Download Duplication of Small Segments Within the Major

From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
Duplication of Small Segments Within the Major Breakpoint Cluster Region in
Chronic Myelogenous Leukemia
By Craig E. Litz, John S . McClure, Cedith M. Copenhaver, and Richard D. Brunning
The t(9;22) in chronic myelogenous leukemia (CML) may
be reciprocal or, in a minority of cases, may result in an
extensive deletion of a portion of the major breakpoint cluster region (M-bcr) of the BCR. This report provides evidence
of the duplication of small segments within the M-bcr in a
small group of patients with CML. Southern blots of Bgl II
and Bgl II/BamHI double-digested DNA from the blood or
bone marrow of 4 6 patients with CML were probed with
a 5 1.4-kb Taq I/Hindlll M-bcr probe and a 3 2-kb Hindllll
BamHl M-bcr probe. Inthree patients, rearrangementswere
noted with both probes in Bgl Il-digested DNA, but were
not present in BglII/BamHI-digestedDNA with either probe.
Southern analysis of DNA samples double-digested with
Bgl II and BspHl from two of these three cases showed no
rearrangements with either probe; the M-bcr BspHl site is
located 26 bp 3 of the BamHl site in the second intron of
the M-bcr. The presence of a rearranged M-bcr with both
probes in BglIl-digested DNA and the lack of rearrangement
in BglII/BamHI and Bglll/BspHI double-digested DNA suggest the presence of M-bcr BamHl and BspHl sites on both
9q -I- chromosome (9q ) and the Philadelphia chromosome (Ph). This implies a duplication of at least the 26-bp
M-bcr BamHIIBspHI fragment in these two samples. Sequence data from one of these t w o cases confirmed the Mbcr breakpoints t o be staggered; the Ph M-bcr breakpoint
occurred 258 bp downstream from the 9q M-bcr breakpoint. It is concluded that a duplication of small segments
within the M-bcr occurs in a small group of patients with
CML, which may lead t o pseudogermline patterns on
Southern blot. Such a duplication may provide insight into
the mechanism of some chromosomal translocations in
neoplasia.
0 1993 by The American Society of Hematology.
C
production of some of the probes used in this study was derived from
blood leukocytes from healthy volunteers.
DNA extraction, restriction enzyme digestion, Southern transfirs,
and hybridization. Peripheral blood and bone marrow cells were
lysed in TNE (10 mmol/L Tris-CI, pH 8.0, 100 mmol/L NaCI, 1
mmol/L EDTA) buffer in the presence of 1% sodium dodecyl sulfate
(SDS). High molecular weight DNA from the cells was fiuther purified
by standard proteinase K treatment (Boehringer-Mannheim Biochemicals, Indianapolis, IN) at a final concentration of 0.1 mg/mL.
The specimens were ethanol precipitated after several phenol-chloroform extractions. RNase treatment was followed by several more
phenol-chloroform extractions and a final ethanol precipitation.
For each of the Bgl IIIBamHI, Bgl IIIBspHI, and Bgl II/Sca I
double digests, 5 pg of DNA from each sample was digested with 50
U of Bgl I1 (Bethesda Research Laboratories, Inc, Gaithersburg, MD)
restriction endonuclease according to the manufacturer’s recommendations. The samples were then ethanol precipitated, resolubilized
in TE (10 mmol/L Tris, pH 7.5, 0.1 mmol/L EDTA), and digested
with 50 U of either BamHI, Sca I (Bethesda Research Laboratories,
Inc), or BspHI (New England Biolabs, Inc, Beverly, MA) restriction
endonuclease according to the manufacturer’s recommendations. For
each of the single digests, 5 pg of DNA from each sample was digested
with 50 U of BglII, HindIII, or Tuq I (Bethesda Research Laboratories,
Inc) according to manufacturer’s recommendations. Electrophoresis
was performed in horizontal 0.7% or 1.O% agarose gels. Four micrograms of X phage DNA digested with BstEII (Bethesda Research Laboratories, Inc) was included on all gels as a size standard. The man-
HRONIC myelogenous leukemia (CML) is a clinically
and morphologically distinct hematopoietic stem cell
neoplasm. Patients generally present in the chronic phase
with splenomegaly, a marked neutrophilia with a left shift,
basophilia, and thrombocytosis. Most patients progress to a
terminal, therapy-resistant acute leukemia within 5 years of
diagnosis.‘
Cytogenetically, the Philadelphia chromosome (Ph) is
found in 90% to 95% of CML patients. At the molecular
level, this translocation represents the aberrant conjoining of
the c-ab1 proto-oncogene from chromosome 9, with the
breakpoint cluster region gene (BCR) on chromosome 22.
This hybrid gene is transcribed and translated into a chimeric
protein product that is considered essential in the pathogenesis
of Ph-positive malignancies. Although the breakpoints on
chromosome 9 are widely scattered, the translocation breakpoints on chromosome 22 are relatively tightly clustered
within a 5.8-kb region referred to as the major breakpoint
cluster region (M-bcr). This tight clustering of breakpoints
on chromosome 22 has rendered this region amenable to
extensive study by conventional Southern blot analysis.’-3
Although the majority of cases of CML shows the predicted
rearranged bands within the M-bcr by Southern blot analysis,
rearrangements with atypical molecular findings may occur.
These include extensive deletions of the 3’ portion of the Mbcr and breakpoints located outside the M - b ~ r .Additional
~,~
aberrancies have also been described in which cleavage by
enzymes predicted to flank the translocation breakpoint produces “pseudogermline” or apparently unrearranged bands6
We report a small group of such cases showing a pseudogermline configuration of the M-bcr on Southern analysis
and propose that this phenomenon is due to a duplication
of small segments within M-bcr sequences in some cases.
MATERIALS AND METHODS
Cases. The study material consisted of bone marrow or blood
samples from 46 patients with CML collected at the University of
Minnesota. Approval for examination of this tissue was obtained by
the Committee on the Use of Human Subjects in Research at the
University of Minnesota. Genomic template DNA used in the PCR
Blood, Vol81, No 6 (March 15). 1993: pp 1567-1572
+
+
From the Department of Laboratory Medicine and Pathology,
University of Minnesota Medical School, Minneapolis, MN.
Submitted August 31, 1992; accepted November 3, 1992.
C.E.L.was a fillow of the American Society of Hematology while
this work was performed.
Address reprint requests to Craig E. Litz, MD, Department of Laboratory Medicine and Pathologv, Mayo Building, Box 198, University
of Minnesota Hospitals, 420 Delaware St SE. Minneapolis, MN
55455.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
“advertisement” in accordance with 18 U.S.C.section 1734 solely to
indicate this fact.
0 1993 by The American Society of Hematology.
0006-4971/93/8106-0026$3.00/0
1567
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
LlTZ ET AL
1568
Table 1. PCR Primers
Primer Seouence
P1
P2
P3
P4
s1
s2
s3
s4
s5
S6
s7
S8
GTTTCAGAAGCTTCTCCCTG
ACTCTGCTTAAATCCAGTGG
CCACTGGATTTAAGCAGAGT
TGTTACCAGCCTTCACTGTT
CCAGTTGGTTTCACAATACA
ATCCTGAGATCCCCAAGACA
AGAAACCCATAGAGCCCCGG
CCACTGGATTTAAGCAGAGT
GTTTCAGAAGCTTCTCCCTG
GATGACTGTCCTTCAAATGA
TGTTACCAGCCTTCACTGTT
CCGGAATTCGTTACATTTGAACCT'TAGTT
M-bcr
Location.
5 exon 2+
3 exon 33 exon 3+
Intron 3Intron 2Intron 2+
5' exon 33' exon 3+
5 exon 2+
c-ab/Intron 3c-ab/+
Those derived from c-ab/ sequences are indicated; + or - signify
DNA strand assignment; primer S8 has a 5 EcoRl site included to facilitate
cloning.
ufacturer's methods were used for transferring the electrophoretically
separated restriction fragments to Genescreen Plus nylon membranes
(Dupont, Inc. Boston. MA).
The probes and Bs/EII-digested X DNA were radiolabeled with '*P
using the random primer reaction.' The filters were prehybridized.
hybridized, stripped, and rehybridized all according to manufacturer's
recommendations (Genescreen Plus: Dupont. Inc). Washes were adjusted to the background radioactivity with a final wash in 1.OX to
0.2X standard saline citrate (SSC) solution (0.015 mol/L NaCI. 0.0075
mol/L sodium citrate) and 0.1% SDS at 60°C to 65°C. The filters
were exposed to Kodak XAR-5 films (Eastman Kodak Co, Rochester,
NY) at -85°C for 24 hours to several days.
frohcx The probes used in this study were either the 5' most
Tu9 I/llindIlI 1.4-kb fragment of the M-hcr (probe I , Fig I), the 3'
most 2-kb //indlIl/Buf?~Hlfragment of the M-bcr (probe 2. Fig I),
the 370-bp Hi~1dIIl/A4.~p
I fragment from the second exon and intron
of the M-bcr (probe 3. Fig 3). the 260-bp Scu IITu9 I fragment from
the third intron ofthe M-bcr (probe 4. Fig 3). and the 250-bp BumHI/
exon 3 M-bcr fragment ("Dup" probe, Fig 4). The plasmid containing
probe 1 was provided by the American Type Culture Collection
(Rockville. MD). The plasmid containing probe 2 was kindly provided
by Dr David Leibowitz (Department of Medicine. Indiana University.
Indianapolis, IN). Probes 3,4. and "Dup" were derived by polymerase
chain reaction (PCR) methodology. Briefly. for probe 3, a primer
pair to the second and third M-bcr exons was synthesized from previously published sequence data (Table I. primers PI and P2'). Five
hundred nanograms ofgenomic DNA was added to 100 pL of a PCR
mixture containing 1.5 mmol/L MgCI2. 50 mmol/L KCI, I O mmol/
L Tris-HCI. pH 8.3, 200 pmol/L dNTP, 20 pmol of each primer.
and 2.5 U of Tu9 I DNA polymerase. After initial denaturation at
95°C for 3 minutes. denaturation. annealing. and extension were
performed on a DNA Thermal Cycler (Perkin Elmer-Cetus, Norwalk,
CT) at 95°C for I minute, 60°C for I minute. and 72°C for I minute
and 30 seconds. respectively, for 35 cycles. The 800-bp amplified
product was then purified using a PCR Magic Preps (Promega Corp.
Madison. WI) column and subsequently doubledigested with Hind111
and .Msp 1. The 370-bp I/indlll/A4.sp I M-bcr fragment was then
isolated in and excised from a 2% NuSieve agarose (FMC Corp.
Rockland. ME) gel. The fragment was then purified over a PCR
Magic Preps column. The 250-bp "Dup" probe (BumHl/exon 3 Mbcr fragment) was isolated in the same fashion from the same 800bp amplification product digested with BumHl only. The 260-bp Scu
I/Tuq I M-bcr fragment (probe 4) was isolated in a similar manner,
except that the primers were complementary to the third M-bcr exon
and intron (Table I: primers P3 and P4R.9).Using the same cycle
parameters and PCR mixture as above, a 425-bp amplified DNA
fragment was produced that yielded the 200-bp probe 4 after Tu9 I/
Scu I double-digestion.
Sequence dutu. The M-bcr consensus sequence in Fig 5 is derived
from previous data and methodology" (personal communication to
Genome Data Base, Baltimore, MD. March, 1992).The Ph and 9q+
sequences were derived from one of the cases using the inverse PCR
method." Briefly. for the Phderived sequence, 100 ng of Tu9 Idigested patient DNA was ligated overnight at 16°C in 90 pL PCR
buffer (1.5 mmol/L MgCI2. 50 mmol/L KCI, I O mmol/L Tris-HCI.
pH 8.3) with 3 Weiss units ofT4 DNA ligase and 0.8 mmol/L dATP.
The mixture was then incubated at 65°C for I O minutes to inactivate
the ligase and the circularized M-bcr region was linearized by restricting with 30 U BufnHI for 20 minutes at 37°C in the same reaction vessel. After incubation at 95°C for I O minutes, the remaining
dNTPs (dGTP. dTTP. and dCTP), two primers (Table I. primers SI
and S2: Fig 5). and Taq polymerase were then added to a concentration of 200 pmol/L (each dNTP). 20 pmol (each primer), and 2.5
Ba
Ba
- -
D
B
I
H
H
1
B
B
2
lkb
Probe1
4.8kb
2.5kb
Probe2
-
-4.8kb
-
-
2.4kb
1 2 1 2
A
B
1.3kb
1.2kb
1 2 1 2
A
B
Fig 1. Partial restriction map of the M-bcr on chromosome 22
and Southem blot analysis of two patients with CML. The restriction
map shows Bgl II (B), BamHt (Ba), and Hindlll (H) sites. Boxes represent exons of the BCR gene found in this region. Solid bars represent the 5 Taq I/Hindlll and 3' Hindlll/BamHI M-bcr probes used
in the Southern blots (probes 1 and 2, respectively). Each autoradiogram panel shows lanes from the same blot probed with each
of the two probes. A and B represent DNA digests from two different
patients with CML. Bg/ll/BarnHI double-digested and 8g/ It-digested
DNA are indicated as 1 and 2 below the autoradiograms, respectively. Lane 1 shows only germline restriction fragments in both
cases with both probes. Lane 2 shows both germline and rearranged
restriction fragments in both cases with both probes.
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
DUPLICATION OF BREAKPOINT CLUSTER REGION
Bas
1569
Ba
S7 and S8 for the 9q+ breakpoint). and 2.5 U of Tuq I DNA polymerase. Amplification was performed using the same cycle parameters
as for probe production above. The amplified products were then
inserted into PUC 19. cloned. and sequenced as described above.
RESULTS
Probe1 Probe2
4.8kb
2.5kb
-
c.
4.8kb
-
DNA digested with Bg/ I1 from 46 patients with CML
demonstrated M-bcr rearrangement by Southem blot analysis
with either the 5’ or 3‘ M-bcr probes (Fig I , probe 1 and probe
2, respectively). Specimens from 6 patients showed rearrangement with only the 5’ probe and I showed rearrangement with only the 3’ probe. These 7 samples were considered
to have a M-bcr deletion involving the probed sequence and
were not further studied. The remaining 39 specimens showed
rearrangement by Southern blot with both 5’ and 3‘ M-bcr
- -
a
Probe 3
c 2.4kb
c 1.3kb
m-
B/BsB
B/Bs B
A
A
Fig 2. Partial restriction map of the M-bcr and Southern blot
analysis of patient A from Fig 1. The symbols of the restriction map
are described in Fig 1; in addition, the BspHl site is indicated as Bs
and is 26 bp 3 of the BamHl site. Each autoradiogram panel shows
lanes from the same blot hybridized with each of the two probes.
B and B/Bs represent Bg/ II and Bg/ II/BspHI double-digested DNA,
respectively. The Bg/ II lanes in this figure are the same lanes as
the A-2 lanes in Fig 1 and show both rearranged and germline restriction fragments with both probes. The Bg/ II/BspHI lanes show
only germline restriction fragments with both probes.
U (Tuq I DNA polymerase). The sample was then amplified using
the Same cycle parameters as described above. Two amplification
products were identified on a 5% polyacrylamide gel, a germline band
at 556 bp and a rearranged band at 700 bp. The 700-bp band was
excised from a low melting point agarose gel. restricted with Tu9 I,
and inserted into a PUC19 vector. The resulting double-stranded
plasmid was subsequently cloned and directly sequenced using a Sequenase version 2.0 kit (USBiochemicals, Inc, Cleveland, OH). The
9q+ derivative chromosome sequence was derived in a similar fashion
except that ( I ) 100 ng of Piw II/Scu I-digested patient DNA was the
starting material. (2) no BurnHI linearization was performed, and
(3) the primers used i n the amplification were further 3’ in location
(Table I.S3 and s4:Fig 5). Amplification yielded four DNA fragments
of 125. 150. 500. and 700 bp in length. The Msp ldigested 500-bp
fragment was ligated into PUC19. which was subsequently cloned
and sequenced: this fragment yielded the 9q+ M-bcr breakpoint of
this case. The sequence data in this case were confirmed by direct
genomic amplification and sequencing using primers complementary
to M-bcr exons and to the c-ah/ oncogene sequence derived from the
above inverse PCR method (Table I . primers S5 through S8). Briefly.
500 ng of genomic DNA were added to 100 pL of a PCR mixture
containing 1.5 mmol/L MgCI2. 50 mmol/L KCI. I O mmol/L TrisHCI, pH 8.3, 200 pmol/L dNTP, 20 pmol of each complementary
primer (Table 1, primers S5 and S6 for the Ph breakpoint and primers
0.6kb
1.4kb
T
B
Probe 4
/ \
H
T
U
Bs
1.9kb
T
B
lOObp
Probe 4
Probe 3
4.8kW
2 5 k L
1.9kb-
-
c4.8kb
1
-
2.4kb
-2.lkb
c0 5 k b
1
2
3
4
5
1 2 3 4 5
Fig 3. Partial M-bcr restriction map and restriction mapping of
the breakpoints in patient A from Fig 1. The solid bars labeled probes
3 and 4 represent the HindllllMsp I and Sca I/Taq I M-bcr restriction
fragments used in the Southern blot analysis, respectively. B, Ba,
Bs, H, S,and T represent Bg/ II, BamHI, BspHI, Hindlll, Sca 1, and
Tag Isites. respectively; the Taq I sites indicated include only those
that flank the indicated probed sequences. M-bcr exons 2 and 3 are
indicated as boxes. Each autoradiogram panel shows lanes from
the same blot probed with each of the t w o probes. Lanes 1 through
5 are Taq I,Bg/ll/BamHI. Bg/II/BspHI,Bg/II, andBg/II/Scal digested
DNA from patient A in Fig 1, respectively. In the Southern assays
using probe 3. germline restriction fragments are seen in the Taq
I, Bg/ IIIBamHI, and Bg/ II/BspHI digests, whereas rearrangements
are noted in Bg/ II/Sca I and Bgl II digested DNA. This indicates that
the M-bcr breakpoint on the Ph chromosome is located between
the BspHl and Sca I site. Using probe 4, germline restriction fragments are seen in the Bg/ II/Sca 1, Bg/ II/BspHI, and Bg/ II/BamHI
digested DNA, whereas rearrangements are noted in Taq I and Bg/
II digested DNA. This indicates that the M-bcr breakpoint on the
9q + derivative chromosome is located between the BamHl and
Taq I site located 20 bp 5 of the BamHl site.
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
1570
1
Dup
-I
Ba
B
H
2
H
B
B
BCWPh
H BaB
Ba
w1
B
1 Dup 2
Ba
H
B
LITZ ET AL
-r
y -4.8kb
f
+
3.3kb
3.lkb
BCWBq+
H
B
B
U
Y
lkb
B
B
c 1.3kb
B
Fig 4. Restriction maps illustrating the duplication within the M-bcr and Southern blot analysis of the M-bcr on the normal chromosome
2 2 (BCR/22), Ph chromosome (BCR/Ph), and the 9q chromosome (BCR/9q ) of patient A in Fig 1. Left portion of the illustration shows
restriction maps of, from top to bottom, the unreananged M-bcr, the M-bcr on the Ph chromosome, and the M-bcr on the 9q chromosome;
the thin and thick lines represent M-bcr and c-ab/ sequences, respectively. The duplicated region of the M-bcr is indicated by a solid box.
Probes 1 and 2 and restriction sites are as described in Fig 1. The probe to this duplicated region is labeled ”Dup.”
+
probes, indicating translocation within the M-bcr. Bg/ II/
BumHl double-digested DNA from this group was screened
for M-bcr rearrangement by Southern analysis with the 5’
and 3’ probes. These studies separated those cases with Mbcr translocations into three groups. The first group (9 patients) demonstrated rearrangement with only the 5’ probe,
indicating a translocation breakpoint 5’ of the M-bcr BamHl
site. The second group (27 patients) demonstrated rearrangement with only the 3’probe, indicating a translocation breakpoint 3’ of the M-bcr BumHI site. The third group demonstrated no rearrangement with either probe (3 patients, Fig
I). The finding of a germline restriction digest pattern was
problematic as digestion with a flanking restriction enzyme
(Bg/ 11) demonstrated rearrangement within this region.
In this latter group of 3 patients, Bg/ II/BspHI doubledigested
DNA was screened by Southern blot analysis with the 5’ and 3’
probes to exclude the serendipitous alignment of BumHl sites
on the Ph and 9q+ derivative chromosomes (Fig 2). As with
the Bg/ II/BamHI digests, no rearrangements with either probe
were found in two of the three cases.The presence of a rearranged
M-bcr with both probes in Bg/ Ildigested DNA and the lack
of rearrangement in Bg/ II/BumHI and Bg/ II/BspHI doubledigested DNA suggest the presence of chromosome 22derived
BumHl and BspHI sites on both chromosome 9q+ and the Ph
chromosome. This implies that the M-bcr BamHI/BspHl fragment is duplicated in these cases of CML.
The breakpoints from one case in this third group was
extensively restriction mapped without assuming reciprocity
in the translocation event (Fig 3). Using the 5’ HindIII/Msp
I fragment of the M-bcr as a probe in Southern blot assays
(Fig 3, probe 3), rearrangements were noted in the Bg/ II and
Bg/ II/Sca I digests; no rearrangements were noted in the Tu9
+
+
I, Bg/ II/BumHI, or Bg/ II/BspHI digests. This indicates that
the breakpoint on the Ph occurred in the 263-bp BspHI/Scu
I fragment of the M-bcr. Using the Scu I/Tu9 I fragment of
the M-bcr as a probe in Southern blot assays (Fig 3, probe
4), rearrangements were noted in the Bg/ II and Tu9 I digests
only; no rearrangements were found in the Bg/ II/Sca I, Bg/
II/BspHI, or Bg/ II/BumHI digests. This indicates that the
breakpoint on 9q+ occurred in the 20-bp To9 I/BarnHI fragment of the M-bcr.
The BumHIIScu I fragment of the M-bcr was used as a
probe in Bgl 11-digested DNA in a Southern blot assay from
this one case (Fig 4, “Dup” probe). This yielded two rearranged fragments and one germline fragment. Because the
BarnHI/Sca I M-bcr fragment is intact on chromosome 9q+,
the presence of two rearranged fragments indicates that the
probed sequence is present elsewhere in the genome of this
case and is, therefore, at least partially duplicated. Reprobing
of the blot with the 5’ M-bcr probe (Fig 4, probe 1) identified
one of the rearranged fragments (Ph chromosome) while reprobing with the 3’ probe (Fig 4, probe 2) identified the other
rearranged fragment (9q+ chromosome). This indicated that
the partially duplicated BamHI/Sca I sequence was located
on both the Ph and 9q+ chromosomes.
Sequence confirmation of the duplication was obtained
through inverse PCR techniques (Fig 5). Briefly, this case was
screened with various restriction enzyme/primer pair combinations. A combination of Tu9 I digestion ofgenomic DNA
followed by ligation and amplification with primers to intervening sequence I I (IVS 11) of the M-bcr yielded a germline
556-bp fragment and a 700-bp rearranged fragment. Cloning
and subsequent sequencing of the 700-bp fragment showed
it to be derived from the Ph chromosome with a breakpoint
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
DUPLICATION OF BREAKPOINT CLUSTER REGION
1571
22
9q*
22
Ph
99+
22
Ph
99+
22
Ph
22
Ph
~tcaagt~agtactggtttggggagcagggttgcagcggccgag
gcggatttactctaaggcagttcatatttggtccccagctgagaattatagcctggaaatacc
ab1
I-
bcr
t
g
c
a
a c
g
t
+
Fig 5. Partial sequence of the M-bcr including the breakpoints on the Ph chromosome and 9q chromosome in patient A from Fig 1.
Upper illustration presents (1) the normal consensus M-bcr sequence, (2) the sequence of the Ph chromosome, and (3)the sequence of
derivative chromosome labeled 22, Ph, and 9q , respectively. The lower panels show the sequence autoradiograms of the
the 9q
breakpoints on the Ph and 9q M-bcrs. In both upper and lower portions of the illustration, black and gray arrows mark the 9q and Ph
chromosome M-bcr breakpoints. respectively. The primers used to obtain the Ph chromosome sequence were 20-bp oligonucleotides
derived from M-bcr sequence immediately adjacent to the BamHl site underscored by the thin black lines; those used to obtain the 9q
chromosome sequence were derived from M-bcr sequence further 3 and are indicated by a thick black line. Both primer pairs were in the
opposite orientation to those used in non-inverse PCR methods.
+
+
+
+
+
occurring at base 55 of M-bcr exon 111. Double-digestion of
genomic DNA with Pvu II/Sca I, followed by ligation and
amplification with M-bcr exon Ill primers, yielded 4 fragments between 125 bp and 700 bp in length. Cloning and
sequencing of the 500-bp DNA fragment showed this fragment to be derived from the 9q+ M-bcr sequence, with a
breakpoint located 12 bp 5' of the IVS I1 BamHl site of the
M-bcr. With the sequence data generated above, primers to
the c-ab1 portion of both the 9q+ and Ph chromosome were
generated and used to amplify, sequence, and verify the respective breakpoints directly from genomic DNA from this
case. The sequence-derived breakpoints corroborated Southern blot-derived breakpoints. This indicates that a 258-bp
region of the M-bcr is duplicated in this case and is present
on both the Ph chromosome and 9q+ chromosome.
DISCUSSION
The Ph has generally been regarded as a reciprocal translocation between chromosomes 9 and 22, although cases with
extensive deletions have been described." This study provides
evidence that duplications of the M-bcr may occur. The
Southern blot data indicate that Bgl 11-digested DNA from
3 of 46 patients with CML demonstrate a M-bcr rearrangement with both 5' and 3' M-bcr probes, yet, when doubledigested with Bgl I1 and BamHI, show no M-bcr rearrangement with either probe. Furthermore, DNA from two of these
three cases double-digested with Bgl I1 and BspHI, a unique
M-bcr enzyme site located within 30 bp ofthe M-bcr BamHI
site, also show no rearrangement with either probe. Serendipitous alignment of two separate restriction enzyme sites
is unlikely. In addition, sequence data indicate that a 258bp M-bcr fragment in one of these cases is duplicated: the
breakpoint locations are verified in this case by fine restriction
mapping using probes flanking the duplicated area. Southern
blot analysis using a probe sequence contained within this
duplicated region demonstrates hybridization with both the
Ph and 9q+ chromosomes.
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
LlTZ ET AL
1572
The presence of a duplicated segment within the M-bcr
involved in the Ph raises several significant issues. First,
molecular identification of this translocation by Southern
blot analysis is commonly used as a diagnostic procedure.
The presence of duplicated sequences may create false
germline patterns with some restriction enzyme digests,
further emphasizing the need to use several restriction enzymes. An M-bcr duplication can confound breakpoint
mapping by Southern blot; this may, in part, explain why
some studies have suggested that M-bcr breakpoint location
is important in the prognosis of CML, whereas other studies
could not substantiate this.12 The interpretation of Southern
blots in these cases has been made under the assumption
of complete reciprocity in the translocation event. Duplicated regions of the M-bcr involving restriction sites invalidate this assumption and data from mapping studies should
be reinterpreted in this light.
Finally, the presence of a duplication of greater than
200 bp within the M-bcr raises questions as to the mechanism of the translocation event. The presence of a relatively large duplicated sequence militates against simple
double-stranded breaks on each chromosome with religation. Short duplicated segments have been described both
in cases of Ph-positive acute lymphoblastic leukemia and
in cases of follicular lymphoma carrying the t( 14; 1
The investigators in these cases postulated a staggered break
on one chromosome of the translocated pair, with subsequent single-stranded ligation and filling of the singlestranded defect. However, both of these cases represented
short duplicated sequences of 4 bp or less; it is unclear if
the staggered-break hypothesis is tenable in a duplication
of the size reported here.
A number of additional hypotheses may also be considered. The relevant segment of DNA may be duplicated
within the M-bcr before the translocation event and the
breakpoint may occur between the duplicated sequences.
Conversely, the duplicated sequence may exist on chromosome 9 before the translocation event, creating a potential site for homologous recombination. Neither of these
scenarios has been previously identified. The possibility
of a rare polymorphism in the patient studied in detail
cannot be excluded as neither parental nor cellular DNA
lacking the Ph was available in this case. Alternatively, the
duplication could arise as a consequence of the translocation event itself. Aberrant DNA replication with asymmetric strand switching between the BCR gene and c-ab1
oncogene could explain such an observation.
8).13314
REFERENCES
1. Kurzrock R, Gutterman JU, Talpaz M: The molecular genetics
of Philadelphia chromosome-positive leukemias. N Engl J Med 3 19:
990, 1988
2. Nowell P, Hungerford D: A minute chromosome in human
chronic granulocytic leukemia. Science 132:1497, 1960
3. Rowley JD: A new consistent chromosomal abnormality in
chronic myelogenous leukaemia identified by quinacrine fluorescence
and Giemsa staining. Nature 243:290, 1973
4. Popenoe DW, Schaefer-RegoK, Mears JG, Bank A, Leibowitz
D: Frequent and extensive deletion during the 9;22 translocation in
CML. Blood 68:1123, 1986
5. Saglio G, Guerrasio A, Tassinari A, Ponzetto C, Zaccaria A,
Testoni P, Celso B, Cambrin GR, Serra A, Pegoraro L, Avanzi GC,
Attadia V, Falda M, Gavosto F Variability of the molecular defects
corresponding to the presence of a Philadelphia chromosome in human hematologic malignancies. Blood 72: 1203, 1988
6. Schaefer-Rego K, Dudek H, Popenoe D, Arlin Z, Mears JG,
Bank A, Leibowitz D CML patients in blast crisis have breakpoints
localized to a specific region of the BCR. Blood 70:448, 1987
7. Feinberg FP, Vogelstein B: A technique for radiolabeling DNA
restriction endonuclease fragments to high specific activity. Anal
Biochem 132:6, 1983
8. Heisterkamp N, Stam K, Groffen J, de Klein A, Grosveld G:
Structural organization of the bcr gene and its role in the P h translocation. Nature 315:758, 1985
9. de Klein A, van Agthoven T, Groffen C, Heisterkamp N, Groffen
J, Grosveld G: Molecular analysis of both translocation products of a
Philadelphia-positive CML patient. Nucleic Acids Res 147071, 1986
10. McClure JS, Litz CE: PCR-based sequencedetection of a Mae11
polymorphism in the human major breakpoint cluster region (Mbcr). Nucleic Acids Res 19:5090, 199 I
11. Ochman H, Medhora MM, Garza DL, Hart1 DL: Amplification of flanking sequences by inverse PCR in Innis M, Gelfand
DH, Swinksy JJ, White T (eds): PCR Protocols: A Guide to Methods
and Applications. San Diego, CA, Academic, 1990, p 2 19
12. Mills KI, Benn P, Birnie G D Does the breakpoint within the
major breakpoint cluster region (M-bcr) influence the duration of
chronic phase in chronic myeloid leukemia? An analyticalcomparison
of current literature. Blood 78:1155, 1991
13. van der Feltz MJM, Shivji MKK, Allen PB, Heisterkamp N,
Groffen J, Wiedemann LM: Nucleotide sequence of both reciprocal
translocation junction regions in a patient with Ph positive acute
lymphoblastic leukaemia, with a breakpoint within the first intron
of the BCR gene. Nucleic Acids Res 17:I, 1989
14. Bakhshi A, Wright JJ, Graninger W, Set0 M, Owens J, Cossman J, Jensen JP, Goldman P, Korsemeyer SJ: Mechanism of the
t( 14;18) chromosomal translocation: Structural analysis of both derivative 14 and 18 reciprocal partners. Proc Natl Acad Sci USA 84:
2396, 1987
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
1993 81: 1567-1572
Duplication of small segments within the major breakpoint cluster
region in chronic myelogenous leukemia
CE Litz, JS McClure, CM Copenhaver and RD Brunning
Updated information and services can be found at:
http://www.bloodjournal.org/content/81/6/1567.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.