and preparing fluorescently labeled cDNA from
your tissue samples! Your teacher will give you copies of these labeled single-stranded cDNAs. The normal cDNA
was labeled with a green fluorescent dye, and the cDNA from the cancerous cells was labeled with a red dye.
3. Your research group of 4 scientists has obtained a microarray slide containing closeups of 6 spots of short strands
of DNA representing different human genes with unknown functions.
How does this compare with an actual microarray slide? ____________________________________________
4. Mix the fluorescently-labeled cDNA from the two cell samples (if they aren’t already mixed).
5. Hybridize (match up) the microarray slide with these labeled cDNAs. Each cDNA will bind to the spots that have
complementary sequences. While you do this for all of the cDNAs, try to neatly stack your hybridized cDNAs to
keep the microarray sequence in view. There may be more than 1 piece of cDNA matching to each microarray
spot.
6. “Wash” the slide to remove excess fluorescent cDNA not bound to spots. (You may simply remove the unbound
cDNAs and put them back in your envelope.)
7. Read the microarray using an instrument that measures the fluorescence of each spot.
 Remember what color red and green lasers together make? ___________
 What color will a spot be if it has no cDNA matches? _____________
On the blank microarray slide below, use markers or colored pencils to color each spot.
1
2
3
4
5
6
8. Analyze the data to determine which genes (represented by spots on the slide page) are expressed in each tissue
sample (and which are expressed in both). What does each color represent about the expression of the gene?
green = _______________________________________________________
red = ________________________________________________________
yellow = _____________________________________________________
black = ______________________________________________________
Chris McCarter; [email protected]; mccarterbiology.edublogs.org
Page 7
9. Your group has obtained interesting results that may be useful in determining how cancer cells differ from normal
cells! The next step in genomics studies is to further study those genes that appear to be important in your treated cells.
Which unknown gene sequences (#1-6) appear to be genes used in all cells? ____________________________________
Which unknown gene sequences (#1-6) might be cancer-preventing genes? ____________________________________
Which unknown gene sequences (#1-6) might be genes that cause cells to become cancerous? _____________________
Are all of the genes expressed at the same level? How do you know this? What could this mean?
What additional questions do you have regarding your microarray results?
Let’s Make Your DNA Microarray Results “Quantitative”
In a real laboratory situation, lasers excite the fluorescent labels (dyes). A computer stores this information, then
assigns a “quantitative value” to each spot based on the intensity of the fluorescent signals (including a combination of
the two dyes). Scientists then interpret the data, looking for genes that are expressed differently between the “control”
cells and the “experimental cells”.
1. Working together with your research group, you will need to devise a procedure for quantifying your colored
spots. Write your procedure below.
2. The class will peer review your procedure.
Chris McCarter; [email protected]; mccarterbiology.edublogs.org
Page 8
3. Use the procedure your class has determined to be the best. Show your results in a data table below.
Which genes should your group of scientists study further? ________________________________________________
Which gene(s) should not be studied at all? __________________________________________________
Which gene(s) are housekeeping genes? ____________________________________________________
What do you think scientists/geneticists could do with the genes next that would help humanity?
Adapted by Chris McCarter from ©2004 Carolyn A. Zanta, UIUC-HHMI Biotechnology Education and Outreach Program (BEOP)
www.life.uiuc.edu/hughes/footlocker
Chris McCarter; [email protected]; mccarterbiology.edublogs.org
Page 9
Procedure II – Experimental Design:
1. Due to your great success with detecting cancer genes via microarrays, your group has been asked to conduct
research on a number of diverse topics involving microarrays. As a group, decide what new research you will conduct.
Your group wants to “branch out” and try something new, so it cannot be about cancer genes!
Scientific Problem:
2. Your job will be to develop the microarray similar to how Part I was done for you in order to test your problem. You
will also need to develop the cDNAs and an answer key. Blank templates for the microarray and cDNAs are available on
our class website (see the Labs tab – microarrays). Tomorrow you will switch labs with another group, complete their
lab, and peer review it. The grading rubric can be found on the class website. You will be given colored paper
(fluorescent dye) to stain your cDNA, an envelope to hold your cDNA, and white paper to make your paper microarray.
Chris McCarter; [email protected]; mccarterbiology.edublogs.org
Page 10
Ethics of Genetic Testing Using Microarrays
1. A group of geneticists recently discovered a genetic link to violent criminal behavior. In their studies, over 65% of
prisoners have 3 genes involved in the study compared to only 8% of the general public. There has been a push by some
local politicians to have everyone arrested tested for these genetic markers. Some even believe we should test
everyone at birth.
2. Many elite athletes have genes that make them particularly suited to their chosen sport. For instance, there are
genes that determine your V O2 max (amount of oxygen the body can process in producing energy), types of muscle
fibers (fast or low twitch), body weight, number of fat cells, etc. Who might be interested in knowing if someone
possesses these genes?
3. Current DNA fingerprinting tests take a lot of time and cost about $50 per sample. DNA chips are a great way to do
DNA analysis of a large sample very quickly and for very little money. Because of this, DNA chips are an essential part
of “DNA Dragnets”. In a DNA Dragnet, DNA samples from many people in a specific area are tested in a mass DNA
screening. The hope is that one of the people tested in the town will match to the suspect’s DNA. Although this has
been done in the UK and Australia, there is still a lot of debate about performing these mass DNA tests in the US.
4. Scientists employed by a meat production company have been studying gene expression in cows. They have
identified 6 key genes that make cows healthier, make their meat have a better flavor, and make the meat available
faster. They can then genetically alter the embryos and by IVF implant only the embryos containing those 6 genes.
5. Geneticists took DNA samples from obese patients and patients of average-weight. They used microarray technology
to identify a number of genes of interest for further study. They are now able to predict who is predisposed to being
obese. The same technology is used to identify if someone has the gene for type 2 diabetes, Alzheimer’s and high
cholesterol. Many scientists believe that if insurance companies paid for this screening, people could be treated sooner
and therefore increase patients’ lifespans as well as saving taxpayers billions of dollars.
Choose 1 of the scenarios above, discuss carefully with your group, and list the following on the back of this paper:
a. who will be affected by this technology?
b. the benefits of using this technology
c. the cons of making this technology readily available to the general public
d. the issues that policy makers must address (politicians, representatives of the biotech company, and insurance
companies)
e. choose a spokesperson to discuss this as a class
Explain how what we discussed about the above scenarios represents the Grad at Grad Characteristics.
What are the 5 qualities of a Brebeuf Grad at Grad? _____________________
_____________________
_____________________________
Chris McCarter; [email protected]; mccarterbiology.edublogs.org
_______________________
__________________________
Page 11