Download DNA the Crown Jewels 2012

The Case of the
Crown Jewels:
Investigate a Crime Scene
Using DNA Restriction
Analysis
(DNA Fingerprinting)
 Overview
Outline
 DNA Structure
 DNA Synthesis
 Simple Tandem Repeats (STRs)
 RFLPs
 Polymerase Chain Reaction (PCR)
 Restriction Enzymes
 Gel Electrophoresis
 DNA Fingerprinting
 Mitochondrial DNA
 CODIS
 Collection and Preservation of DNA Evidence
What is DNA?
 DNA- Deoxyribonucleic Acid
 Codes for an organisms traits.
 1985- It was discovered that portions of DNA structure
of certain genes are as unique to each individual as
fingerprints.
 DNA Fingerprinting (now also referred to as DNA
Profiling or DNA Typing) - process of isolating and
reading specific DNA markers that are unique.
 DNA typing is now a routine procedure in crime labs
and the US courts have overwhelmingly admitted DNA
evidence and accepted the reliability of this scientific
technology.
What is DNA?
 In each nucleus of your 60 trillion cells are
46 chromosomes.
 Arranged along the chromosomes, like beads on a
thread are 23,000 genes. The gene is the basic unit of
heredity. It instructs the body cells to make proteins
that determine everything from hair color to our
susceptibility to disease.
 A gene is actually composed of DNA specifically
designed to carry out a specific body function.
 DNA was 1st discovered in 1868.
 In 1952, Watson and Crick developed a model of the
structure of DNA that is accepted today.
DNA Structure
What is DNA made of?
Nucleotides:
Phosphate group
Sugar- Deoxyribose
Nitrogen Base
Carbon atoms of sugar are numbered
Nucleotide 1
one strand of DNA
Nucleotide 2
Nucleotide 3
Nucleotide 4
Nucleotides
are linked in
a chain
5’
3’
Two strands of DNA
•Double-stranded DNA
•Anti-parallel
•Hydrogen bonds
•AT or GC pairs
3’
5’
(DNA codes for proteins, such as
pigments in hair and eyes)
The Human Genome Project (HGP)
Finished in 2003,was an international
scientific research project with the goal
of determining the sequence of
chemical base pairs which make up
human DNA, and of identifying and
mapping all of the genes of the human
genome from both a physical and
functional standpoint.
DNA Synthesis
DNA Replication
5
3
5
3
AGTCAG-
T
C
A
G
T
C
A- T
G- C
T- A
C-G
A- T
G- C
3
5
3
5
Separate
strands
A- T
G-C
T-A
C -G
A- T
G-C
3
T
C
A
G
T
C
3
5
5
A
G
T
C
A
G
3
5
5
3
AGTCAG-
5
A
G
T
C
3
5
3
5
A- T
G-C
T-A
C -G
3
-T
-C
3
5
Add
correct
bases
Building a Strand of DNA
Process is necessary before the cell can divide.
• DNA strand untwists
• Weak hydrogen bonds holding the bases together break through
enzyme action.
• Free floating nucleotides join with a complement nucleotide.
• Process happens at many places on the chromosome until 2
identical strands of DNA are made.
• Many enzymes are involved in the process.
• For example, DNA polymerase joins all nucleotides together,
determined by the original DNA strand.
• DNA polymerases also “proofread” the growing DNA double helix
for mismatched base pairs, which are replaced with correct bases.
DNA at Work
 DNA directs the production of proteins.
 Every three bases in a gene codes for one specific amino acid
in the polypeptide chain. Polypeptides are polymers.
 Proteins are made of polymers of amino acids (polypeptides).
There are 20 different amino acids from which all proteins on
earth are made.
 The sequence of the amino acids in the polypeptide chain
determines the shape and therefore the function of the protein.
 Example- hemoglobin- found in our red blood cells and
responsible for carrying oxygen to our body cells.
Hemoglobin is made of 4 polypeptide chains.
 Consider the problem with sickle cell anemia-
How do we distinguish one person’s DNA from
another?
 We do not need to sequence the entire 3 billion base
pairs of a person’s DNA to distinguish it from another
person’s DNA
 Noncoding regions of DNA (junk DNA) contain
sequences that are 3-100 bp in length that are repeated
at different locations (loci) along the chromosome. For
example- CGGCT may be repeated 3 times at a loci;
and it may be repeated 9 times at the same loci on a
homologous chromosome.
 These sequences are called Short Tandem Repeats
(STRs) or VNTRs or RFLPs
STRs
• Each person has STRs (3-7 bases in length repeated)
that were inherited from mother and father on the
homologous chromosomes inherited at birth. (VNTRs are
longer repeats also inherited from your parents.)
• No person has STRs that are identical to those of either
parent, you have a combination of your parents STRs.
• The number of repeats at each loci on chromosome is
highly variable in the population.
• The length of the DNA after cutting the chromosome with
a restriction enzyme, and its position after electrophoresis
will depend on the exact number of repeats at the locus
The uniqueness of an individual’s STRs provides
the scientific marker of identity known as a DNA
fingerprint.
In the United States the FBI has standardized a set
of 13 STR assays (13 different locations on the
chromosomes) for DNA typing, and has organized
the CODIS database for forensic identification in
criminal cases.
The United States maintains the largest DNA
database in the world: The Combined DNA Index
System, contains over 11,592,430 offender1
profiles, 1,325,123 arrestee profiles and 607,173
forensic profiles as of January 2015.
Preparation of a DNA fingerprint is a
Multi- Stepped Process
• Specimen collection- blood, semen, etc
• easy to contaminate a DNA sample with DNA from
other sources (bacteria, DNA of person collecting
sample)
• DNA is not stable for very long-it degrades
• sunlight
• heat
• moisture
DNA fingerprinting is a comparative process:
DNA from crime scene is compared with DNA of
a suspect so minimum of two samples must be
prepared
DNA extraction- standardized methods have been
developed need to separate DNA from other cell
material and debris from crime scene.
RFLP (VNTR or STR)
Analysis or PCR
How to do DNA Fingerprinting
The Big Picture
Collect Tissue Sample
>5000 cells
RFLP / Southern blot
3-20 cells
PCR Analysis
RFLP Analysis
1. Not all DNA codes for the making of a protein, much
of our DNA seems to have no purpose today. (Maybe it
did in our evolutionary past.)
2.Within non-coding segments of DNA are found
tandem repeats- sequences of bases that are repeated
numerous times. (ex- TAGTAGTAGTAGTAG)
3. 30% of the human genome is made up of repeating
segments of DNA.
4.These repeating units seem to act as filler or spacers
between coding segments.
RFLP Analysis
All humans have the same type of repeats, but there is
tremendous variation in the number of repeats that
each of us have. There are numerous possibilities for
the number of times a particular sequence of base
letters can repeat itself on a DNA strand. The
possibilities become greater when one deals with 2
chromosomes each containing different lengths of
repeating sequences. Remember that one chromosome
in a homologous pair came from your mother and the
other one came from your father.
Need to Analyze only a Small
Fraction of Genome
• Human genome is too big to analyze:
•
3 x 109 base pairs  65,536 bp between cuts
= ~46,000 bands
• Most regions of genome are not suitable:
•
99.9% of DNA sequence is same from one
person to the next
• Solutions:
•
Limit analysis to a few genomic regions
•
Focus on regions which are highly variable
How to Focus on Specific
Regions of Genome
Need a probe:
A short single stranded DNA which is
complementary to the region of interest
ATGGCATGGACC Radioactive probe
GTCATATGTGTTCATGGCATGGACCGAGTCAATATGCGGCT
:::::::::::::::::::::::::::::::::::::::::
::::::::::::
CAGTATACACAAGTACCGTACCTGGCTCAGTTATACGCCGA
A probe will base pair to the region of interest
If you do this for 13 different repeat
sequences at 13 different loci on the
chromosome, each person produces
a different band pattern when the
fragments are separated by gel
electrophoresis (26 bands will be
produced total- 2 bands for each
STR analyzed)
• Since the # of times sequence is repeated
is different for each person, fragment size
will be different.
• 13 different STR sequences are analyzed
• Differences in fragment length occur
among individuals at each of the 13 loci
on the chromosome where the STRs occur
• This allows for a lot of variation
More on STRs
• Number of repeats varies greatly between
individuals
• STRs make up 10-15% of the mammalian genome
• STRs are also called “microsatellites”
• STRs are “junk DNA”
• STRs are more stable than VNTRs because they
are shorter (3-7 bases in length)
• STRs are more abundant in our genome than
VNTRs so they are more useful
Polymerase Chain Reaction
(PCR)
PCR amplifies the amount of DNA if only a small
amount is collected
PCR- in a nutshell!
Purpose – Quickly make many copies of a region
of a DNA molecule, exponentially!
Method – Multiple rounds of DNA replication
Components in PCR reaction – Target DNA,
nucleotides, DNA polymerase, and primers
Temperature cycling – DNA replication
controlled by temperature…
Temperature Cycling in PCR
Temperature cycling – PCR process uses a machine
(thermocycler) in which PCR reaction goes through
~30 cycles of three different temperature changes:
~95ºC
– Melting temperature
(Denatures the DNA, breaking the
hydrogen bonds between the bases,
making the DNA single stranded
50-65ºC
– Annealing temperature(primer attaches to the single
stranded DNA)
72ºC
– Extension temperature- (DNA
Polymerase attaches nucleotides)
Polymerase Chain Reaction
(PCR) analysis
1). primers are designed to flank the
region to be amplified in target DNA
2). primers are annealed (attached) to
denatured (single stranded DNA) DNA
3). DNA is synthesized using Taq
polymerase (from Thermus aquaticus)
4). primers are annealed again and the
process is repeated through 20-30 cycles,
exponentially amplifying the target
sequence
5). DNA is analyzed by gel electrophoresis
Conclusion- PCR (Polymerase Chain Reaction)
This is a lab technique that enables technologists to copy small
quantities or broken pieces of DNA outside of a living cell.
2. DNA polymerases and an automatic machine called a DNA
Thermal Cycler are used to copy the DNA once per cycle.
3. Within a few hours 30 cycles can multiply the small quantity of
DNA to more than a million pieces of the DNA.
4. Once the DNA has been copied, it can be analyzed.
5. Because of PCR technology, sample size is no longer a limitation
in characterizing DNA recovered from crime-scene evidence. In fact,
PCR works best with DNA strands that are no longer than a couple
of hundred bases.
6. PCR has been applied to the identification of saliva residues found
on envelopes, stamps, soda cans, and cigarette butts.
7. With PCR less than one-billionth of a gram of DNA is required for
analysis.
Restriction Enzymes are used
to cut our DNA into segments
of different sizes
Restriction Enzymes
• Also called restriction endonucleases
• Occur naturally in bacteria
• Hundreds are purified and available commercially
• Named for bacterial genus, species, strain, and type
Example:
EcoRI
Genus: Escherichia
Species: coli
Strain: R
Restriction endonucleases
• Recognize specific base sequences in DNA
• Cut DNA at those recognition sites
Restriction Enzyme Recognition Site
• Enzymes recognize specific 4-8 bp sequences
EcoRI
5’…GAATTC…3’
3’…CTTAAG…5’
• Recognition sites have symmetry
• Some enzymes cut in a staggered fashion
• Some enzymes cut in a direct fashion
PvuII
5’…CAGCTG…3’
3’…GTCGAC…5’
Gel Electrophoresis
(At the negative pole)
(Negative at the end with the wells containing the DNA and positive at the other end)
Southern Blotting- Makes a permanent Nitrocellulose
paper often has a
chemical on it that
record of the DNA pattern.
denatures the DNA
DNA Fingerprinting
, semen
DNA Fingerprinting
Determination of an individual’s unique
collection of DNA restriction fragments
Steps in Making a DNA Fingerprint
1. Specimen collection CSI for wildlife
2. DNA extraction
3. PCR if necessary
4. Cut DNA with Restriction Enzymes at
restriction sites
5. Gel Electrophoresis
6. Southern Blot
7. Add Probe (radioactive or fluorescent)
8. X-Ray and develop or look at under UV
light
Mitochondrial DNA (mtDNA)
A. Mitochondria- sites of cellular respiration in the cell.
1. A single mitochondrion contains several loops of DNA.
2. mtDNA is inherited from only the mother since it is in the
cytoplasm of the egg cell.
3. There are hundreds to thousands of mitochondria in a cell, but only
one nucleus.
4.In situations where nuclear DNA is degraded, like in charred
bodies, or is in small quantity like a hair shaft, mtDNA can be analyzed.
5. mtDNA analysis is more sensitive than nuclear DNA profiling but it is
also more time consuming and expensive.
6. Another problem is that all maternally related people have the same
mtDNA.
7. In cases involving a missing or long deceased, an mtDNA reference
sample could be obtained from any maternally related relative.
8. Two variable regions exist- HV1 and HV2. When these areas are
sequenced and analyzed, maternal lineage can be determined.
The Combined DNA Index Sequence
A. Use in Forensic Science (CODIS)
1. All 50 states have mandated the collection of DNA from
convicted offenders of particular crimes and the establishment of
DNA data bases for law enforcement purposes.
2. The CODIS is a computer software program developed by
the FBI that maintains local, state and national databases of DNA
profiles of convicted offenders, unsolved crime scene evidence,
and profiles of missing persons.
3. CODIS enable law officials to electronically compare DNA
profiles. Thousands of matches have linked serial crimes to each
other and have solved crimes by allowing investigators to
match crime scene evidence to known convicted offenders.
4. It has also allowed for the exoneration of innocent people
convicted of crimes they did not commit.
The Collection and Preservation of
Biological Evidence for DNA Analysis
A. Low copy number
1. About 3- 36 cells are needed for the most sensitive type of
DNA profiling – STR.
B. Crime Scene Procedures
1. After the usual initial crime scene analysis has been done
(photographs, sketches, notes, blood spatter analysis) then
collection of biological material can occur.
2. The evidence collector must handle all body fluids and
biologically stained materials with a minimum amount of
personal contact.
3. All body fluids must be considered to be infectious, so latex
gloves must be worn. These gloves also serve to reduce the
possibility of contamination of the evidence.
The Collection and Preservation of
Biological Evidence for DNA Analysis
4. All clothing both from the victim and the suspect must be
bagged, labeled and sent to the lab for analysis.
5. Efforts must be made to search for and collect less obvious
evidence such as towels, handkerchiefs, or rags that may have
been used and then hidden.
6. Floor cracks and other crevices must be searched for blood
evidence.
7. Each stained article must be packaged separately in a paper
bag or in a well ventilated box.
8. If this is not possible, dried blood should be removed with
the aid of a sterile swab, lightly moistened with sterile distilled
water. A portion of the unstained surface material near the stain
must also be swabbed to serve as the substrate control.
The Collection and Preservation of
Biological Evidence for DNA Analysis
9. All swabs must be dried before being packaged in a swab
box.
10. All packaged biological material must be stored in a cool
location until delivery to the lab.
11. Blood mixed with soil, however, should be immediately
frozen due in a clean, sterile container due the microbes that
would quickly degrade the DNA in the blood.
12. Blood from all victims and suspect (about 7 cc of whole
blood) should be drawn by medical personnel. The blood
should be preserved with EDTA. This chemical preserves the
blood as well as inhibiting the action of enzymes in the blood
that would act to degrade the DNA. The tubes must be
refrigerated and sent to the lab.
The Collection and Preservation of
Biological Evidence for DNA Analysis
13.A buccal swab is often taken by swabbing the inside of the
cheek. This leaves buccal cells on the swab that can be tested
for DNA.
14. Toothbrushes, hairbrushes or combs are also used to supply
DNA.
15. Contamination of samples with foreign DNA from an
investigator occurs by sneezing or coughing on the sample, or
by packing the samples incorrectly. STR analysis shows such
contamination because in this type of test only two bands
signifying 2 alleles should be present. If more than 2 bands are
present then contamination from an outside source occurred.
The Collection and Preservation of
Biological Evidence for DNA Analysis
16. Other simple steps to avoid contamination include:
• Change gloves before handling a new piece of
evidence.
• Collect substrate controls.
• Use clean forceps to pick up small items such as
cigarette butts or stamps.
• Package each item in its own well ventilated container.