* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Duplication of Small Segments Within the Major
Cancer epigenetics wikipedia , lookup
Skewed X-inactivation wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
DNA barcoding wikipedia , lookup
Human genome wikipedia , lookup
DNA polymerase wikipedia , lookup
DNA profiling wikipedia , lookup
Primary transcript wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
DNA vaccination wikipedia , lookup
Y chromosome wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Metagenomics wikipedia , lookup
Microevolution wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Point mutation wikipedia , lookup
Designer baby wikipedia , lookup
X-inactivation wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Non-coding DNA wikipedia , lookup
Molecular cloning wikipedia , lookup
History of genetic engineering wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Epigenomics wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Genome editing wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Genomic library wikipedia , lookup
DNA supercoil wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Microsatellite wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Helitron (biology) wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Neocentromere wikipedia , lookup
From www.bloodjournal.org by guest on August 3, 2017. For personal use only. Duplication of Small Segments Within the Major Breakpoint Cluster Region in Chronic Myelogenous Leukemia By Craig E. Litz, John S . McClure, Cedith M. Copenhaver, and Richard D. Brunning The t(9;22) in chronic myelogenous leukemia (CML) may be reciprocal or, in a minority of cases, may result in an extensive deletion of a portion of the major breakpoint cluster region (M-bcr) of the BCR. This report provides evidence of the duplication of small segments within the M-bcr in a small group of patients with CML. Southern blots of Bgl II and Bgl II/BamHI double-digested DNA from the blood or bone marrow of 4 6 patients with CML were probed with a 5 1.4-kb Taq I/Hindlll M-bcr probe and a 3 2-kb Hindllll BamHl M-bcr probe. Inthree patients, rearrangementswere noted with both probes in Bgl Il-digested DNA, but were not present in BglII/BamHI-digestedDNA with either probe. Southern analysis of DNA samples double-digested with Bgl II and BspHl from two of these three cases showed no rearrangements with either probe; the M-bcr BspHl site is located 26 bp 3 of the BamHl site in the second intron of the M-bcr. The presence of a rearranged M-bcr with both probes in BglIl-digested DNA and the lack of rearrangement in BglII/BamHI and Bglll/BspHI double-digested DNA suggest the presence of M-bcr BamHl and BspHl sites on both 9q -I- chromosome (9q ) and the Philadelphia chromosome (Ph). This implies a duplication of at least the 26-bp M-bcr BamHIIBspHI fragment in these two samples. Sequence data from one of these t w o cases confirmed the Mbcr breakpoints t o be staggered; the Ph M-bcr breakpoint occurred 258 bp downstream from the 9q M-bcr breakpoint. It is concluded that a duplication of small segments within the M-bcr occurs in a small group of patients with CML, which may lead t o pseudogermline patterns on Southern blot. Such a duplication may provide insight into the mechanism of some chromosomal translocations in neoplasia. 0 1993 by The American Society of Hematology. C production of some of the probes used in this study was derived from blood leukocytes from healthy volunteers. DNA extraction, restriction enzyme digestion, Southern transfirs, and hybridization. Peripheral blood and bone marrow cells were lysed in TNE (10 mmol/L Tris-CI, pH 8.0, 100 mmol/L NaCI, 1 mmol/L EDTA) buffer in the presence of 1% sodium dodecyl sulfate (SDS). High molecular weight DNA from the cells was fiuther purified by standard proteinase K treatment (Boehringer-Mannheim Biochemicals, Indianapolis, IN) at a final concentration of 0.1 mg/mL. The specimens were ethanol precipitated after several phenol-chloroform extractions. RNase treatment was followed by several more phenol-chloroform extractions and a final ethanol precipitation. For each of the Bgl IIIBamHI, Bgl IIIBspHI, and Bgl II/Sca I double digests, 5 pg of DNA from each sample was digested with 50 U of Bgl I1 (Bethesda Research Laboratories, Inc, Gaithersburg, MD) restriction endonuclease according to the manufacturer’s recommendations. The samples were then ethanol precipitated, resolubilized in TE (10 mmol/L Tris, pH 7.5, 0.1 mmol/L EDTA), and digested with 50 U of either BamHI, Sca I (Bethesda Research Laboratories, Inc), or BspHI (New England Biolabs, Inc, Beverly, MA) restriction endonuclease according to the manufacturer’s recommendations. For each of the single digests, 5 pg of DNA from each sample was digested with 50 U of BglII, HindIII, or Tuq I (Bethesda Research Laboratories, Inc) according to manufacturer’s recommendations. Electrophoresis was performed in horizontal 0.7% or 1.O% agarose gels. Four micrograms of X phage DNA digested with BstEII (Bethesda Research Laboratories, Inc) was included on all gels as a size standard. The man- HRONIC myelogenous leukemia (CML) is a clinically and morphologically distinct hematopoietic stem cell neoplasm. Patients generally present in the chronic phase with splenomegaly, a marked neutrophilia with a left shift, basophilia, and thrombocytosis. Most patients progress to a terminal, therapy-resistant acute leukemia within 5 years of diagnosis.‘ Cytogenetically, the Philadelphia chromosome (Ph) is found in 90% to 95% of CML patients. At the molecular level, this translocation represents the aberrant conjoining of the c-ab1 proto-oncogene from chromosome 9, with the breakpoint cluster region gene (BCR) on chromosome 22. This hybrid gene is transcribed and translated into a chimeric protein product that is considered essential in the pathogenesis of Ph-positive malignancies. Although the breakpoints on chromosome 9 are widely scattered, the translocation breakpoints on chromosome 22 are relatively tightly clustered within a 5.8-kb region referred to as the major breakpoint cluster region (M-bcr). This tight clustering of breakpoints on chromosome 22 has rendered this region amenable to extensive study by conventional Southern blot analysis.’-3 Although the majority of cases of CML shows the predicted rearranged bands within the M-bcr by Southern blot analysis, rearrangements with atypical molecular findings may occur. These include extensive deletions of the 3’ portion of the Mbcr and breakpoints located outside the M - b ~ r .Additional ~,~ aberrancies have also been described in which cleavage by enzymes predicted to flank the translocation breakpoint produces “pseudogermline” or apparently unrearranged bands6 We report a small group of such cases showing a pseudogermline configuration of the M-bcr on Southern analysis and propose that this phenomenon is due to a duplication of small segments within M-bcr sequences in some cases. MATERIALS AND METHODS Cases. The study material consisted of bone marrow or blood samples from 46 patients with CML collected at the University of Minnesota. Approval for examination of this tissue was obtained by the Committee on the Use of Human Subjects in Research at the University of Minnesota. Genomic template DNA used in the PCR Blood, Vol81, No 6 (March 15). 1993: pp 1567-1572 + + From the Department of Laboratory Medicine and Pathology, University of Minnesota Medical School, Minneapolis, MN. Submitted August 31, 1992; accepted November 3, 1992. C.E.L.was a fillow of the American Society of Hematology while this work was performed. Address reprint requests to Craig E. Litz, MD, Department of Laboratory Medicine and Pathologv, Mayo Building, Box 198, University of Minnesota Hospitals, 420 Delaware St SE. Minneapolis, MN 55455. The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C.section 1734 solely to indicate this fact. 0 1993 by The American Society of Hematology. 0006-4971/93/8106-0026$3.00/0 1567 From www.bloodjournal.org by guest on August 3, 2017. For personal use only. LlTZ ET AL 1568 Table 1. PCR Primers Primer Seouence P1 P2 P3 P4 s1 s2 s3 s4 s5 S6 s7 S8 GTTTCAGAAGCTTCTCCCTG ACTCTGCTTAAATCCAGTGG CCACTGGATTTAAGCAGAGT TGTTACCAGCCTTCACTGTT CCAGTTGGTTTCACAATACA ATCCTGAGATCCCCAAGACA AGAAACCCATAGAGCCCCGG CCACTGGATTTAAGCAGAGT GTTTCAGAAGCTTCTCCCTG GATGACTGTCCTTCAAATGA TGTTACCAGCCTTCACTGTT CCGGAATTCGTTACATTTGAACCT'TAGTT M-bcr Location. 5 exon 2+ 3 exon 33 exon 3+ Intron 3Intron 2Intron 2+ 5' exon 33' exon 3+ 5 exon 2+ c-ab/Intron 3c-ab/+ Those derived from c-ab/ sequences are indicated; + or - signify DNA strand assignment; primer S8 has a 5 EcoRl site included to facilitate cloning. ufacturer's methods were used for transferring the electrophoretically separated restriction fragments to Genescreen Plus nylon membranes (Dupont, Inc. Boston. MA). The probes and Bs/EII-digested X DNA were radiolabeled with '*P using the random primer reaction.' The filters were prehybridized. hybridized, stripped, and rehybridized all according to manufacturer's recommendations (Genescreen Plus: Dupont. Inc). Washes were adjusted to the background radioactivity with a final wash in 1.OX to 0.2X standard saline citrate (SSC) solution (0.015 mol/L NaCI. 0.0075 mol/L sodium citrate) and 0.1% SDS at 60°C to 65°C. The filters were exposed to Kodak XAR-5 films (Eastman Kodak Co, Rochester, NY) at -85°C for 24 hours to several days. frohcx The probes used in this study were either the 5' most Tu9 I/llindIlI 1.4-kb fragment of the M-hcr (probe I , Fig I), the 3' most 2-kb //indlIl/Buf?~Hlfragment of the M-bcr (probe 2. Fig I), the 370-bp Hi~1dIIl/A4.~p I fragment from the second exon and intron of the M-bcr (probe 3. Fig 3). the 260-bp Scu IITu9 I fragment from the third intron ofthe M-bcr (probe 4. Fig 3). and the 250-bp BumHI/ exon 3 M-bcr fragment ("Dup" probe, Fig 4). The plasmid containing probe 1 was provided by the American Type Culture Collection (Rockville. MD). The plasmid containing probe 2 was kindly provided by Dr David Leibowitz (Department of Medicine. Indiana University. Indianapolis, IN). Probes 3,4. and "Dup" were derived by polymerase chain reaction (PCR) methodology. Briefly. for probe 3, a primer pair to the second and third M-bcr exons was synthesized from previously published sequence data (Table I. primers PI and P2'). Five hundred nanograms ofgenomic DNA was added to 100 pL of a PCR mixture containing 1.5 mmol/L MgCI2. 50 mmol/L KCI, I O mmol/ L Tris-HCI. pH 8.3, 200 pmol/L dNTP, 20 pmol of each primer. and 2.5 U of Tu9 I DNA polymerase. After initial denaturation at 95°C for 3 minutes. denaturation. annealing. and extension were performed on a DNA Thermal Cycler (Perkin Elmer-Cetus, Norwalk, CT) at 95°C for I minute, 60°C for I minute. and 72°C for I minute and 30 seconds. respectively, for 35 cycles. The 800-bp amplified product was then purified using a PCR Magic Preps (Promega Corp. Madison. WI) column and subsequently doubledigested with Hind111 and .Msp 1. The 370-bp I/indlll/A4.sp I M-bcr fragment was then isolated in and excised from a 2% NuSieve agarose (FMC Corp. Rockland. ME) gel. The fragment was then purified over a PCR Magic Preps column. The 250-bp "Dup" probe (BumHl/exon 3 Mbcr fragment) was isolated in the same fashion from the same 800bp amplification product digested with BumHl only. The 260-bp Scu I/Tuq I M-bcr fragment (probe 4) was isolated in a similar manner, except that the primers were complementary to the third M-bcr exon and intron (Table I: primers P3 and P4R.9).Using the same cycle parameters and PCR mixture as above, a 425-bp amplified DNA fragment was produced that yielded the 200-bp probe 4 after Tu9 I/ Scu I double-digestion. Sequence dutu. The M-bcr consensus sequence in Fig 5 is derived from previous data and methodology" (personal communication to Genome Data Base, Baltimore, MD. March, 1992).The Ph and 9q+ sequences were derived from one of the cases using the inverse PCR method." Briefly. for the Phderived sequence, 100 ng of Tu9 Idigested patient DNA was ligated overnight at 16°C in 90 pL PCR buffer (1.5 mmol/L MgCI2. 50 mmol/L KCI, I O mmol/L Tris-HCI. pH 8.3) with 3 Weiss units ofT4 DNA ligase and 0.8 mmol/L dATP. The mixture was then incubated at 65°C for I O minutes to inactivate the ligase and the circularized M-bcr region was linearized by restricting with 30 U BufnHI for 20 minutes at 37°C in the same reaction vessel. After incubation at 95°C for I O minutes, the remaining dNTPs (dGTP. dTTP. and dCTP), two primers (Table I. primers SI and S2: Fig 5). and Taq polymerase were then added to a concentration of 200 pmol/L (each dNTP). 20 pmol (each primer), and 2.5 Ba Ba - - D B I H H 1 B B 2 lkb Probe1 4.8kb 2.5kb Probe2 - -4.8kb - - 2.4kb 1 2 1 2 A B 1.3kb 1.2kb 1 2 1 2 A B Fig 1. Partial restriction map of the M-bcr on chromosome 22 and Southem blot analysis of two patients with CML. The restriction map shows Bgl II (B), BamHt (Ba), and Hindlll (H) sites. Boxes represent exons of the BCR gene found in this region. Solid bars represent the 5 Taq I/Hindlll and 3' Hindlll/BamHI M-bcr probes used in the Southern blots (probes 1 and 2, respectively). Each autoradiogram panel shows lanes from the same blot probed with each of the two probes. A and B represent DNA digests from two different patients with CML. Bg/ll/BarnHI double-digested and 8g/ It-digested DNA are indicated as 1 and 2 below the autoradiograms, respectively. Lane 1 shows only germline restriction fragments in both cases with both probes. Lane 2 shows both germline and rearranged restriction fragments in both cases with both probes. From www.bloodjournal.org by guest on August 3, 2017. For personal use only. DUPLICATION OF BREAKPOINT CLUSTER REGION Bas 1569 Ba S7 and S8 for the 9q+ breakpoint). and 2.5 U of Tuq I DNA polymerase. Amplification was performed using the same cycle parameters as for probe production above. The amplified products were then inserted into PUC 19. cloned. and sequenced as described above. RESULTS Probe1 Probe2 4.8kb 2.5kb - c. 4.8kb - DNA digested with Bg/ I1 from 46 patients with CML demonstrated M-bcr rearrangement by Southem blot analysis with either the 5’ or 3‘ M-bcr probes (Fig I , probe 1 and probe 2, respectively). Specimens from 6 patients showed rearrangement with only the 5’ probe and I showed rearrangement with only the 3’ probe. These 7 samples were considered to have a M-bcr deletion involving the probed sequence and were not further studied. The remaining 39 specimens showed rearrangement by Southern blot with both 5’ and 3‘ M-bcr - - a Probe 3 c 2.4kb c 1.3kb m- B/BsB B/Bs B A A Fig 2. Partial restriction map of the M-bcr and Southern blot analysis of patient A from Fig 1. The symbols of the restriction map are described in Fig 1; in addition, the BspHl site is indicated as Bs and is 26 bp 3 of the BamHl site. Each autoradiogram panel shows lanes from the same blot hybridized with each of the two probes. B and B/Bs represent Bg/ II and Bg/ II/BspHI double-digested DNA, respectively. The Bg/ II lanes in this figure are the same lanes as the A-2 lanes in Fig 1 and show both rearranged and germline restriction fragments with both probes. The Bg/ II/BspHI lanes show only germline restriction fragments with both probes. U (Tuq I DNA polymerase). The sample was then amplified using the Same cycle parameters as described above. Two amplification products were identified on a 5% polyacrylamide gel, a germline band at 556 bp and a rearranged band at 700 bp. The 700-bp band was excised from a low melting point agarose gel. restricted with Tu9 I, and inserted into a PUC19 vector. The resulting double-stranded plasmid was subsequently cloned and directly sequenced using a Sequenase version 2.0 kit (USBiochemicals, Inc, Cleveland, OH). The 9q+ derivative chromosome sequence was derived in a similar fashion except that ( I ) 100 ng of Piw II/Scu I-digested patient DNA was the starting material. (2) no BurnHI linearization was performed, and (3) the primers used i n the amplification were further 3’ in location (Table I.S3 and s4:Fig 5). Amplification yielded four DNA fragments of 125. 150. 500. and 700 bp in length. The Msp ldigested 500-bp fragment was ligated into PUC19. which was subsequently cloned and sequenced: this fragment yielded the 9q+ M-bcr breakpoint of this case. The sequence data in this case were confirmed by direct genomic amplification and sequencing using primers complementary to M-bcr exons and to the c-ah/ oncogene sequence derived from the above inverse PCR method (Table I . primers S5 through S8). Briefly. 500 ng of genomic DNA were added to 100 pL of a PCR mixture containing 1.5 mmol/L MgCI2. 50 mmol/L KCI. I O mmol/L TrisHCI, pH 8.3, 200 pmol/L dNTP, 20 pmol of each complementary primer (Table 1, primers S5 and S6 for the Ph breakpoint and primers 0.6kb 1.4kb T B Probe 4 / \ H T U Bs 1.9kb T B lOObp Probe 4 Probe 3 4.8kW 2 5 k L 1.9kb- - c4.8kb 1 - 2.4kb -2.lkb c0 5 k b 1 2 3 4 5 1 2 3 4 5 Fig 3. Partial M-bcr restriction map and restriction mapping of the breakpoints in patient A from Fig 1. The solid bars labeled probes 3 and 4 represent the HindllllMsp I and Sca I/Taq I M-bcr restriction fragments used in the Southern blot analysis, respectively. B, Ba, Bs, H, S,and T represent Bg/ II, BamHI, BspHI, Hindlll, Sca 1, and Tag Isites. respectively; the Taq I sites indicated include only those that flank the indicated probed sequences. M-bcr exons 2 and 3 are indicated as boxes. Each autoradiogram panel shows lanes from the same blot probed with each of the t w o probes. Lanes 1 through 5 are Taq I,Bg/ll/BamHI. Bg/II/BspHI,Bg/II, andBg/II/Scal digested DNA from patient A in Fig 1, respectively. In the Southern assays using probe 3. germline restriction fragments are seen in the Taq I, Bg/ IIIBamHI, and Bg/ II/BspHI digests, whereas rearrangements are noted in Bg/ II/Sca I and Bgl II digested DNA. This indicates that the M-bcr breakpoint on the Ph chromosome is located between the BspHl and Sca I site. Using probe 4, germline restriction fragments are seen in the Bg/ II/Sca 1, Bg/ II/BspHI, and Bg/ II/BamHI digested DNA, whereas rearrangements are noted in Taq I and Bg/ II digested DNA. This indicates that the M-bcr breakpoint on the 9q + derivative chromosome is located between the BamHl and Taq I site located 20 bp 5 of the BamHl site. From www.bloodjournal.org by guest on August 3, 2017. For personal use only. 1570 1 Dup -I Ba B H 2 H B B BCWPh H BaB Ba w1 B 1 Dup 2 Ba H B LITZ ET AL -r y -4.8kb f + 3.3kb 3.lkb BCWBq+ H B B U Y lkb B B c 1.3kb B Fig 4. Restriction maps illustrating the duplication within the M-bcr and Southern blot analysis of the M-bcr on the normal chromosome 2 2 (BCR/22), Ph chromosome (BCR/Ph), and the 9q chromosome (BCR/9q ) of patient A in Fig 1. Left portion of the illustration shows restriction maps of, from top to bottom, the unreananged M-bcr, the M-bcr on the Ph chromosome, and the M-bcr on the 9q chromosome; the thin and thick lines represent M-bcr and c-ab/ sequences, respectively. The duplicated region of the M-bcr is indicated by a solid box. Probes 1 and 2 and restriction sites are as described in Fig 1. The probe to this duplicated region is labeled ”Dup.” + probes, indicating translocation within the M-bcr. Bg/ II/ BumHl double-digested DNA from this group was screened for M-bcr rearrangement by Southern analysis with the 5’ and 3’ probes. These studies separated those cases with Mbcr translocations into three groups. The first group (9 patients) demonstrated rearrangement with only the 5’ probe, indicating a translocation breakpoint 5’ of the M-bcr BamHl site. The second group (27 patients) demonstrated rearrangement with only the 3’probe, indicating a translocation breakpoint 3’ of the M-bcr BumHI site. The third group demonstrated no rearrangement with either probe (3 patients, Fig I). The finding of a germline restriction digest pattern was problematic as digestion with a flanking restriction enzyme (Bg/ 11) demonstrated rearrangement within this region. In this latter group of 3 patients, Bg/ II/BspHI doubledigested DNA was screened by Southern blot analysis with the 5’ and 3’ probes to exclude the serendipitous alignment of BumHl sites on the Ph and 9q+ derivative chromosomes (Fig 2). As with the Bg/ II/BamHI digests, no rearrangements with either probe were found in two of the three cases.The presence of a rearranged M-bcr with both probes in Bg/ Ildigested DNA and the lack of rearrangement in Bg/ II/BumHI and Bg/ II/BspHI doubledigested DNA suggest the presence of chromosome 22derived BumHl and BspHI sites on both chromosome 9q+ and the Ph chromosome. This implies that the M-bcr BamHI/BspHl fragment is duplicated in these cases of CML. The breakpoints from one case in this third group was extensively restriction mapped without assuming reciprocity in the translocation event (Fig 3). Using the 5’ HindIII/Msp I fragment of the M-bcr as a probe in Southern blot assays (Fig 3, probe 3), rearrangements were noted in the Bg/ II and Bg/ II/Sca I digests; no rearrangements were noted in the Tu9 + + I, Bg/ II/BumHI, or Bg/ II/BspHI digests. This indicates that the breakpoint on the Ph occurred in the 263-bp BspHI/Scu I fragment of the M-bcr. Using the Scu I/Tu9 I fragment of the M-bcr as a probe in Southern blot assays (Fig 3, probe 4), rearrangements were noted in the Bg/ II and Tu9 I digests only; no rearrangements were found in the Bg/ II/Sca I, Bg/ II/BspHI, or Bg/ II/BumHI digests. This indicates that the breakpoint on 9q+ occurred in the 20-bp To9 I/BarnHI fragment of the M-bcr. The BumHIIScu I fragment of the M-bcr was used as a probe in Bgl 11-digested DNA in a Southern blot assay from this one case (Fig 4, “Dup” probe). This yielded two rearranged fragments and one germline fragment. Because the BarnHI/Sca I M-bcr fragment is intact on chromosome 9q+, the presence of two rearranged fragments indicates that the probed sequence is present elsewhere in the genome of this case and is, therefore, at least partially duplicated. Reprobing of the blot with the 5’ M-bcr probe (Fig 4, probe 1) identified one of the rearranged fragments (Ph chromosome) while reprobing with the 3’ probe (Fig 4, probe 2) identified the other rearranged fragment (9q+ chromosome). This indicated that the partially duplicated BamHI/Sca I sequence was located on both the Ph and 9q+ chromosomes. Sequence confirmation of the duplication was obtained through inverse PCR techniques (Fig 5). Briefly, this case was screened with various restriction enzyme/primer pair combinations. A combination of Tu9 I digestion ofgenomic DNA followed by ligation and amplification with primers to intervening sequence I I (IVS 11) of the M-bcr yielded a germline 556-bp fragment and a 700-bp rearranged fragment. Cloning and subsequent sequencing of the 700-bp fragment showed it to be derived from the Ph chromosome with a breakpoint From www.bloodjournal.org by guest on August 3, 2017. For personal use only. DUPLICATION OF BREAKPOINT CLUSTER REGION 1571 22 9q* 22 Ph 99+ 22 Ph 99+ 22 Ph 22 Ph ~tcaagt~agtactggtttggggagcagggttgcagcggccgag gcggatttactctaaggcagttcatatttggtccccagctgagaattatagcctggaaatacc ab1 I- bcr t g c a a c g t + Fig 5. Partial sequence of the M-bcr including the breakpoints on the Ph chromosome and 9q chromosome in patient A from Fig 1. Upper illustration presents (1) the normal consensus M-bcr sequence, (2) the sequence of the Ph chromosome, and (3)the sequence of derivative chromosome labeled 22, Ph, and 9q , respectively. The lower panels show the sequence autoradiograms of the the 9q breakpoints on the Ph and 9q M-bcrs. In both upper and lower portions of the illustration, black and gray arrows mark the 9q and Ph chromosome M-bcr breakpoints. respectively. The primers used to obtain the Ph chromosome sequence were 20-bp oligonucleotides derived from M-bcr sequence immediately adjacent to the BamHl site underscored by the thin black lines; those used to obtain the 9q chromosome sequence were derived from M-bcr sequence further 3 and are indicated by a thick black line. Both primer pairs were in the opposite orientation to those used in non-inverse PCR methods. + + + + + occurring at base 55 of M-bcr exon 111. Double-digestion of genomic DNA with Pvu II/Sca I, followed by ligation and amplification with M-bcr exon Ill primers, yielded 4 fragments between 125 bp and 700 bp in length. Cloning and sequencing of the 500-bp DNA fragment showed this fragment to be derived from the 9q+ M-bcr sequence, with a breakpoint located 12 bp 5' of the IVS I1 BamHl site of the M-bcr. With the sequence data generated above, primers to the c-ab1 portion of both the 9q+ and Ph chromosome were generated and used to amplify, sequence, and verify the respective breakpoints directly from genomic DNA from this case. The sequence-derived breakpoints corroborated Southern blot-derived breakpoints. This indicates that a 258-bp region of the M-bcr is duplicated in this case and is present on both the Ph chromosome and 9q+ chromosome. DISCUSSION The Ph has generally been regarded as a reciprocal translocation between chromosomes 9 and 22, although cases with extensive deletions have been described." This study provides evidence that duplications of the M-bcr may occur. The Southern blot data indicate that Bgl 11-digested DNA from 3 of 46 patients with CML demonstrate a M-bcr rearrangement with both 5' and 3' M-bcr probes, yet, when doubledigested with Bgl I1 and BamHI, show no M-bcr rearrangement with either probe. Furthermore, DNA from two of these three cases double-digested with Bgl I1 and BspHI, a unique M-bcr enzyme site located within 30 bp ofthe M-bcr BamHI site, also show no rearrangement with either probe. Serendipitous alignment of two separate restriction enzyme sites is unlikely. In addition, sequence data indicate that a 258bp M-bcr fragment in one of these cases is duplicated: the breakpoint locations are verified in this case by fine restriction mapping using probes flanking the duplicated area. Southern blot analysis using a probe sequence contained within this duplicated region demonstrates hybridization with both the Ph and 9q+ chromosomes. From www.bloodjournal.org by guest on August 3, 2017. For personal use only. LlTZ ET AL 1572 The presence of a duplicated segment within the M-bcr involved in the Ph raises several significant issues. First, molecular identification of this translocation by Southern blot analysis is commonly used as a diagnostic procedure. The presence of duplicated sequences may create false germline patterns with some restriction enzyme digests, further emphasizing the need to use several restriction enzymes. An M-bcr duplication can confound breakpoint mapping by Southern blot; this may, in part, explain why some studies have suggested that M-bcr breakpoint location is important in the prognosis of CML, whereas other studies could not substantiate this.12 The interpretation of Southern blots in these cases has been made under the assumption of complete reciprocity in the translocation event. Duplicated regions of the M-bcr involving restriction sites invalidate this assumption and data from mapping studies should be reinterpreted in this light. Finally, the presence of a duplication of greater than 200 bp within the M-bcr raises questions as to the mechanism of the translocation event. The presence of a relatively large duplicated sequence militates against simple double-stranded breaks on each chromosome with religation. Short duplicated segments have been described both in cases of Ph-positive acute lymphoblastic leukemia and in cases of follicular lymphoma carrying the t( 14; 1 The investigators in these cases postulated a staggered break on one chromosome of the translocated pair, with subsequent single-stranded ligation and filling of the singlestranded defect. However, both of these cases represented short duplicated sequences of 4 bp or less; it is unclear if the staggered-break hypothesis is tenable in a duplication of the size reported here. A number of additional hypotheses may also be considered. The relevant segment of DNA may be duplicated within the M-bcr before the translocation event and the breakpoint may occur between the duplicated sequences. Conversely, the duplicated sequence may exist on chromosome 9 before the translocation event, creating a potential site for homologous recombination. Neither of these scenarios has been previously identified. The possibility of a rare polymorphism in the patient studied in detail cannot be excluded as neither parental nor cellular DNA lacking the Ph was available in this case. Alternatively, the duplication could arise as a consequence of the translocation event itself. Aberrant DNA replication with asymmetric strand switching between the BCR gene and c-ab1 oncogene could explain such an observation. 8).13314 REFERENCES 1. Kurzrock R, Gutterman JU, Talpaz M: The molecular genetics of Philadelphia chromosome-positive leukemias. N Engl J Med 3 19: 990, 1988 2. Nowell P, Hungerford D: A minute chromosome in human chronic granulocytic leukemia. Science 132:1497, 1960 3. Rowley JD: A new consistent chromosomal abnormality in chronic myelogenous leukaemia identified by quinacrine fluorescence and Giemsa staining. Nature 243:290, 1973 4. Popenoe DW, Schaefer-RegoK, Mears JG, Bank A, Leibowitz D: Frequent and extensive deletion during the 9;22 translocation in CML. Blood 68:1123, 1986 5. Saglio G, Guerrasio A, Tassinari A, Ponzetto C, Zaccaria A, Testoni P, Celso B, Cambrin GR, Serra A, Pegoraro L, Avanzi GC, Attadia V, Falda M, Gavosto F Variability of the molecular defects corresponding to the presence of a Philadelphia chromosome in human hematologic malignancies. Blood 72: 1203, 1988 6. Schaefer-Rego K, Dudek H, Popenoe D, Arlin Z, Mears JG, Bank A, Leibowitz D CML patients in blast crisis have breakpoints localized to a specific region of the BCR. Blood 70:448, 1987 7. Feinberg FP, Vogelstein B: A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal Biochem 132:6, 1983 8. Heisterkamp N, Stam K, Groffen J, de Klein A, Grosveld G: Structural organization of the bcr gene and its role in the P h translocation. Nature 315:758, 1985 9. de Klein A, van Agthoven T, Groffen C, Heisterkamp N, Groffen J, Grosveld G: Molecular analysis of both translocation products of a Philadelphia-positive CML patient. Nucleic Acids Res 147071, 1986 10. McClure JS, Litz CE: PCR-based sequencedetection of a Mae11 polymorphism in the human major breakpoint cluster region (Mbcr). Nucleic Acids Res 19:5090, 199 I 11. Ochman H, Medhora MM, Garza DL, Hart1 DL: Amplification of flanking sequences by inverse PCR in Innis M, Gelfand DH, Swinksy JJ, White T (eds): PCR Protocols: A Guide to Methods and Applications. San Diego, CA, Academic, 1990, p 2 19 12. Mills KI, Benn P, Birnie G D Does the breakpoint within the major breakpoint cluster region (M-bcr) influence the duration of chronic phase in chronic myeloid leukemia? An analyticalcomparison of current literature. Blood 78:1155, 1991 13. van der Feltz MJM, Shivji MKK, Allen PB, Heisterkamp N, Groffen J, Wiedemann LM: Nucleotide sequence of both reciprocal translocation junction regions in a patient with Ph positive acute lymphoblastic leukaemia, with a breakpoint within the first intron of the BCR gene. Nucleic Acids Res 17:I, 1989 14. Bakhshi A, Wright JJ, Graninger W, Set0 M, Owens J, Cossman J, Jensen JP, Goldman P, Korsemeyer SJ: Mechanism of the t( 14;18) chromosomal translocation: Structural analysis of both derivative 14 and 18 reciprocal partners. Proc Natl Acad Sci USA 84: 2396, 1987 From www.bloodjournal.org by guest on August 3, 2017. For personal use only. 1993 81: 1567-1572 Duplication of small segments within the major breakpoint cluster region in chronic myelogenous leukemia CE Litz, JS McClure, CM Copenhaver and RD Brunning Updated information and services can be found at: http://www.bloodjournal.org/content/81/6/1567.full.html Articles on similar topics can be found in the following Blood collections Information about reproducing this article in parts or in its entirety may be found online at: http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests Information about ordering reprints may be found online at: http://www.bloodjournal.org/site/misc/rights.xhtml#reprints Information about subscriptions and ASH membership may be found online at: http://www.bloodjournal.org/site/subscriptions/index.xhtml Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036. Copyright 2011 by The American Society of Hematology; all rights reserved.