Download Mutation, Mutagens, and DNA Repair

How Genetic Tests Work - Molecular
(sequence, target, array), Biochemical
& Cytogenetics
Contents
[hide]
1 Understanding Genetic Testing
2 Uses of Genetic Testing
3 Types of Genetic Testing
3.1 Cytogenetic Testing
3.2 Biochemical Testing
3.3 Molecular Testing
4 Limitations to Genetic Testing
5 See Also
6 References
7 External Links
[edit]
Understanding Genetic Testing
Genetic testing involves examining a person’s DNA, found in blood or other
tissues, for some abnormality linked to a disease or condition. DNA is actually
a chemical alphabet composed of four units that make up all of the genes, or
genetic material, found inside our cells. Genes are important for the body’s
normal development and functioning. Each gene is unique due to the order of
the four DNA units (see DNA).
When a mistake happens affecting part or all of the gene, this can result in an
abnormal function or change in the body, leading to disease. The mistake can
be fairly large or very small, and different types of genetic tests are used to
identify the specific gene abnormality (see Genes and Their Properties).
1
The most common type of genetic testing is Newborn Screening. Almost
every baby born in the United States has a blood sample tested for abnormal
or missing genes or proteins. Early detection can allow the doctor to prescribe
drugs or to place the baby on a specific diet in order to prevent or reduce the
severity of a disease. Another type of testing, known as carrier testing, can
help determine the risk of parents passing on a mutation to their child.
Predictive or predispositional genetic testing can determine the risk of a
healthy person developing a disease in the future. Finally, genetic tests can
be used to look for gene abnormalities in persons suspected of having a
genetic disease based on symptoms or family history.
Genetic testing is not always 100 percent accurate. Even when a genetic test
positively detects a mutation, the test usually cannot determine when or what
symptoms of the disease may show, which symptoms will occur first, how
severe the disease will be, or how the disease will progress over time. If a test
is negative, an individual may still be at risk for a disease. Therefore, it is
important to speak to a health professional such as a genetic counselor to
help you understand the benefits and risks of genetic testing and to answer
any questions you may have before and after testing.
Genetic counselors are health professionals trained in the areas of medical
genetics and counseling. Genetic counselors are trained to help persons as
they consider testing, when they receive the results, and in the weeks and
months afterward.
When deciding whether or not to have a genetic test for you or your child,
several issues should be considered. In addition to the medical issues,
genetic testing also raises some social, ethical, and legal issues you should
be aware of. Below is a list of some of the issues you should discuss with
your physician or genetic counselor:
What treatments are available for this genetic disease?
What impact would the genetic test results have on my family?
What happens if the results are uncertain or inconclusive?
What are the risks for future pregnancies?
What is the cost of the test and will my insurance cover it?
Who will have access to the test results?
What emotional support services are available?
Do other family members have a right to know the test results?
What is the risk of discrimination by my employer or insurer?
Uses of Genetic Testing
2
Genetic tests can be used for many different purposes.
Newborn screening is the most widespread use of genetic testing
[See Chapter 4 for more information about newborn screening]. Almost
every newborn in the U.S. is screened for
several genetic diseases. Early detection of these diseases can lead to
interventions to prevent the onset of symptoms or minimize disease severity.
Carrier testing can be used to help couples to learn if they carry—and
thus risk passing to their children—an allele for a recessive condition such
as cystic fibrosis, sickle cell anemia, and Tay-Sachs disease. This type of
testing is typically offered to individuals who have a family history of a
genetic disorder and to people in ethnic groups with an increased risk of
specific genetic conditions. If both parents are tested, the test can provide
information about a couple’s risk of having a child with a genetic condition.
Prenatal diagnostic testing is used to detect changes in a fetus’s
genes or chromosomes. This type of testing is offered to couples with an
increased risk of having a baby with a genetic or chromosomal disorder. A
tissue sample for testing can be obtained through amniocentesis or
chorionic villus sampling.
Genetic tests may be used to confirm a diagnosis in a symptomatic
individual or used to monitor prognosis of a disease or response to
treatment.
Predictive or predispositional genetic testing can identify individuals
at risk of getting a disease prior to the onset of symptoms. These tests are
particularly useful if an individual has a family history of a specific disease
and an intervention is available to prevent the onset of disease or minimize
disease severity. Predictive testing can identify mutations that increase a
person’s risk of developing disorders with a genetic basis, such as certain
types of cancer.
[edit]
Types of Genetic Testing
Several different methods are currently used in genetic testing laboratories.
The type of test will depend on the type of abnormality that is being
3
measured. In general, three major types of genetic testing are available:
cytogenetic, biochemical, and molecular testing.
[edit]
Cytogenetic Testing
Cytogenetics involves the examination of whole chromosomes for
abnormalities. Chromosomes of a dividing human cell can be clearly analyzed
under a microscope. White blood cells, specifically T lymphocytes, are the
most readily accessible cells for cytogenetic analysis since they are easily
collected from blood and are capable of rapid division in cell culture. Cells
from other tissues such as bone marrow (for leukemia), amniotic fluid
(prenatal diagnosis), and other tissue biopsies can also be cultured for
cytogenetic analysis.
Following several days of cell culture, chromosomes are fixed, spread on
microscope slides, and then stained. The staining methods for routine
analysis allow each of the chromosomes to be individually identified. The
distinct bands of each chromosome revealed by staining allow for analysis of
chromosome structure.
[edit]
Biochemical Testing
The enormous numbers of biochemical reactions that routinely occur in cells
require different types of proteins. Several classes of proteins exist to fulfill
multiple functions, such as enzymes, transporters, structural proteins,
regulatory proteins, receptors, and hormones. A mutation in any type of
protein can result in disease if the mutation results in failure of the protein to
correctly function.
Clinical testing for a biochemical disease utilizes techniques that examine the
protein instead of the gene. Tests can be developed to directly measure
protein activity (enzymes), level of metabolites (indirect measurement of
protein activity), and the size or quantity of protein (structural proteins). These
tests require a tissue sample in which the protein is present, typically blood,
urine, amniotic fluid, or cerebrospinal fluid. Because proteins are more
unstable than DNA and can degrade quickly, the sample must be collected,
stored properly, and shipped promptly according to the laboratory’s
specifications.
[edit]
Molecular Testing
For small DNA mutations, direct DNA testing may be the most effective
method, particularly if the function of the protein is not known and a
biochemical test cannot be developed. A DNA test can be performed on any
4
tissue sample and requires very small amounts of sample. Some genetic
diseases can be caused by many different mutations, making molecular
testing challenging. For example, more than 1,000 mutations in the cystic
fibrosis transmembrane conductance regulator (CFTR) gene can cause cystic
fibrosis (CF). It would be impractical to sequence the entire CFTR gene to
identify the causative mutation since the gene is quite large. However, since
the majority of CF cases are caused by approximately 30 mutations, this
smaller group of mutations is first tested before more comprehensive testing
is performed.
Limitations to Genetic Testing
While the physical risks associated with most forms of genetic testing are
small, since some tests only require a blood sample or buccal smear
(retrieved from the inside of the cheek), there are many psychological, social,
and financial effects on a person’s life that should be taken into consideration.
See Also
Ethical, Legal, and Social Issues
Pregnancy Screening / Reproductive Screening
Inheritance
5
Repair of DNA
Photoreactivation
Organisms have evolved at least four processes for repairing UV damage in DNA:
photoreactivation, excision, error-prone, and recombination repair. Depending on
the type of organism and the nature of the UV damage, these processes may
successfully repair damage, partially repair the damage and create a mutation, or
fail to work at all.
The simplest process for repair of pyrimidine dimers is called photoreactivation
which, as the name suggests, requires light. Photoreactivation is catalyzed by a
single protein called photolyase, which uses the energy in a photon of light to
chemically break apart a pyrimidine dimer in DNA. Photoreactivation probably
represents the earliest type of UV repair system because many species, from
bacteria through marsupials share the enzyme responsible. Humans and other
placental mammals do not seem to have a photoreactivation process, but the gene
which codes for photolyase has been conserved and may have evolved to play a role
in the excision repair process. The PHR1 gene encoding photolyase is defective in
the sensitive strain used in the experiments.
Excision repair
In excision repair, the region of DNA containing the dimer or other damage is
physically cut out and then replaced by new DNA synthesis (Figure 1). Excision
repair has more steps and requires more enzymes than photoreactivation, but it can
work on damage created by agents other than UV and on lesions other than
pyrimidine dimers. In Escherichia coli bacteria, excision repair requires six
proteins: three are involved in finding the damaged region of the DNA and cutting
the DNA strand around the lesion; one participates in removing the damaged bit;
DNA polymerase replaces the portion which was removed; and a final enzyme
called DNA ligase glues the new and old portions back together. Mutations in the
genes coding for any of these proteins will interfere with the process and cause the
mutant bacterium to be highly sensitive to killing and mutation by UV light. The
excision repair system probably repairs a large amount of UV damage.
In yeast and other eukaryotes, DNA is wrapped up in more complicated structures
than in bacteria, which may explain why these organisms seem to need more
proteins to carry out excision repair. In yeast, at least twelve proteins may
participate in excision repair. Researchers originally identified many of these by
finding mutants unable to repair UV damage. We don't yet know the functions of all
of these proteins, but scientists very recently found that the RAD1 and RAD10 gene
products may act together in cutting DNA near dimers and that the RAD3 gene
product is needed to identify dimers to the other repair proteins. These genes have
close counterparts in humans: for example, the protein made by the RAD3 gene has
the same sequence of amino acids in over 50% of the positions as the product of its
human counterpart, ERCC2. People with mutations in ERCC2 are very sensitive to
6
sunlight and suffer from the disease xeroderma pigmentosum. Yeast with mutations
in RAD3 are very sensitive to UV and are killed or mutated by very low doses of UV.
RAD1 is mutated in the sensitive strain G948-1C/U.
Error-prone repair
The excision process described in the previous section is mostly accurate, or errorfree. Sometimes, however, mistakes are made when a cell tries to repair a lesion in
its DNA. In the case of pyrimidine dimers, mistakes may happen when two dimers
are near each other on opposite strands of the DNA (Figure 2). If the cell tries to do
excision repair, it won't know how to copy the dimer when it tries to carry out the
repair DNA synthesis because the dimer is not a normal part of DNA. It might make
a mistake rather than not repair the gap in the DNA. Sometimes, unfortunately, an
error-prone process is the only way to repair DNA damage. Most mutations arising
after UV treatment of cells are the result of error-prone repair of the DNA lesions.
In yeast, we know of several genes whose products are required for error-prone
repair; one of them, RAD18, is mutated in the sensitive strain used in the
experiments.
Recombinational repair
When pyrimidine dimers block DNA replication in a eukaryotic chromosome, the
polymerase can start replication at other places further downstream. The result of
replicating a DNA molecule or chromosome containing a dimer is thus a gap in one
strand of the DNA where the dimer blocked a portion from being copied (Figure 3).
A gap in DNA means that one strand is missing information; the strand must be
repaired before the cell divides. The most frequent way that cells fill such a gap is by
genetic recombination with another DNA molecule or chromosome containing the
same or similar information. The recombinational repair system is a fourth process
involved in repair of UV damage to DNA. The genes which make the proteins
functioning in this system have been identified because mutations in them block
recombination. One important member of this group is the RAD51 gene, which
makes a protein that can help DNA molecules find their similar partners and begin
recombination.
Figure 1: Steps in Excision Repair
Figure 2: Steps in Error-prone Repair
Figure 3: Steps in Recombinational Repair
Step 1: DNA with dimer is replicated, leaving a gap in one daughter molecule.
Step 2: Recombination with other daughter molecule fills gap by transfer of good
strand.
Step 3: DNA replication fills gap in donor daughter molecule.
7
Biochemistry 3107 - Fall 2001
8
DNA Repair
Direct Reversal
Direct repair systems reverse the mutagenic event. They are relatively rare. Examples are
the photoreactivation repair system which can reverse the UV induced pyrimidine dimer
formation and the removal of methyl groups by methyltransferases.
Pyrimidine dimers can be recognized by the enzyme photolyase which binds to the
photodimer and, in the presence of visible light in the range 300-500 nm, will split the
dimer.
[24-27]
Excision of the modified base
Bases which have been modified by alkylation or deamination may be removed from
DNA by special DNA glycosylases.
[24-29] [S31-44]
Each type of modified base has a corresponding DNA glycosylases which removes the
base leaving an apurinic or apyrimidinic site in the DNA. These sites are then
recognized by AP endonucleases which remove the ribose-phosphate moiety from the
backbone. The resulting gap can be reapired by DNA polymerase I and DNA ligase.
The following table lists a number of DNA glycosylases and their activities:
Glycosylase
Base(s) recognized
Ura-DNA glycosylase
Uracil
Hmu-DNA glycosylase
Hydroxymethyl uracil
5-mC-DNA glycosylase
5-methylcytosine
FaPy-DNA glycosylase
Formamidopyrimidines
8 hydroxyguanine
5,6-HT--DNA glycosylase
(endonuclease III)
5,6 hydrated thymines
9
Excision of modified nucleotides - Nucleotide Excision
Repair
The Nucleotide Excision Repair pathway involves the removal of a short stretch of
nucleotides containing a major distortion in the DNA double helix (including that caused
by pyrimidine dimers). This pathway requires the uvrABC encoded excinuclease, a
helicase encoded by uvrD, and DNA polymerase I.
[24-28] [S31-43]

UvrA is both an ATPase and a DNA-binding protein (it contains Zn-finger
motifs). It functions as a dimer and it recognizes and binds to damaged DNA. The
function of UvrA is to lead UvrB to the site of damage.

UvrB is an endonuclease and an ATPase, although the ATPase activity is cryptic
and is only revealed when it is complexed with UvrA.

UvrC then binds to UvrB. This complex nicks the DNA on either side of the
lesion or damage. UvrC nicks DNA about 7 nucleotides on the 5' side of the
damage; UvrB nicks DNA about 4 nucleotides on the 3' side of the damage.

The UvrD helicase binds to this region and unwinds it. By so doing, it displaces
the short single strand carrying the site of the damage. In total a region of 12-13
nucleotides is removed.
This region is then repaired by DNA polymerase I and DNA ligase.
Fidelity of DNA Replication
The process of DNA replication is remarkably accurate. Errors occur only once every 109
- 1010 nucleotides incorporated.
DNA polymerases, however, are not nearly so accurate. They make mistakes once every
104 - 105 nucleotides incorporated. The proofreading activity of a polymerase will
improve the overall error rate by 102 - 103 but this still leaves a difference of 102 - 103 in
the error rates between DNA synthesis and replication.
This difference is accomodated by mismatch repair systems which quickly fix any errors
made during replication.
10
Excision of modified nucleotides - DNA Mismatch Repair
This classic repair system is required to repair errors that escape detection by the proofreading systems during DNA replication. DNA Mismatch repair systems can distinguish
newly-synthesized DNA from parental DNA by virtue of the fact that the newlysynthesized DNA strands are non-methylated while parental DNA strands are
methylated.
DNA in which one strand is methylated and the other non-methylated is described as
hemimethylated.
Methylation of DNA is due to the activity of the dam methylase which methylates
adenine bases in the sequence GATC. The importance of this methylation for maintaining
the integrity of bacterial DNA is confirmed by the observation that dam- strains of E. coli
have increased rates of spontaneous mutation.
The mismatch repair system can act at a distance - in other words, a mismatch can be
repaired even though the nearest hemimethylated site is 1000 bp away.
Repair requires the products of the mutS, mutL and mutH genes which are believed to
function as a complex. These genes were originally identified as MUTATOR genes since
mutations in these genes will result in defective repair systems with the consequence that
the cells will have a higher rate of spontaneous mutation than usual.
MutS recognizes and binds at the site of a base pair mismatch.
MutH binds at a hemimethyalted GATC sequence and cleaves the nonmethylated strand.
MutL is thought to act as a linker protein which binds MutS and MutH in a complex.
The DNA between the nick caused by MutH and the site of the mismatch is removed by
exonuclease I or by exonuclease VII. The UvrD helicase is also involved. The resulting
gap is repaired by DNA polymerase III and DNA ligase.
[S31-45]
11
FROM: J. Jiricny (1998) Replication
errors: cha(lle)nging the genome. EMBO
J. 7:6427-6436.
NOTE: The above image may be restricted to users
from licensed or registered sites.


View the MutS Exhibit from the Online Macromolecular Museum.
View the MutH Exhibit from the Online Macromolecular Museum.
Repair and Cancer
In humans, at least one form of cancer is now known to be associated with a genetic
defect in a gene whose product is likely to function in a mismatch repair system.
Human nonpolyposis colorectal cancer is associated with defects in a human counterpart
to MutS (HNPCC Type 1) or MutL (HNPCC Type 2).
Genetic polymorphisms linked to HNPCC (type 1) were identified in a Newfoundland
family and in a New Zealand family. Further isolation and sequencing of the locus
identified it as coding for a homolog of MutS. Work to characterize the linkage in the
Newfoundland family was carried out by Jane Green in the Faculty of Medicine at MUN.
Subsequent work by Terry-Lynn Young identified a second family.
Online Mendelian Inheritance in Man entry on HNPCC (TYPE 1)
Genetic polymorphisms linked to HNPCC (type 2) have been identified in a locus
identified coding for a homolog of MutL.
Online Mendelian Inheritance in Man entry on HNPCC (TYPE 2)
Recombination and Repair
12
The repair system known as postreplication repair permits the cell to tolerate damage
without actually repairing it. It depends on the mechanisms of homologous genetic
recombination to replace a damaged region of DNA that cannot be repaired with a good
copy of the same region.
[24-30]
An example or model showing how this system might operate is as follows.
Let us suppose that a DNA molecule has acquired a thymine dimer:
Now also supose that this molecule is being replicated. A PolIII replisome will be unable
to correctly copy the thymine dimer. Rather than stall at this point, it may simply skip
over the problem:
It is now believed that DNA polymerase II (PolII) reinitiates DNA synthesis
downstream of lesions such as thymine dimers.
Now, we are left with two daughter molecules, one of which is complete and one of
which has an unpaired region containing a thymine dimer:
13
This cannot be repaired by the usual repair systems. However, the exposed ssDNA can be
bound by the RecA protein which can then catalyse strand exchange with the correctly
synthesised daugthter molecule:
This intermediate contains two Holliday junctions which can be cleaved (resolved) by
the Ruv proteins to give:
One daughter molecule still contains the thymine dimer but the opposite strand has the
correctgenetic sequence. The other daughter now conatins a gap but this gap can be
repaired correctly by the usual repair systems.
Note, that under stress conditions, DNA polymerase V (see below) can copy thymine
dimers. However, it often misincorporates a guanine nucleotide opposite the second
thymine. This accounts for the observation that a thymine dimers (and, specifically, the
second base of the dimer) is a hotspot for A -> G transitions.
SOS Repair
14
The SOS repair system is induced in response to major damage to the bacterial DNA or
in response to agents which inhibit DNA replication. The system is a complex one with
over 20 genes involved. Two of these are the important regulator genes: lexA and recA.
[Figure 10-17 from Snyder & Champness, Molecular Genetics of Bacteria]
LexA is a repressor that regulates the expression of all of the other SOS repair genes,
including recA. It also regulates its own synthesis (i.e. it is autoregulatory). Normally,
LexA blocks expression of the SOS repair genes.
The RecA protein is a multifunctional protein with ATPase and ssDNA binding
activities. When bound by ssDNA, it is also a co-protease. Damage or severe stress to
the cell generates ssDNA which activates this co-protease activity. The RecA co-protease
activity then stimulates the protease activity of the LexA protein. As a result, LexA is no
longer able to block transcription and the SOS repair genes are thereby induced and
expressed.
Among the genes that are induced are uvrABC and D and also umuC and umuD. UmuD
is cleaved by the RecA coprotease activity and the truncated protein, UmuD', in
association with UmuC forms DNA polymerase V. PolV requires the  and  subunit of
PolIII for optimal activity. , which functions as the sliding clamp, is required for
processivity and  is the clamp loader. DNA synthesis by PolV is error-prone.
RESOURCE MATERIAL
VOET, VOET &
PRATT
1. Chapter 24, DNA Replication, Repair and
STRYER
1. Chapter 31, DNA Structure, Replication, and
Recombination, pages 798 - 801
Repair, pages 811-813
LEHNINGER
1. Chapter 24, DNA Metabolism, pages 831 - 839
TAMARIN
1. Chapter 16, pages 472 - 480.
WEB SITES


View the MutS Exhibit from the Online
Macromolecular Museum.
View the MutH Exhibit from the Online
Macromolecular Museum.
15
Format and Original Material © Martin E. Mulligan, 1996-2001
16
Marita Cohn
Molecular genetics of telomeres and telomerase
Project description
Telomeres are the terminal protein-DNA complexes of linear eukaryotic
chromosomes, and are essential to ensure chromosome integrity and
stability. Broken chromosome ends, lacking telomeres, show a propensity to
fuse with each other and are also susceptible to degradation by exonucleases.
Among a wide variety of eukaryotic species, the telomeric DNA consists of
typically G-rich tandem repeats, 5-8 bp in length. These repeats are
synthesized by telomerase, a telomere-specific RNP polymerase, which uses
an internal RNA moiety as a template sequence for this procedure. In a
reverse-transcriptase like manner, telomerase copies part of this RNA
sequence into DNA.
The mechanism of telomere elongation
by telomerase. In this example the
telomerase enzyme is synthesizing the
repeated sequence TTGGGG, which is
the telomeric sequence of Tetrahymena
thermophila.
17
The first detection of telomerase activity, in the ciliate Tetrahymena
thermophila, was followed by its detection in a variety of organisms
including vertebrates, yeast, and plants. In the absence of telomerase
activity, telomeres shorten with each cell division. Normal human somatic
cells lack detectable telomerase activity, whereas telomerase is activated in
germ cells, immortalized cells and the majority of primary tumors. The
correlation between telomerase activity and tumor growth has spurred
investigations of the possiblities to use telomerase activity as a target for
anticancer drug treatments.
Our identification of much longer telomeric repeat units (16-26 bp) in
several yeast species has expanded the previous range of telomeric repeat
sequences to include not only more complex sequences, but also ones that
are not necessarily G-rich. Despite a marked telomeric sequence diversity,
all the yeast species examined show a conserved core. This may be partly
explained by the preservation of a binding site for the RAP1 protein.
The length of telomeres are regulated, so that each species has a defined
average mean length. The RAP1 protein has been shown to play a key role
in a negative-feedback mechanism that controls the length of telomeric
repeat tracts in yeast. A model has been proposed where the number of
bound RAP1 protein molecules is sensed by the cell, and is used to measure
the length of the telomere tract.
The "protein counting" model for
telomere length regulation. The RAP1
proteins bind to the telomeric DNA.
When a threshold number is reached,
further telomere elongation by
telomerase is inhibited.
How the "protein counting" mechanism is mediated is still largely unknown,
but it has been proposed that the binding of a critical number of RAP1
protein molecules alters the shape of telomeres so that the telomerase
18
enzyme can no longer access the end. When the telomeres shorten and the
number of protein molecules decrease, the enzyme would regain its ability to
bind and elongate the telomere. Several other yeast telomere binding
proteins are involved in the assembly of the functional telomere cap of the
yeast chromosome, and are implicated in the regulation of telomere length.
How the actions of these proteins are coordinated to maintain telomeres
within a defined range has yet to be determined.
The telomeric DNA sequences are
bound by a number of different proteins
which build up a protective cap on the
chromosome. The RAP1 protein has
been shown to regulate the length of
the telomere, probably by controlling
the access of telomerase to the end of
the chromosome.
We have analyzed the Rap1p protein counting mechanism in two other yeast
species; Saccharomyces castellii and Saccharomyces dairenensis, and have
shown that they have RAP1 proteins with homologous functions. These
species offer an advantage in the prediction of the number of bound Rap1p
molecules, because they have homogeneously repeated telomeric DNA
sequences, and thus constitute valuable new models for the analyses of the
protein counting mechanism.
Fundamental knowledge of telomere maintenance will be of importance for
the establishment of the role of telomerase in tumorigenesis. In our project
19
we are characterizing the telomerase enzyme and the mechanisms of its
DNA synthesizing activity, and we want to determine what factors that
interact with telomerase to regulate its biochemical activity. We recently
isolated the S. castellii CDC13 homolog (scasCDC13) and determined that
the full-length protein specifically binds single-stranded telomeric DNA.
The minimal binding site is an octamer sequence which overlaps the Rap1
binding site. The four nucleotides of most importance for the sequence
specific binding were found to be conserved among telomeric sequences of
various different species, including those in human telomeres. Thus, further
analysis of scasCdc13p function is promising interesting data on the details
of the molecular mechanisms involved in telomere maintenance.
Telomerase is an enzyme that adds specific DNA sequence repeats ("TTAGGG" in all
vertebrates) to the 3' ("three prime") end of DNA strands in the telomere regions, which
are found at the ends of eukaryotic chromosomes. The telomeres contain condensed
DNA material, giving stability to the chromosomes. The enzyme is a reverse
transcriptase that carries its own RNA molecule, which is used as a template when it
elongates telomeres, which are shortened after each replication cycle. Telomerase was
discovered by Carol W. Greider and Elizabeth Blackburn in 1985 in the ciliate
Tetrahymena.[1] There are some indicators that telomerase is of retroviral origin.[2]
Why do some cancer cells divide not into two, as cells are supposed to
do in mitosis, but into three-four new cells that look thoroughly
abnormal? This question was raised as early as the 1890s by the
German tumor researcher David Hansemann, who could observe the
strange mitosis even using the microscopes of his day. Now another
David, Lund University researcher David Gisselsson, has found an
answer.
Together with associates from the Section for Clinical Genetics, David
Gisselsson has long been studying chromosome changes in various sorts of
cancer cells. Contrary to the earlier belief that tumor cells are rather stable
genetically, a few years ago he was able to show that genetic chaos prevails
in certain severe cancer forms.
"The normal number of chromosomes in a human cell is 46. But in tumors
from skeletal and pancreatic cancer, some cells can have far fewer than 46
chromosomes while others have several hundred. The structure of these
chromosomes is also often abnormal-for example, they have lost some parts,
20
traded segments with each other, and copied certain genes in mass
production," says David Gisselsson.
The Lund scientists have scrutinized these phenomena in a series of studies.
They have been able to demonstrate that certain tumor cells get stuck in
mitosis, so that their chromosomes do not divide neatly in two directions,
but rather get pulled apart in a disorganized manner into the daughter cells.
This is because the ends of the chromosomes, the so-called telomers, have
lost their protective exteriors.
Cells with truncated, unprotected telomers from different chromosomes
actually ought to simply die, but this does not happen in these tumor cells.
Instead, the naked telomers cling to each other. This can be the explanation
for the abnormal number of chromosomes in some tumor cells, where
certain ones have incorporated a number of extra chromosomes while others
wind up with too few.
Having the wrong number of chromosomes does not lead directly to death in
these tumor cells. On the other hand, they have problems with mitosis.
"We have observed that these cells sometimes try to divide, but they fail and
go into an idle state. If they then try again, they tend to divide in three or
four directions. This explains Hansemann's discovery from the 1890s!" says
David Gisselsson.
In its latest study the Lund team has also shown that the daughter cells of
those cells which divide in more than two directions have a completely
random distribution of chromosomes. This genetic chaos is so great that the
cells usually die.
Research groups in several countries have been studying von Hansemann
mitosis at the molecular level, that is, what happens inside the cell. But this
work has proven to have little relevance to the struggle against cancer. These
are not the cells that make a tumor grow, since they themselves typically die
off.
On the other hand, the Lund team now wishes to study substances that might
be able to counteract cancer by further damaging already truncated telomers.
In that way it may be possible to increase the genetic chaos in tumor cells in
order to get more of them to simply die.
21
Copyright 1998 by Beth A. Montelone, Ph. D., Division of Biology, Kansas
State University; originally written as a supplement to BIOL400, Human
Genetics.
Mutation, Mutagens, and DNA Repair
Outline
I. Introduction: Definitions and mutation rates
We have been using the term 'mutation' pretty loosely up to this point in the
course...now we need to define it more precisely: mutation-- a change in
the genetic material (ie. DNA). We are going to spend some time talking
about how mutations can occur and what their consequences may be to cells;
we will also be looking at the ways in which cells avoid mutations by
repairing DNA damage.
Why this focus? Why are mutations important? There are several reasons: 1)
they may have deleterious or (rarely) advantageous consequences to an
organism (or its descendants); 2) they are important to geneticists: the most
common way we study something is to break it--ie., we search for or make a
variant (mutant) lacking the ability to perform a process which we want to
study. These genetic variants possess mutant alleles of the genes we are
interested in studying. 3) Mutations are important as the major source of
genetic variation which fuels evolutionary change (as we will see later when
we talk about population genetics and evolution).
Let's further define mutation as a heritable change in the genetic material.
This point becomes important in multicellular organisms where we must
distinguish between changes in gametes (germline mutations) and changes in
body cells (somatic mutations). The former are passed on to one's offspring;
the latter are not but we will see they can be very important in causing
cancer.
22
In detection of germline mutations in humans and measurement of human
mutation rates we have the problem of diploidy. Most forward mutations
(normal gene to mutant form) are recessive and so won't be detected unless a
zygote gets two copies of the mutant allele. [Reversion or reverse mutation
(mutant back to normal) is generally much less frequent because there are a
lot more ways to "break" a gene than there are to reverse an existing
mutation.] So how can we detect and measure rates of new mutations? We
can look at dominant mutations on occuring on the autosomes and at both
recessive and dominant mutations on the X chromosome, since males are
hemizygous for X-linked genes. Example: achondroplasia occurs
sporadically (in families with no previous history) as a result of new
mutations in the gene for the fibroblast growth factor receptor. One study
detected seven infants born with sporadic achondroplasia in one year among
242,257 total births recorded. So the rate (actually a frequency but we won't
be concerned about the difference for the purposes of thinking about rates in
this course) is 7/242,257 x 1/2 (2 alleles per zygote) = 1.4 x 10e-5.
This rate is roughly in the middle of the range reported for various human
genes: those with high mutation rates like NF1 (neurofibromatosis type 1)
and DMD (Duchenne muscular dystrophy) (ca. 1 x 10e-4) and those with
low rates of new mutation like the Huntington's Disease gene (1 x 10e-6).
This hundred-fold range shows that mutation rates per gene can be
intrinsically different.
Why might this be? Two possible explanations are: 1) target size and 2) hot
spots. Some genes are large, meaning that there are many bases at which
mutations could alter or disrupt their function. The large target argument
could well be responsible for the high rates of mutation of the NF and DMD
genes, as these are known to have very large protein coding regions.
Alternatively, some genes may be in regions of chromosomes which are
more susceptible to genetic damage/change or may contain sequences which
are more likely to be altered by spontaneous mutations; the achondroplasia
gene is known to contain a hot spot of the latter type (a CpG sequence,
discussed below).
From studies like these in vivo and others using human cells in vitro, the
overall human mutation rate is estimated to be about 1 x 10e-6 per gene per
generation. (Therefore the HD gene rate is probably more typical than the
other genes mentioned above.) This rate is similar to those measured in
various prokaryotic and eukaryotic microorganisms. We can use the
23
estimated human mutation rate to determine its impact on the likelihood of
changes occurring in each generation: a rate of 1 x 10e-6 mutations/gene x 5
x 10e4 genes/haploid genome = 5 x 10e-2 mutations per gamete (=5/100 or
1/20). 1/20 x 2 gametes per zygote = 1/10 chance that each zygote carries a
new mutation somewhere in the genome. This seems like a very high
number but we need to remember that most mutations are recessive and thus
will not be expressed in the heterozygous condition.
II. Types of Mutations
Mutations, or heritable alterations in the genetic material, may be gross (at
the level of the chromosome, which we have already discussed) or point
alterations (this technically means mutations not visible as cytological
abnormalities and/or those which map to a single "point" in experimental
crosses). The latter can involve just a single nucleotide pair in DNA. In this
section, we will be considering small changes in DNA, of the point mutation
type.
A. Base pair (nucleotide pair) substitutions
These are of two types: transitions (purine to purine or pyrimidine to
pyrimidine) and transversions (purine to pyrimidine or pyrimidine to
purine). We break these down into the two categories because they can occur
in different ways.
The consequences of base substitution mutations in protein coding regions
of a gene depend on the substitution and its location. They may be silent, not
resulting in a new amino acid in the protein sequence, eg. GCA or GCG
codons in mRNA both mean arginine [this is often true in the third position
of a codon, especially with transitions because of "wobble" base pairing]. A
base substitution could also result in an amino acid substitution; this is
referred to as a missense mutation. For example, CTC in the DNA sense
strand [GAG in mRNA] will specify a glutamate residue in the protein; this
is altered to CAC in the DNA or GUG in the mRNA, resulting in a valine
residue in the beta-globin protein chain causing sickle-cell anemia. Missense
mutations may have very serious consquences, as in the case of sickle-cell
anemia, mild consequences as in the case of hemoglobin C (a different
amino acid substitution in position 6 of beta-globin) or no phenotype as in
the case of two known amino acid substitutions at position 7 of beta-globin.
Finally, base substitutions in a protein coding region may mutate an amino
24
acid codon to a termination codon or vice versa. The former type, which
results in a prematurely shortened protein is referred to as a nonsense
mutation. The effects of nonsense mutations are variable depending upon
how much of the truncated protein is present and is required for its function.
Base substitution mutations may also occur in promoters or 5' regulatory
regions of genes or in introns and may affect their transcription, translation,
or splicing. Many of the beta-thalassemias are the result of these types of
non-structural mutations that affect the level of expression of the globin
genes. All of the types of mutation described above have been observed in
human globin genes. Their consequences depend on what they do to the
level of expression of the gene product and/or on what amino acid
substitution may have occurred and where it is in the protein.
B. Frameshift mutations
These result from the insertion or deletion of one or more (not in multiples
of three) nucleotides in the coding region of a gene. This causes an alteration
of the reading frame: since codons are groups of three nucleotides, there are
three possible reading frames for each gene although only one is used.
eg. mRNA with sequence AUG CAG AUA AAC GCU GCA UAA
amino acid sequence from the first reading frame: met gln ile asn ala ala stop
the second reading frame gives: cys arg stop
A mutation of this sort changes all the amino acids downstream and is very
likely to create a nonfunctional product since it may differ greatly from the
normal protein. Further, reading frames other than the correct one often
contain stop codons which will truncate the mutant protein prematurely.
III. Origins of spontaneous mutation
A. Definition and sources
A spontaneous mutation is one that occurs as a result of natural processes in
cells. We can distinguish these from induced mutations; those that occur as a
result of interaction of DNA with an outside agent or mutagen. Since some
of the same mechanisms are involved in producing spontaneous and induced
mutations, we will consider them together. Some so-called "spontaneous
mutations" probably are the result of naturally occurring mutagens in the
25
environment; nevertheless there are others that definitely arise
spontaneously, for example, DNA replication errors.
B. DNA replication errors and polymerase accuracy
Mistakes in DNA replication where an incorrect nucleotide is added will
lead to a mutation in the next round of DNA replication of the strand with
the incorrect nucleotide.The frequency at which a DNA polymerase makes
mistakes (inserts an incorrect base) will influence the spontaneous mutation
frequency and it has been observed that different polymerases vary in their
accuracy. One major factor affecting polymerase accuracy is the presence of
a "proofreading" 3'-5' exonuclease which will remove incorrectly paired
bases inserted by the polymerase. This was shown in vitro with purified
DNA polymerases (those with 3'-5' exonucleases make fewer mistakes) and
genetically by Drake with bacteriophage T4 mutants: T4 has its own
polymerase with a 3'-5' exo. Drake isolated mutator mutants (which had a
higher spontaneous mutation rate than normal) and antimutator mutants
(lower mutation rate than normal) in the polymerase gene and showed that
the mutators had a higher ratio of polymerizing to exonuclease activity than
normal and that the antimutators had a lower ratio. These studies showed
that the function of the 3'-5' exonuclease is to prevent misincorporation
during DNA replication and to prevent mutations. Mutator mutants have
since been isolated in other organisms and have been shown to affect various
components of the DNA replication complex; alterations in a number of
these proteins are likely to affect the accuracy of the system.
C. Base alterations and base damage
The bases of DNA are subject to spontaneous structural alterations called
tautomerization: they are capable of existing in two forms between which
they interconvert. For example, guanine can exist in keto or enol forms. The
keto form is favored but the enol form can occur by shifting a proton and
some electrons; these forms are called tautomers or structural isomers. The
various tautomer forms of the bases have different pairing properties.
Thymine can also have an enol form; adenine and cytosine exist in amino or
imino forms. If during DNA replication, G is in the enol form, the
polymerase will add a T across from it instead of the normal C because the
base pairing rules are changed (not a polymerase error). The result is a G:C
to A:T transition; tautomerization causes transition mutations only.
26
Another mutatgenic process occurring in cells is spontaneous base
degradation. The deamination of cytosine to uracil happens at a significant
rate in cells.
Deamination can be repaired by a specific repair process which detects
uracil, not normally present in DNA; otherwise the U will cause A to be
inserted opposite it and cause a C:G to T:A transition when the DNA is
replicated.
Deamination of methylcytosine to thymine can also occur. Methylcytosine
occurs in the human genome at the sequence 5'CpG3', which is normally
avoided in the coding regions of genes. If the meC is deaminated to T, there
is no repair system which can recognize and remove it (because T is a
normal base in DNA). This means that wherever CpG occurs in genes it is a
"hot spot" for mutation. Such a hot spot has recently been found in the
achondroplasia gene.
A third type of spontaneous DNA damage that occurs frequently is damage
to the bases by free radicals of oxygen. These arise in cells as a result of
oxidative metabolism and also are formed by physical agents such as
radiation. An important oxidation product is 8-hydroxyguanine, which
mispairs with adenine, resulting in G:C to T:A transversions.
Still another type of spontaneous DNA damage is alkylation, the addition of
alkyl (methyl, ethyl, occasionally propyl) groups to the bases or backbone of
DNA. Alkylation can occur through reaction of compounds such as Sadenosyl methionine with DNA. Alkylated bases may be subject to
spontaneous breakdown or mispairing.
D. Spontaneous frameshift mutations
Streisinger observed in the 1960's that frameshift mutations in
bacteriophages tended to occur in areas with "runs" of repeats of one
nucleotide.
Example:
5' AGTCAATCCATGAAAAAATCAG 3'
3' TCAGTTAGGTACTTTTTTAGTC 5'
He proposed that these frameshifts are the result of "slipped mispairing"
between the template DNA strand and the newly synthesized strand during
27
DNA replication. In the sequence above, a likely spot for frameshift
mutations to occur would be in the stretch of 6 A:T base pairs. Subsequent
studies with genes from other organisms, including humans, have shown that
runs of repeated nucleotides are indeed hotspots for frameshift mutations.
28
IV. Mutagens
A mutagen is a natural or human-made agent (physical or chemical) which
can alter the structure or sequence of DNA.
A. Chemical mutagens
The first report of mutagenic action of a chemical was in 1942 by Charlotte
Auerbach, who showed that nitrogen mustard (component of poisonous
mustard gas used in World Wars I and II) could cause mutations in cells.
Since that time, many other mutagenic chemicals have been identified and
there is a huge industry and government bureaucracy dedicated to finding
them in food additives, industrial wastes, etc.
It is possible to distinguish chemical mutagens by their modes of action;
some of these cause mutations by mechanisms similar to those which arise
spontaneously while others are more like radiation (to be considered next) in
their effects.
1. Base analogs
These chemicals structurally resemble purines and pyrimidines and may be
incorporated into DNA in place of the normal bases during DNA replication:


bromouracil (BU)--artificially created compound extensively used in
research. Resembles thymine (has Br atom instead of methyl group)
and will be incorporated into DNA and pair with A like thymine. It
has a higher likelihood for tautomerization to the enol form (BU*)
aminopurine --adenine analog which can pair with T or (less well)
with C; causes A:T to G:C or G:C to A:T transitions. Base analogs
cause transitions, as do spontaneous tautomerization events.
2. Chemicals which alter structure and pairing properties of bases
There are many such mutagens; some well-known examples are:

nitrous acid--formed by digestion of nitrites (preservatives) in foods.
It causes C to U, meC to T, and A to hypoxanthine deaminations. [See
above for the consequences of the first two events; hypoxanthine in
DNA pairs with C and causes transitions. Deamination by nitrous
acid, like spontaneous deamination, causes transitions.
29

nitrosoguanidine, methyl methanesulfonate, ethyl
methanesulfonate--chemical mutagens that react with bases and add
methyl or ethyl groups. Depending on the affected atom, the alkylated
base may then degrade to yield a baseless site, which is mutagenic and
recombinogenic, or mispair to result in mutations upon DNA
replication.
3. Intercalating agents
acridine orange, proflavin, ethidium bromide (used in labs as dyes and
mutagens)
All are flat, multiple ring molecules which interact with bases of DNA and
insert between them. This insertion causes a "stretching" of the DNA duplex
and the DNA polymerase is "fooled" into inserting an extra base opposite an
intercalated molecule. The result is that intercalating agents cause
frameshifts.
4. Agents altering DNA structure
We are using this as a "catch-all" category which includes a variety of
different kinds of agents. These may be:



--large molecules which bind to bases in DNA and cause them to be
noncoding--we refer to these as "bulky" lesions (eg. NAAAF)
--agents causing intra- and inter-strand crosslinks (eg. psoralens-found in some vegetables and used in treatments of some skin
conditions)
--chemicals causing DNA strand breaks (eg. peroxides)
What these agents have in common is that they probably cause
mutations not directly but by induction of mutagenic repair processes
(to be described later).
B. Radiation
Radiation was the first mutagenic agent known; its effects on genes were
first reported in the 1920's. Radiation itself was discovered in 1890's:
Roentgen discovered X-rays in 1895, Becquerel discovered radioactivity in
1896, and Marie and Pierre Curie discovered radioactive elements in 1898.
These three discoveries and others led to the birth of atomic physics and our
understanding of electromagnetic radiation.
30
1. EM spectrum
Visible light and other forms of radiation are all types of electromagnetic
radiation (consists of electric and magnetic waves). The length of EM waves
(wavelength) varies widely and is inversely proportional to the energy they
contain: this is the basis of the so-called EM spectrum.
The longest waves (AM radio) have the least energy while successively
shorter waves and increasing energy are seen with FM radio, TV,
microwaves, infrared, visible, ultraviolet (UV), X and gamma radiation. The
portion which is biologically significant is UV and higher energy radiation.
2. Ionizing radiation
X- and gamma-rays are energetic enough that they produce reactive ions
(charged atoms or molecules) when they react with biological molecules;
thus they are referred to as ionizing radiation. This term also includes
corpuscular radiation--streams of atomic and subatomic particles emitted by
radioactive elements: these are of two types, alpha- and beta-particles [alpha
are helium nuclei, 2 protons and 2 neutrons; beta are electrons].
UV radiation is not ionizing but can react with DNA and other biological
molecules and is also important as a mutagen.
The units now used for ionizing radiation of all types are rems (roentgen
equivalent man): 1 rem of any ionizing radiation produces similar biological
effects. The unit used previously was the rad (radiation absorbed dose).
However, the effects of different types of radiation differ for one rad unit:
one rad of alpha particles has a much greater damaging effect than one rad
of gamma rays; alpha particles have a greater RBE (relative biological
effectiveness) than gamma rays. The relationship between these units is that:
# rads x RBE = # rems
In addition to the energy type and total dose of radiation the dose rate should
be considered: the same number of rems given in a brief, intense exposure
(high dose rate) causes burns and skin damage versus a long-term weak
exposure (low dose rate) which would only increase risk of mutation and
cancer.
31
3. Sources of radiation
Natural sources of radiation produce so-called background radiation. These
include cosmic rays from the sun and outer space, radioactive elements in
soil and terrestrial products (wood, stone) and in the atmosphere (radon).
One's exposure due to background radiation varies with geographic location.
In addition, humans have created artificial sources of radiation which
contribute to our radiation exposure. Among these are medical testing
(diagnostic X-rays and other procedures), nuclear testing and power plants,
and various other products (TV's, smoke detectors, airport X-rays).
Taken together, our overall total average exposure from all sources is about
350 mrem/year; the major contributor of which is from radon exposure. See
the graph on page 281 of your text for the breakdown.
4. Biological effects of radiation
Ionizing radiation produces a range of damage to cells and organisms
primarily due to the production of free radicals of water (the hydroxyl or OH
radical). Free radicals possess unpaired electrons and are chemically very
reactive and will interact with DNA, proteins, lipids in cell membranes, etc.
Thus X-rays can cause DNA and protein damage which may result in
organelle failure, block cell division, or cause cell death. The rapidly
dividing cell types (blood cell-forming areas of bone marrow,
gastrointestinal tract lining) are the most affected by ionizing radiation and
the severity of the effects depends upon the dose received. The information
below is based upon accidental exposures of nuclear plant workers and
victims of atomic bomb explosions such as those in Hiroshima and
Nagasaki:
sublethal dose (100-250 rems): nausea and vomiting early; 1-2 wk. latent
period followed by malaise, anorexia, diarrhea, hair loss, recovery (latency
due to time it takes hematopoetic or other damage to show up)
lethal dose (350-450 rems): nausea and vomiting early; 1 wk. latent period
followed by above with more severe symptoms including internal bleeding;
a 50% chance of death [LD50 : dose at which half of exposed individuals
will die; ca. 400 rems for humans]. Death is due to blood cell or
gastrointestinal failure.
32
supralethal dose (>650 rems): nausea and vomiting early, followed by
shock, abdominal pain, diarrhea, fever and death within hours or days. Death
is due to heart or CNS damage.
For the affected tissues and organs, the number of destroyed cells and the
likelihood of their replacement determines the survival chances. The long
term effects include increased cancer risk and increased risk of mutations in
one's offspring.
5. Genetic effects of radiation
Ionizing radiation produces a range of effects on DNA both through free
radical effects and direct action:



-breaks in one or both strands (can lead to rearrangements, deletions,
chromosome loss, death if unrepaired; this is from stimulation of
recombination)
-damage to/loss of bases (mutations)
-crosslinking of DNA to itself or proteins
The genetic effects of radiation were reported in 1927 in Drosophila by
Muller and in 1928 in plants (barley) by Stadler; both showed that the
frequency of induced mutations is a function of X-ray dose. Their
experiments revealed that there was a linear relationship between X-ray dose
and induced mutation level, that there was no threshold or "safe" dose of
radiation and that all doses are significant, and finally, that "split dose"
experiments showed that the genetic effects of radiation are cumulative.
6. UV (ultraviolet)
UV radiation is less energetic, and therefore non-ionizing, but its
wavelengths are preferentially absorbed by bases of DNA and by aromatic
amino acids of proteins, so it, too, has important biological and genetic
effects.
UV is normally classified in terms of its wavelength: UV-C (180-290 nm)-"germicidal"--most energetic and lethal, it is not found in sunlight because it
is absorbed by the ozone layer; UV-B (290-320 nm)--major lethal/mutagenic
fraction of sunlight; UV-A (320 nm--visible)--"near UV"--also has
deleterious effects (primarily because it creates oxygen radicals) but it
produces very few pyrimidine dimers. Tanning beds will have UV-A and
33
UV-B. To see a graphic representation of the wavelengths of UV and ozone
absorption, click here.
The major lethal lesions are pyrimidine dimers in DNA (produced by UV-B
and UV-C)--these are the result of a covalent attachment between adjacent
pyrimidines in one strand. This is shown here for a thymine-thymine dimer
and here for a thymine-cytosine dimer. These dimers, like bulky lesions
from chemicals, block transcription and DNA replication and are lethal if
unrepaired. They can stimulate mutation and chromosome rearrangement as
well.
V. DNA repair systems
Because DNA damage occurs spontaneously and as a result to ubiquitous
environmental agents, most organisms possess some capacity to repair their
DNA and DNA is the only macromolecule which IS repaired by cells. We
can divide "repair" mechanisms into 3 categories:
damage reversal--simplest; enzymatic action restores normal structure
without breaking backbone
damage removal--involves cutting out and replacing a damaged or
inappropriate base or section of nucleotides
damage tolerance--not truly repair but a way of coping with damage so that
life can go on
We will look at examples of each type of repair, the mechanisms, the
consequences of mutations in each, in both model organisms and in humans.
A. Damage reversal
1. Photoreactivation
This is one of the simplest and perhaps oldest repair systems: it consists of a
single enzyme which can split pyrimidine dimers (break the covalent bond)
in presence of light. Click here to see the photoreactivation reaction.
The photolyase enzyme catalyzes this reaction; it is found in many bacteria,
lower eukaryotes, insects, and plants. It seems to be absent in mammals
(including humans). The gene is present in mammals but may code for a
protein with an accessory function in another type of repair.
34
2. Ligation of single strand breaks
X-rays and some chemicals like peroxides can cause breaks in backbone of
DNA. Simple breaks in one strand are rapidly repaired by DNA ligase.
Microbial mutants lacking ligase tend to have high levels of recombination
since DNA ends are recombinogenic (very reactive). A human known only
by the code name of 46BR was found to have mutations in both of her DNA
ligase I genes; she had poor growth, immunodeficiency, and sun sensitivity
and died at a young age of lymphoma. Fibroblast cells from 46BR are
sensitive to killing by DNA damaging agents including ionizing radiation. In
addition, the rare hereditary disease Bloom syndrome also somehow is
involved with DNA ligase deficiency (although the Bloom syndrome protein
is a DNA helicase); patients' cultured cells have high levels of chromosome
aberrations and spontaneous mutation.
B. Damage removal
1. Base excision repair
The damaged or inappropriate base is removed from its sugar linkage and
replaced. These are glycosylase enzymes which cut the base-sugar bond.
example: uracil glycosylase--enzyme which removes uracil from DNA.
Uracil is not supposed to be in DNA--can occur if RNA primers not
removed in DNA replication or (more likely) if cytosine is deaminated (this
is potentially mutagenic). The enzyme recognizes uracil and cuts the
glyscosyl linkage to deoxyribose. The sugar is then cleaved and a new base
put in by DNA polymerase using the other strand as a template. Mutants
lacking uracil glycosylase have elevated spontaneous mutation levels (C to
U is not fixed, which leads to transitions) and are hyper-sensitive to killing
and mutation by nitrous acid (which causes C to U deamination).
There are other specific glycosylases for particular types of DNA damage
caused by radiation and chemicals.
2. Mismatch repair
This process occurs after DNA replication as a last "spellcheck" on its
accuracy. In E. coli, it adds another 100-1000-fold accuracy to replication. It
is carried out by a group of proteins which can scan DNA and look for
incorrectly paired bases (or unpaired bases) which will have aberrant
dimensions in the double helix. The incorrect nucleotide is removed as part
of a short stretch and then the DNA polymerase gets a second try to get the
right sequence.
35
Human mismatch repair proteins have recently been identified and are very
similar to those of the prokaryote E. coli and the simple eukaryote yeast (this
is an old invention of cells); mutations are found to be passed in the
germline of families with some types of inherited colon cancer (HPNCC).
3. Nucleotide excision repair
This system works on DNA damage which is "bulky" and creates a block to
DNA replication and transcription (so--UV-induced dimers and some kinds
of chemical adducts). It probably recognizes not a specific structure but a
distortion in the double helix. The mechanism consists of cleavage of the
DNA strand containing the damage by endonucleases on either side of
damage followed by exonuclease removal of a short segment containing the
damaged region. DNA polymerase can fill in the gap that results. Excision
repair is shown here .
Mutants that are defective in NER have been isolated in many organisms
and are sensitive to killing and mutagenesis by UV and chemicals which act
like UV. Humans with the hereditary disease xeroderma pigmentosum are
sunlight-sensitive, they have very high risks of skin cancers on sun-exposed
areas of the body and have defects in genes homologous to those required
for NER in simple eukaryotes. NER mutants in lower organisms are UVsensitive and have elevated levels of mutation and recombination induced by
UV (because they are unable to use the accurate NER method to remove
pyrimidine dimers and must use mutagenic or recombinogenic systems).
C. DNA damage tolerance
Not all DNA damage is or can be removed immediately; some of it may
persist for a while. If a DNA replication fork encounters DNA damage such
as a pyrimidine dimer it will normally act as a block to further replication.
However, in eukaryotes, DNA replication initiates at multiple sites and it
may be able to resume downstream of a dimer, leaving a "gap" of singlestranded unreplicated DNA. The gap is potentially just as dangerous if not
more so than the dimer if the cell divides. So there is a way to repair the gap
by recombination with either the other homolog or the sister chromatid--this
yields two intact daughter molecules, one of which still contains the dimer.
36
1. Recombinational (daughter-strand gap) repair
This is a repair mechanism which promotes recombination to fix the
daughter-strand gap--not the dimer--and is a way to cope with the problems
of a non-coding lesion persisting in DNA. The events of recombinational
repair are shown here . This type of recombinational repair is generally
accurate (although it can cause homozygosis of deleterious recessive alleles)
and requires a homolog or sister chromatid. The products of the human
breast cancer susceptibility genes BRCA1 and BRCA2 may be involved in
recombinational repair together with homologs of the yeast RAD51 and
RAD52 genes.
A second type of recombinational repair which is used primarily to repair
broken DNA ends such as are caused by ionizing radiation and chemical
mutagens with similar action is the non-homologous end-joining reaction.
This repair system is also employed by B and T cells of the immune system
for genetic rearrangements needed for their function. The Ku70, Ku80, and
DNA-dependent protein kinase proteins are needed for non-homologous
end-joining. Rodent cell lines with mutations in these genes are very
sensitive to killing by ionizing radiation and defective in immune system
rearrangement.
2. Mutagenic repair (trans-lesion synthesis)
An alternative scenario for a DNA polymerase blocked at a dimer is to
change its specificity so that it can insert any nucleotide opposite the dimer
and continue replication ("mutate or die" scenario). See the figure . We
know that this can happen in bacteria and think that it probably happens in
eukaryotes, though the mechanism is not well understood. This is a reason
why repair may sometimes cause mutations.
VI. Checkpoints
Ataxia telangiectasia is a human autosomal recessive hereditary disease
which causes several defects including about a hundred-fold increase in
cancer susceptibility. AT patients' cells in culture show abnormalities
including spontaneous and radiation-induced chromosome breaks and
sensitivity to killing by X-rays. (Ironically, the patients also show extreme
sensitivity to killing by X-ray doses intended to be therapeutic for their
cancers.) However, AT cultured cells do not show a defect in repair of X-ray
damage to their DNA; instead, unlike normal cells, they continue to replicate
their DNA even when it has been damaged by X-rays. It is the failure to
37
recognize DNA damage and respond appropriately by halting the cell cycle
until repair can occur that leads to chromosome aberrations and death after
X-ray in the AT patients.
The defect in AT is one in a cell cycle checkpoint, a decision point that
governs progression through the next phase of the cell cycle. There are
genetically controlled checkpoints that decide entry into a new cell cycle
(G0 to G1 point), the decision to replicate the DNA (G1 to S point), and the
decision to divide (G2 to M point). Mutations in the checkpoint genes can
lead to uncontrolled cell growth, ie. cancer.
Although AT itself is a rare condition, it has been estimated that the frequency of
heterozygotes with one AT mutation is about 1% in the population. These individuals
also have a higher cancer risk and intermediate radiation sensitivity. Thus, screening by
X-ray methods (eg. mammography) may increase the chances of an AT heterozygote
developing cancer.
Last updated June 14, 1999.
Replication of a circular bacterial chromosome
38
Bacterial chromosomes are circular, and replication proceeds with
two replication forks proceeding from an origin of replication (ori) to
the terminus in opposite directions. This process is termed bidirectional replication. It is useful to consider one-half of the
replicating chromosome at a time. This half-chromosome replicating
unit is called a replichore. The two replichores of a circular
chromosome undergo very similar processes. (Graphic computer art
by Daniel Yuen)
Introduction
A common bacteria that colonizes intestines serves as a excellent
example of a bacterium with a circular chromosome. Replication of
the Escherichia coli chromosome proceeds in stages, which can be
divided into three major headings; initiation, elongation and
termination. Bacteria initiate DNA replication at a specific site on the
chromosome, the replication origin oriC, from which replication
proceeds bidirectionally to the terminus.[1]
Initiation proceeds in a series of well defined biochemical steps, and
is the only phase of DNA replication that is known to be regulated, but
39
is regulated such that replication occurs only once in each cell
cycle.[2]
During the elongation phase of replication, two distinct but related
events occurs; that is the simultaneous synthesis of the leading and
lagging strands. Several enzymes at the replication fork are essential
to the synthesis of both strands. Parental strands are first unwound
by DNA helicases, and the resulting topological stress is relieved by
topoisomerase. Each separated strand is then stabilized by single
stranded binding proteins [SSB]. From this point synthesis of leading
and lagging strands is very different.
Eventually, the two replication forks of the circular chromosome meet
at a terminus region containing multiple copies of a 23 base pair
sequence called Ter for terminus.[3] The Ter sequences function as a
binding site for a protein called Tus (for Terminus Utilization
Substance), whereby replication halts when either replication fork
encounters a functional Tus-Ter complex.
Initiation
The E.coli bacterial replication origin, called oriC consists of 245 base
pairs bearing DNA sequences that are highly conserved among
bacterial replication origins. The chromosomal origin, functions as a
site where enzymes assemble to form the machinery that will
generate the replication fork.[4]
Image:Tobeuploaded
DNA sequence elements within oriC that are important for its function
include DnaA boxes, a 9-mer repeat with a highly conserved
consensus sequence 5' - TTATCCACA - 3' [5] , that are recognized by
the DnaA protein. DnaA protein plays a crucial role in the initiation of
chromosomal DNA replication. [6] Bound to ATP, and with the
assistance of bacterial histone-like proteins [HU] DnaA then unwinds
an AT-rich region near the left boundary of oriC, which carries three
13-mer motifs [7], and opens up the double-stranded DNA for
entrance of other replication proteins.[8]
This region also contains four “GATC” sequences that are recognized
by DNA adenine methylase (Dam), an enzyme that modifies the
40
adenine base when this sequence is unmethylated or
hemimethylated. The methylation of adenines is important as it alters
the conformation of DNA to promote strand separation[9] , and it
appears that this region of oriC has a natural tendency to unwind.[10]
DNA sequence motifs in oriC of the E. coli. The gray bars represent
GATC sequences recognized by DNA adenine methyltransferase.
Small blue arrows are 13-mer sequences near the left border of oriC
that become single-stranded when oriC is bound by DnaA in
association with ATP. The red boxes are DnaA box sequences
recognized by DnaA protein. Smaller green boxes represent I sites
bound by DnaA-ATP. The site within oriC to which integration host
factor (IHF) binds is shown between DnaA boxes R1 and R5 (M).
Dashed lines represent two regions bound by SeqA protein. (after
Jon M. Kaguni 2006).[11]
DnaA then recruits the replicative helicase, DnaB, from the DnaBDnaC complex to the unwound region to form the pre-priming
complex.[12] After DnaB translocates to the apex of each replication
fork, the helicase both unwinds the parental DNA and interacts
momentarily with primase .[13]
In order for DNA replication to continue, single stranded binding
proteins are needed to prevent the single strands of DNA from
forming secondary structures and to prevent them from re-annealing.
In addition, DNA gyrase is needed to relieve the topological stress
created by the action of DnaB helicase.
41
Processivity of the DNA pol III replication complex is assured by a
clamp. The DNA polymerase beta clamp in more detail (image).
Elongation
DNA-replication illustrated by the bacterial replication fork. The helix
unwinds and both strands replicate simultaneously, during the
unwinding process. The leading strand replicates continuously from 3'
end of existing strand, with newest end of forming strand facing into
replication fork. The lagging strand replicates by a series of fragments
(Okazaki-fragments placed end-to-end, with newest ends of
fragments facing away from fork; the Okazaki-fragments later ligated
together. During replication, DNA polymerase III proof-reads for
mismatched bases
Bacterial chromosomal replication occurs in a bidirectional manner,
and has been investigated both genetically and autoradiographically,
whereby results provide clear evidence for bidirectional replication in
E. coli. In specific experiments, E. coli cells initiating chromosome
replication after release from amino-acid starvation were incubated in
[3H]thymine of moderate specific activity, followed by incubation in
[3H] thymine plus [3H]thymidine of very high specific activity. The
grain tracks produced in autoradiographs of chromosomes were
denser on both ends than in the middle. The autoradiographic
42
patterns are, therefore, evidence that replication of the chromosome
in E. coli is bidirectional.[1]
See Figure 4 of D. M. Prescott, and P. L. Kuempel (1972): A
grain track produced by an E. coli chromosome from cells
labeled for 19 min with [3H] thymine, followed by labelingfor 2.5
min with [3H]thymine and ['H]thymidine. [1].[1]
The E. coli replicase DNA polymerase III is a 900 kD complex,
possessing a dimeric structure.Each monomeric unit has a catalytic
core, a dimerization subunit, and a processivity component .[14] DNA
Pol III uses one set of its core subunits to synthesize the leading
strand continuously, while the other set of core subunits cycles from
one Okazaki fragment to the next on the looped lagging strand.
Leading strand synthesis begins with the synthesis of a short RNA
primer at the replication origin by the enzyme Primase (DnaG
protein).

Deoxynucleotides are then added to this primer by a single DNA
polymerase III dimer, in an integrated complex with DnaB helicase.
Leading strand synthesis then proceeds continuously, while the DNA
is concurrently unwound at the replication fork. In contrast, lagging
strand synthesis is accomplished in short Okazaki fragments. First,
an RNA primer is synthesized by primase, and, like that in leading
strand synthesis, DNA Pol III binds to the RNA primer and adds
deoxyribonucleotides.
When the synthesis of an Okazaki fragment has been completed,
replication halts and the core subunits of DNA Pol III dissociates from
the β sliding clamp [B sliding clap is the processivity subunit of DNA
Pol III]. [15]The RNA primer is remove and replaced with DNA by DNA
polymerase I [which also possesses proofreading exonuclease
activity] and the remaining nick is sealed by DNA Ligase, which then
ligates these fragments to form the lagging strand.
Since replication of a circular chromosome occurs bidirectionally,
when the replication fork moves around the circle, a structure shaped
like the Greek letter theta Ө is formed. John Cairns provided a welldesigned demonstration of E. coli chromosomal replication in 1963. In
his experiment, he radioactively labeled the chromosome by growing
his cultures in a medium containing 3H-thymidine. The nucleoside
43
base was incorporated uniformly into the bacterial chromosome. He
then isolated the chromosomes by lysing the cells gently and placed
them on an electron micrograph (EM) grid which he exposed to X-ray
film for two months. This Experiment clearly demonstrates the theta
replication model of circular bacterial chromosomes.[16]

See Autoradiograph of intact replicating chromosome of E.coli
[2][17]
Termination
Replication termination of prokaryotic occurs at specific sequences
called replication termini.[18] In E.coli, there are 10 replication termini
(Ter) located in a region opposite to the replication origin (Fig 5).The
Ter sites have polarity, that is, they arrest replication forks, when they
are present in one orientation with respect to ori, but allow forks to
pass through unrestricted in the opposite orientation. The
arrangement of the Ter sites forms a replication trap that forces the
two forks, initiated at oriC, to meet each other within a well-defined
region of the chromosome.[19]
See locations and sequences of the replication termini of E.
coli.(A) Map showing the ori and the 10 Ter sites. (B) The
consensus sequence of Ter. [3][20]
The Ter sites specifically interact with the replication terminator
protein called Tus, which is a polar contra-helicase, that is, it impedes
the DNA unwinding activity of DnaB in an orientation-dependent
manner.[21] The crystal structure of the Tus-Ter complex has been
solved, and it reveals a protein that has structural asymmetry and has
a DNA-binding domain, consisting of a series of β-strands, that
invade the major groove of Ter DNA. The crystal structure was
originally interpreted to account for replication fork arrest, solely on
the basis of Tus-Ter, protein-DNA interaction, that allegedly was
strong enough to form a nonspecific barrier, not only to DnaB
helicase-catalyzed DNA unwinding, but in principle, to any protein
that would unwind DNA .[22] When either replication fork encounters a
functional Tus-Ter complex, it halts replication.

44

The crystal structure of the Ter DNA-Tus protein complex (A)
showing the nonblocking and the fork-blocking faces of Tus. (B)
A cross-sectional view of the helicase-arresting surface.[4][23]
Topoisomerase activities illustrated with on covalently closed circular
DNA. Topisomerase enzymes are able to form supercoils in DNA,
and interconvert covalentely closed circular DNA and their catenated
forms.
Replication of the DNA separating the opposing replication forks,
leaves the completed chromosomes joined as ‘catenanes’ or
topologically interlinked circles. The circles are not covalently linked,
but cannot be separated because they are interwound and each is
covalently closed. The catenated circles require the action of
45
topoisomerases to separate the circles [decatanation]. In E.coli, DNA
topoisomerase IV plays the major role in the separation of the
catenated chromosomes, transiently breaking both DNA strands of
one chromosome and allowing the other chromosome to pass
through the break.[24]
There has been some confusion about the role DNA gyrase plays in
decatenation. To define the nomenclature, there are two types of
topoisomerases: type I produces transient single-strand breaks in
DNA and types II produces transient double-strand breaks. As a
result, the type I enzyme removes supercoils from DNA one at a time,
whereas the type II enzyme removes supercoils two at a time. The
topo I of both prokaryotes and eukaryotes are the type I
topoisomerase. The eukaryotic topo II, bacterial gyrase, and bacterial
topo IV belong to the type II.
We often forget that DNA gyrase does in fact have topoisomerase
type II activity; thus, with it being a homologue of topoisomerase IV
(also having topoisomerase II activity) we expect similarity in the two
proteins' functions. DNA gyrase preliminary role is to introduce
negative super coils into DNA, thereby relaxing positive supercoils
that come into play during DNA replication. Topoisomerase IV also
relaxes positive supercoils, therefore, DNA Gyrase and
topoisomerase IV play an almost identical role in removing the
positive supercoils ahead of a translocating DNA polymerase,
allowing DNA replication to continue unhindered by topological strain.
[25]
Confusion arises when some scientific literature state that DNA
gyrase is the sole enzyme responsible for decatanation. In an
experiment conducted by Zechiedrich,Khodursky and Cozzarelli in
1997, it was found that topoisomerase IV is the only important
decatenase of DNA replication intermediates in bacteria.[26] In this
particular experiment, when DNA gyrase alone were inhibited, most
of the catenanes were unlinked. However, when Topoisomerase IV
alone was inhibited, decatenation was almost completely blocked.
The results obtained suggest that Topoisomerase IV is the primary
decatenase in vivo, and although DNA gyrase does play a role in
46
decatenation, its function is not as essential as topoisomerase IV in
the decatentation of interlinked chromosomes.
Conclusion
Replication of circular chromosomal DNA. Partially replicated DNA
forms a theta structure due to bidirectional replication.
It is now known that not all bacteria have a single circular
chromosome; in fact, some bacteria have multiple circular
chromosomes, and many bacteria have linear chromosomes and
linear plasmids. However, in bacterial cells which contain a single
circular chromosome, such as E.coli, studies have shown DNA
replication to occur at specific sequences called the Origin, and
proceed bidirectionally in which the partially replicated chromosome
forms a theta like structure. Replication continues until the replication
fork encounters a functional Tus-Ter complex, which functions as a
molecular trap to halt further replication of the molecule. With the
assistance of topoisomerase IV in E.coli, the two catenanted circles
are then separated forming two double stranded, circular
chromosomes.
Summary
Although it is now well established that not all prokaryotic chromosomes
exist as a single circular molecule of DNA as previously thought, it still
holds true that in most bacterial cells, the chromosome replicates as a
circular structure. The synthesis of a DNA molecule can be divided into
three stages: initiation, elongation and termination, distinguished by the
reactions taking place, and the enzymes involved. In bacterial cells with
circular chromosomes, synthesis occurs at the replication fork, the place at
which the DNA helix is unwound from the origin until they have copied the
47
whole replicon. When the replication fork moves around the circle, it occurs
bidirectionally, and as a result, a structure shaped like the Greek letter theta
Ө is formed. Finally since the bacterial chromosome is a single replicon, the
fork meets on the other side and two complete double-stranded circular
DNA molecules are formed. In this review, we will be focusing on the
replication of circular bacterial chromosomes, and we will use a model
prokaryote, namely the common gut bacterium Escherichia coli, to
demonstrate how circular DNA molecules in prokaryotic organisms are
replicated.
Acknowledgments
This is based on an article by Imalda Devaparanam and David Tribe
made available under CC by SA licensing conditions from a
University course activity at the Department of Microbiology and
Immunology, University of Melbourne, 2007.
48
Mechanisms of Telomere Replication
PI: PRICE, CAROLYN M.
Abstract: Telomeric DNA is packed into a protective complex that
acts as a cap over the chromosome end. This cap is essential for
preventing chromosome fusions and hence the chromosomal
rearrangements that result in cancer. The telomeric cap is a dynamic
structure that balances the need to protect the DNA terminus from the
DNA repair machinery with the need to allow access to telomerase
and other replication enzymes. The architecture of the cap is still
unclear, but it seems to be composed of a number of molecular
interactions that include DNA-protein or protein-protein interactions
with the single-strand overhang on the DNA terminus, the telomeric
tract, and subtelomeric sequences. This proposal focuses on the
single-strand overhang and its associated proteins because it is a
particularly critical component of the cap. The proposal has two main
goals: to define the architecture of the telomeric cap by ascertaining
how factors that associate with or modulate overhang structure
promote cap formation, and to determine how the DNA terminus is
processed to generate the precise overhang structure that is required to
form a functional cap. The specific aims are as follows: 1. To
characterize the telomeric DNA structure generated by leading-strand
synthesis in Tetrahymena. This aim tests current models for telomere
replication and will establish the structures from which G-overhangs
are generated. 2. To investigate the role of telomerase and repair
proteins in telomere capping and G-overhang generation and
maintenance. This will be achieved by deleting or mutating TERT,
Ku70 or Rad51 and determining the effect on overhang structure and
cap architecture. 3. To delineate the role of the Tetrahymena Goverhang binding protein in telomere capping and determine whether
this protein specifies the boundaries for overhang processing. The
Tetrahymena Pot1 homolog (tPot1) will be identified and the effect of
tPot1 deletion or mutagenesis on capping and overhang processing
will be determined. 4. To characterize the nucleases responsible for Gand C-strand cleavage. In vivo and in vitro processing assays will be
developed with artificial telomere substrates. The proposed studies
will give a much deeper understanding of the DNA processing
49
reactions that lead to assembly of the terminal DNA-protein complex,
the architecture of this telomeric cap, and its role in chromosome
protection and stabilization.
Termination of replication
Because bacteria have circular chromosomes, termination of replication
occurs when the two replication forks meet each other on the opposite end of
the parental chromosome. E coli regulate this process through the use of
termination sequences which, when bound by the Tus protein, enable only
one direction of replication fork to pass through. As a result, the replication
forks are constrained to always meet within the termination region of the
chromosome.[15]
Eukaryotes initiate DNA replication at multiple points in the chromosome,
so replication forks meet and terminate at many points in the chromosome;
these are not known to be regulated in any particular manner. Because
eukaryotes have linear chromosomes, DNA replication often fails to
synthesize to the very end of the chromosomes (telomeres), resulting in
telomere shortening. This is a normal process in somatic cells — cells are
only able to divide a certain number of times before the DNA loss prevents
further division. (This is known as the Hayflick limit.) Within the germ cell
line, which passes DNA to the next generation, the enzyme telomerase
extends the repetitive sequences of the telomere region to prevent
degradation. Telomerase can become mistakenly active in somatic cells,
sometimes leading to cancer formation
50
Telomere shortening
Lagging strand during DNA replication
"Telomeres" shorten partly (see below) because of the end replication
problem that is exhibited during DNA replication in eukaryotes only.
Because DNA replication does not begin at either end of the DNA strand,
but starts in the center, and considering that all DNA polymerases that have
been discovered move in the 5' to 3' direction, one finds a leading and a
lagging strand on the DNA molecule being replicated.
On the leading strand, DNA polymerase can make a complementary DNA
strand without any difficulty because it goes from 5' to 3'. However, there is
a problem going in the other direction on the lagging strand. To counter this,
short sequences of RNA acting as primers attach to the lagging strand a little
way ahead of where the initiation site was. The DNA polymerase can start
replication at that point and go to the end of the initiation site. This causes
the formation of Okazaki fragments. More RNA primers attach further on
the DNA strand and DNA polymerase comes along and continues to make a
new DNA strand.
Eventually, the last RNA primer attaches, and DNA polymerase, RNA
nuclease and DNA ligase come along to convert the RNA (of the primers) to
DNA, and seal the gaps in between the Okazaki fragments. But in order to
change RNA to DNA, there must be another DNA strand in front of the
RNA primer. This happens at all the sites of the lagging strand, but it doesn't
happen at the end where the last RNA primer is attached. Ultimately, that
RNA is destroyed by enzymes that degrade RNA left on the DNA. Thus, a
51
section of telomeres is lost during each cycle of replication at the 5' end of
lagging strand.
However, in vitro studies (von Zglinicki et al. 1995, 2000) have shown that
telomeres are highly susceptible to oxidative stress. Telomere shortening due
to free radicals explains the difference between the estimated loss per
division because of the end-replication problem (ca. 20 bp) and actual
telomere shortening rates (50-100 bp), and has a greater absolute impact on
telomere length than shortening caused by the end-replication problem
52
Origins of Replication
Although the semiconservative nature of DNA replication had been
confirmed, many questions about replication remained. One of these
questions was: is replication initiated at a specific site on the chromosome,
or is it initiated at random sites, or even multiple sites?
The answer to this question depends somewhat on the organism being
considered. Bacteria, for example, have a single specific origin of
replication; in other words, bacterial replication begins at the same spot on
the chromosome every time. In E. coli, this site is called OriC. OriC is a 9
base-pair (bp) sequence that is repeated four times within the region.
Eukaryotes also have specific sites at which replication is originated.
However, because eukaryotic cells contain much more DNA than bacteria
(humans have approximately 1500 times as much DNA as E.coli), there
must be multiple origins of replication on each chromosome in order to
replicate all of the DNA in a timely fashion. The amount of DNA replicated
from a single origin is called a replicon.
Other research has revealed that DNA replication proceeds bidirectionally
from an origin of replication. This means that replication proceeds in
opposite directions away from the origin:
Note in the diagram how each original DNA molecule branches, or forks, at
the point where replication is occurring. These branch points are called
replication forks. Because replication is bi-directional, two replication forks
form at each origin of replication. (Some rare examples have been seen
where replication is unidirectional from the origin.) The open area of the
chromosome between the replication forks is called a replication bubble.
53
DNA Polymerase I
DNA replication is catalyzed by a family of enzymes called DNA
polymerases. The first of these enzymes to be discovered, DNA polymerase
I, was isolated from bacteria (specifically, E. coli). Characterization of the
activity of this enzyme in vitro revealed that it had certain requirements for
activity. It needed 5'-triphosphate forms of the four nucleotides, and it
required the presence of preexisting DNA. The DNA serves two purposes:
1) it serves as a template for the synthesis of the new DNA (the template
determines the sequence of the new DNA strand, through the specificity of
base pairing), and 2) it serves as a primer for DNA synthesis. It turns out that
DNA polymerase I cannot initiate DNA synthesis without having a free 3'OH to add a new nucleotide to. DNA synthesis therefore needs a primer, a
preexisting piece of nucleic acid to serve as an initiator of DNA synthesis.
DNA polymerase I synthesizes DNA by forming a bond between the 5'
phosphate of the incoming nucleotide (the other two phosphate groups from
the nucleotide triphosphate are lost) and the 3' OH group of the nucleotide at
the end of the growing DNA chain. If you draw this out for yourselves,
you'll realize that this means the DNA chain being synthesized grows in a 5'
to 3' direction. This is an important rule to remember: DNA polymerase
synthesizes DNA only in a 5' to 3' direction.
In addition to its polymerase activity, DNA polymerase I has two other
enzymatic activities, both of which are exonuclease activities. Exonucleases
are enzymes that digest DNA (cleave phosphodiester bonds), chewing away
at nucleotides from the end of the DNA chain. DNA polymerase I has 3' to
5' exonuclease activity, which degrades DNA in a direction opposite to that
of synthesis. This provides the enzyme with a proofreading function: if a
wrong nucleotide gets inserted into a growing chain, the enzyme can digest
it out with the 3' to 5' exonuclease activity (almost like using the delete key
while word processing), and insert the correct nucleotide.
DNA polymerase I also has a 5' to 3' exonuclease activity, which degrades
nucleic acids in the same direction as synthesis. As we'll see, this activity is
used to remove primers during DNA replication.
Multiple Polymerases
DNA polymerase I, it turns out, is not the main enzyme involved in
replicating the bacterial chromosome. When the gene encoding the enzyme
54
was mutated in E. coli, the bacteria were still able to replicate their
chromosomes. They were, however, deficient in DNA repair. This suggested
that DNA polymerase I is primarily involved in DNA repair (although it
does play a role in replication, as we will see), and that another yet-to-bediscovered enzyme would be responsible for replication.
Eventually, two other DNA polymerases were identified, and named DNA
polymerases II and III. These both had 5' to 3' polymerase activity like DNA
polymerase I, and 3' to 5' exonuclease activity. Neither of these enzymes had
the 5' to 3' exonuclease activity found in DNA polymerase I. The various
enzyme activities of the different polymerases are summarized in the table
below.
Enzyme
Activity
DNA Polymerase DNA Polymerase DNA Polymerase
I
II
III
5' to 3'
polymerase
Yes
Yes
Yes
3' to 5'
exonuclease
Yes
Yes
Yes
5' to 3'
exonuclease
Yes
No
No
DNA polymerase III turns out to be the main enzyme involved in DNA
replication. DNA polymerase II is a minor enzyme involved in DNA repair.
DNA polymerase I is the main polymerase involved in DNA repair, and
plays a specialized role in DNA replication, using its 5' to 3' exonuclease
activity.
The Mechanism of Prokaryotic DNA Replication
As mentioned above, DNA replication in E. coli begins at OriC. It starts
when the polypeptide products of the dnaA gene bind to the origin. These
polypeptides cause localized strand separation. This allows a complex of the
protein products of the dnaB and dnaC genes to bind. This complex acts as a
helicase, which functions to unwind the DNA further. This unwinding
produces the two replication forks. The unwound single-stranded region is
kept single stranded through the action of single-strand binding proteins.
There are other proteins that are found at the replication forks at this time,
but their function is not well understood, so they will not be addressed.
55
At this point, a primer is needed so that DNA polymerase III can begin to
act. As mentioned earlier, DNA synthesis needs a primer, so how is a primer
produced? An enzyme called primase serves this purpose, by synthesizing a
short stretch of RNA (generally from 5 to 15 nucleotides in length). RNA
synthesis does not require a primer, so primase (which is a type of enzyme
called an RNA polymerase) is able to synthesize a short primer where
needed. Once this primer is made, DNA synthesis can begin, extending the
polynucleotide chain originating with the RNA primer. Priming and
synthesis occurs on both strands in the helicase complex moves along the
parental DNA, shifting the replication fork, and allowing synthesis to
continue.
This leads to another problem that has to be
solved. As more DNA unwinds, and the
replication fork moves along, synthesis of one
strand (the lower strand in the diagram) can just
continue, following the movement of the
replication fork. The other strand being
synthesized, however, cannot do this. As the
replication fork moves along, it leaves a gap
behind, as shown in panel B of the figure. To
compensate for this, a second RNA primer must
be synthesized a bit behind the first one, and
DNA synthesized until it reaches the first primer
(this is shown in panel C). You can easily
imagine that as the replication fork progresses a
bit further, this process will have to be repeated.
Therefore, at each replication fork, the synthesis
of one new DNA strand (the lower one in the
figure) is continuous, while synthesis of the
other strand must be accomplished in small
increments, short stretch after short stretch; this
type of synthesis is termed discontinuous. The strand of DNA that is
synthesized continuously is called the leading strand, and the strand that is
synthesized discontinuously is called the lagging strand. The small
fragments of DNA making up the lagging strand are named Okazaki
fragments, after the researcher who discovered them. Okazaki fragments are
typically about 1000 to 2000 nucleotides each.
56
Discontinuous replication solves one problem
but still leaves one matter unsettled: the
lagging strand will be composed of individual,
unjoined fragments of DNA and RNA. This is
where DNA polymerase I comes into play.
DNA polymerase I uses its 5' to 3' exonuclease
activity to digest away the primer RNA, and
replaces the primer with DNA by extending
the strand from the adjacent Okazaki fragment. At this point all that is left to
be done is to physically join the Okazaki fragments. This is accomplished by
an enzyme known as DNA ligase. DNA ligase is able to join the 5' end of
one DNA strand to the 3' end of another DNA strand.
Eukaryotic DNA Replication
Synthesis of DNA in eukaryotes is less well understood, but the process
appears to be basically the same as in prokaryotes, with a few notable
exceptions. For one thing, eukaryotic DNA is complexed with histones to
form chromatin. Every round of replication, therefore, requires that the
histones be removed, then replaced after replication is complete. This
requirement understandably slows the whole replication process down.
Eukaryotic cells are also much more complex than prokaryotes, because they
contain organelles such as mitochondria and chloroplasts (in plants) that
contain their own DNA, which must also be replicated. Eukaryotic cells
therefore have more than three DNA polymerases; there have been five
DNA polymerases identified so far.
Eukaryotes have another difference: eukaryotic chromosomes are linear,
rather than circular as in prokaryotes.
DNA Replication: Summary of Key Points



DNA replication is semiconservative, with each existing strand
serving as a template for the synthesis of a new strand.
Replication begins at specific locations called origins of replication.
Replication requires a primer , and proceeds bidirectionally from the
point of origin, creating an expanding replication bubble.
On one strand (the leading strand), synthesis is continuous; on the
other strand (the lagging strand) synthesis is discontinuous, producing
a series of Okazaki fragments that must be ligated together.
57
Replication fork
From Wikipedia, the free encyclopedia
Jump to: navigation, search
Scheme
of
the
replication
fork.
a: template, b: leading strand, c: lagging strand, d: replication fork, e: primer,
f: Okazaki fragments
The replication fork is a structure that forms within the nucleus during
DNA replication. It is created by helicases, which break the hydrogen bonds
holding the two DNA strands together. The resulting structure has two
branching "prongs", each one made up of a single strand of DNA, that are
called the leading and lagging strands. DNA polymerase creates new
partners for the two strands by adding nucleotides.
Leading strand
DNA replication
The leading strand is the DNA strand at the opposite side of the replication
fork from the lagging strand. It goes from a 5' to 3' direction, because DNA
Polymerase can only synthesize a new DNA strand in a 5' to 3' manner. On
58
the leading strand, DNA polymerase III (DNA Pol III) "reads" the DNA and
adds nucleotides to it continuously.
Lagging strand
The lagging strand is the DNA strand opposite the replication fork from the
leading strand. It goes from a 3' to 5'.
When replicating, the original DNA splits in two, forming two "prongs"
which resemble a fork (i.e. the "replication fork"). DNA has a ladder-like
structure; imagine a ladder broken in half vertically, along the steps. Each
half of the ladder now requires a new half to match it.
Pol III, the main DNA replication enzyme, cannot work in the 3' to 5'
direction of the template strand, and so replication of the lagging strand is
more complicated than of the leading strand.
On the lagging strand, primase "reads" the DNA and adds RNA to it in
short, separated segments. DNA polymerase III lengthens the primed
segments, forming Okazaki fragments. DNA polymerase I then "reads" the
fragments, removes the RNA using its flap endonuclease domain, and
replaces the RNA nucleotides with DNA nucleotides (this is necessary
because RNA and DNA use slightly different kinds of nucleotides). DNA
ligase joins thLog in / create account
How to Extract DNA From Fruits
CONTENTS
INTRODUCTION
PROCEDURE
Summary of the procedure
Preliminary operations
Preparation of the extracting solution
Preparation of the mush
Extracting the DNA
Filtration
Removing the proteins
Precipitating the DNA
Observation through the microscope
CONCLUSION
59
REFERENCES
Figure 1: Test tube with DNA extract
INTRODUCTION
In recent years, it is not uncommon to read articles on DNA in both scientific and popular
magazines. DNA is regularly mentioned in the news and is often featured in TV detective
or crime-scene investigation dramas. DNA, also known as DeoxyriboNucleic Acid, is a
long molecule that holds the genetic information for all living beings, be it vegetable,
animal or a simple microorganisms. It is capable of copying itself and can synthesize
RNA (RiboNucleic Acid). In more evolved or complex forms of life, DNA is contained
in the nucleus of the cells. Except for the red blood cells of mammalians, which are
devoid of a nuclei, all cells of a living being have their own DNA. The cells of an
organism use certain parts of the DNA molecule, or genes, to produce the proteins they
need to function. For a more detailed description of DNA including its structure, its
60
functions and the mechanism by which proteins are produced, the reader should consult
the texts listed [1] the Reference section of this paper, which are well written and contain
excellent illustrations. In this article, I describe a simple experiment that will allow you to
extract a bit of DNA from a banana, however, you can also try it using other fruits and
even vegetables. It is an experiment that can be performed both at home and in a school
laboratory.
PROCEDURE
SUMMARY OF THE PROCEDURE
The procedure described below exploits the fact that the external membrane of cells and
that of their nuclei are composed of fatty substances that can be broken down using a
simple detergent. The first operation in this procedure is to break-up the fruit into a pulp
or mush so that the cells are separated each from other as much as possible thereby
exposing them to the action of the detergent. Secondly, the detergent is added to the pulp
of the fruit so as to release the DNA from the cell membranes, which encapsulate it.
Thirdly, it is necessary to filter the mixture to separate the nucleic acid from the remains
of the cellular membranes. Finally, the DNA is precipitated in alcohol where it becomes
visible. The DNA you obtain using this procedure can be observed with a microscope and
can be used for other experiments like electrophoresis or other experiments.
PRELIMINARY OPERATIONS
MATERIALS
- pot;
- thermometer;
- plastic salad bowl;
- ice cubes;
- 50 cc of 70 - 95 % 70-95% isopropyl or denatured alcohol (ethanol) in a closed bottle;
- rags and absorbent paper tissues.
METHOD
- The day before the experiment, prepare some ice cubes;
- at least 2 hours before, place in a freezer a sealed vapor-tight plastic bottle with 50 cc of
70-95% isopropyl or ethyl denatured alcohol. This container must to be closed tightly to
prevent alcohol vapors from being released since they are flammable;
- 15 minutes before starting the procedure, warm a pot of tap water to 60°C;
61
Figure 2 - Before starting the experiment, it is important
to perform the preliminary operations described here .
PREPARATION OF THE EXTRACTION SOLUTION
As mentioned previously, the DNA is held inside the nucleus of the cells of the fruit we
are using. To free the DNA, it will be necessary to breakdown the membranes of the cells
as well as those of the nuclei. As these membranes are made up of phospholipids, which
are molecules rich in fats, we will dissolve them by using a simple household detergent.
We will also use a little table salt, which helps to eliminate the proteins, called histones,
on which the DNA is wrapped.
MATERIALS
- 100 cc of distilled water but tap water can also be used ;
- a scale to weigh few grams (if possible);
- 3 g of table salt (a half teaspoon);
- 10 cc of liquid detergent;
- a 10 cc syringe without needle;
- a 100 cc beaker;
- a glass rod.
METHOD
- Pour 3 g of salt and 80 cc of distilled water in a 100 cc beaker;
- mix until the salt is completely dissolved;
- with the syringe, take 10 cc of liquid detergent and add it to the solution;
- add distilled water until you obtain a total volume of 100 cc;
- while avoiding to produce bubbles, mix to homogenize the solution;
- the extracting solution is ready.
62
Figure 3 - Preparation of the extracting solution (Distilled
water, table salt, detergent, syringe, 100 cc beaker and spoon).
PREPARATION OF THE PULP
This operation serves to separate the cells from each other and to better expose them to
the action of the extraction solution.
MATERIALS
- 100 g of banana (or: kiwi, apple, pear, kaki, peas, onion, etc.);
- balance;
- knife;
- chopping board and fork;
- 250 cc beaker;
- a teaspoon.
METHOD
- Place 100 g of banana (without peel) on a chopping board and crush it with a fork until
you obtain a pulp. If you use an onion, with a knife obtain cubes of about 5 mm of side or
less. You can also use a mortar or a blender. If so, do not shred the pulp too much;
- pour the mush in a 250 cc beaker.
63
Figure 4 - Preparation of the fruit pulp
EXTRACTING THE DNA
The aim of this operation is to breakdown the membranes of the cells and their nuclei to
free the DNA. The pulp will heated to 60°C to speed up and help the process of breaking
down the membrane walls. Heating the pulp also helps to deactivate certain enzymes like
DNase that can degrade the DNA. However, if the pulp is held at an elevated temperatures
for too long a time the DNA may begin to fragment du to the heat exposure. For this reason
it is advised to cool the pulp after approximately 15 minutes in a bath of chilled water.
Figure 5 - Pour the extraction solution in the pulp and mix.
64
Figure 6 - The pulp should be kept at 60°C for no more than
15 minutes and then chilled to about 0°C for 5 minutes
MATERIALS
- thermometer;
- pot with water at 60°C;
- salad bowl with tap water and ice cubes.
METHOD
- Pour the extracting solution on the mush;
- place the beaker in a bain-marie in the pot with water at 60°C;
- mix the mush so to distribute the extracting solution and to make the temperature
uniform;
- after 15 minutes, place the beaker in a bain-marie in the water with ice cubes;
- mix the mush to make the temperature uniform;
- after 5 minutes, remove the beaker from the cold water and prepare yourself for the
filtration
How to Extract DNA From Fruits
G. Carboni, January 2007
Text editing by Donald Desaulniers, Ph.D.
65
66
.
.
.
67
FILTRATION
The filtration process is used to collect the liquid rich in DNA
and to separate it from the cellular remnants and the other tissues
of the fruit, which will be discarded.
MATERIALS
- sieve with a diameter of about 12 cm;
- coffee filter paper (laboratory filter is too much thick). Kitchen
absorbent tissue paper can also be used, provided that it does not
have any visible holes;
- bowl.
METHOD
- place the sieve on the bowl;
- take a filter paper, soak it and place it in the sieve;
Figure 7 - Filtering the pulp using a sieve, filter - pour a little pulp on the filter, taking care that is goes through
paper and a bowl.
the filter paper ;
- mix with care to help the filtration and avoid ripping the filter
paper;
- the filtered liquid you will obtain is rich in DNA.
REMOVING THE PROTEINS (optional)
With this additional operation it is possible to obtain a purer DNA extract, but it it is not essential if you want to
observe the DNA. Because DNA is wrapped on proteins called histones is will be necessary to remove these
proteins to obtain a DNA extract of higher purity. To remove these histones, you can use proteolytic enzymes like
Protease. While you can purchase protease in a shop that sells chemical products, you can also substitute it with a
substance that is much easier to find; it is found in the juice of the pineapple which that contains Bromelain, a
substance able to breakdown proteins into the amino acids of which they are composed.
68
Figure 8 - Obtaining the pineapple juice.
Figure 9 - In a tube, pour 5 cc of filtrate and 1 cc of
pineapple juice.
MATERIALS
- Proteolytic enzyme (ex: Protease or pineapple juice);
- a 5 cc syringe without needle.
METHOD
- In a tube, pour 5 cc of the filtered solution;
- add 1 cc of pineapple juice and mix;
- wait 2 - 3 minutes to let to the bromelain react.
PRECIPITATING THE DNA
DNA is quite soluble in water and invisible, while it is insoluble in alcohol wherein it precipitates and becomes
visible. By adding alcohol to the DNA filtrate solution in the tube, the DNA is rendered visible.
69
Figure 11 - Tube with DNA of the banana mixed with a
numerous tiny air
Figure 10 - Very slowly, pour some ice cold alcohol into bubbles freed from the alcohol which is warming up. In
the tube and avoid mixing the alcohol with the filtrate.
Figure 1, there
are less bubbles and the DNA is observed as a milky
substance.
MATERIALS
- Some tubes for the possible repetition of the operation;
- tubes holder;
- icy alcohol (kept in a freezer).
METHOD
- Slowly, pour in the tube of the previous step some icy alcohol by avoiding it mix with the filtrate;
- the volume of the alcohol has to be about the same of that of the solution;
- let the tube rest for 5 minutes to allow to the DNA to precipitate and accumulate in the tube.
Now, at the interface between alcohol and the filtrate you should be able to see a milky substance, which tends to
increase in volume as time progresses. This milky substance is the DNA of the banana. Unfortunately, inside this
milky little mass, you may observe numerous tiny bubbles. The presence of these bubbles is due to the property
that the solubility of gases in a cold liquid is higher than in a warm one. While alcohol was in the freezer it likely
absorbed some gases that are expelled as the liquid is warmed up.
70
OBSERVATION THROUGH THE MICROSCOPE
(optional)
MATERIALS
- some clean microscope slides;
- hook made with a long metal wire;
- dye to stain the nucleus (ex: Toluidine, Methylene Blue, AcetoOrcein);
- dropper;
- microscope.
METHOD
- with a long metal wire ending with a hook, extract a sample of DNA
from the tube and place it on a clean microscope slide;
- level the mass on the slide and stain it with a nuclear dye;
- if necessary, add a little water and mount the coverslip.
Figure 12 - Sample of banana DNA at
By observing this preparation under the microscope, do not expect to
about 100 X
see the well-known double helix ladder structure of the DNA. You
(stained with a 1% solution of Toluidine).
cannot see it even with an electronic microscope. What you will see
are clumps or flocks of DNA material which look like a tangled mass
of protein strands as illustrated Figure 12.
CONCLUSION
This experiment was not so difficult to carry out after all, was it not?. The aim of this simple experiment was to
provide you with an introduction to the procedures that are used in molecular biology. Often, the techniques used
in modern microbiology laboratories are based on simple operations like this one. In other cases the procedures
can be quite complex and may involve more sophisticated manipulations and equipment. In all cases a sound
knowledge of biology and chemistry is essential to understanding how DNA is used in the fields of life sciences
and health sciences. If this experiment has sparked an interest in pursuing future explorations, remember that
resources available through the Internet you can lead you to new areas of discovery. If you would like to learn
more, look at the document [2] in the References section of this paper. The extraction of the DNA is the first step
of many other fascinating experiments.
BIBLIOGRAPHY
1 - Helena Curtis, N. Sue Barnes; "Biology"; Worth Publishers, Inc., New York; A biology text for high schools.
2 - http://www.funsci.com/texts/wsites_en.htm Look for the term: "SAPS". You will find the directions to made
other interesting and fun experiments in biology.
Internet keywords: dna extraction, dna proteins amino acids ribosome.
71
‫‪357‬نبت‪ :‬مبادئ الوراثة الجزيئية ‪)1+1(2‬‬
‫التركيب البنائي للــ ‪ DAN‬و الــ ‪ RNA‬التكاثر‬
‫الذاتي للـــ ‪ DNA‬؟ الشفرة الوراثية‪ ،‬نسخ‬
‫وترجمة المادة الوراثية ‪ DNA‬والوحدات الوراثية‪،‬‬
‫توازن تركيب الجينات والسالسل الببتيدية‪،‬‬
‫وظائف البناء المتشابه والبناء المختلف للــ ‪DNA‬‬
‫؟ إعادة تنظيم المادة الوراثية في البكتيريا‪،‬‬
‫البالزميدات واألبيسومات والـ ‪ DNA‬؟ تعديل‬
‫التعبير عن الجينات‪.‬‬
‫تبرع اآلن »‬
‫علم األحياء الجزيئ‬
‫يقوم علم األحياء الجزيئي أو البيولوجيا الجزيئية (باإلنجليزية‪ )Molecular biology :‬بدراسة‬
‫األحياء على المستوى الجزيئي ‪ ،‬لذلك فهو يتداخل مع كال من علم األحياء و الكيمياء في عدة فروع‬
‫و يتقاطع مع الكيمياء الحيوية و علم الوراثة في عدة مناطق و تخصصات ‪ .‬تهتم البيولوجيا‬
‫الجزيئية بدراسة مختلف العالقات المتبادلة بين كافة األنظمة الخلوية و بخاصة العالقات بين الدنا و‬
‫الرنا و عملية االصطناع البروتيني إضافة إلى آليات تنظيم هذه العملية و كافة العمليات الحيوية ‪.‬‬
‫يصف وليم أستبوري علم االحياء الجزيئي في مقالة له في مجلة نيتشر ‪:‬‬
‫" ‪ ...‬بأنه ليس تقنية بل هو مقاربة‪ ،‬مقاربة من وجهة نظر ما يدعى بالعلوم األساسية مع‬
‫فكرة موجهة للبحث ضمن الحقائق و الخطوط العريضة لعلم األحياء عن خطة جزيئية‬
‫موافقة ‪ .‬إنه علم يهتم أساسا بأشكال الجزيئات الحيوية و ‪ ...‬بشكل أكثر تحديدا على البنى‬
‫الثالثية األبعاد و التشكيالت البنيوية بحيث ال تقتصر فقط على الدراسة الشكلية‬
‫‪ morphology‬بل تتعداها لتدرس التشكل ‪ genesis‬و الوظيفة ‪" .‬‬
‫[عدل] العالقة بعلوم األحياء األخرى على المستوى الجزيئي‬
‫رسم توضيحي للعالقة لبن الكيمياء الحيوية‪ ،‬وعلم الوراثة‪ ،‬وعلم األحياء الجزيئي‪.‬‬
‫الباحثون في األحياء الجزيئية استخدموا تقنيات محددة منشؤها علم األحياء الجزيئي‪ ,‬ولكن مع تزايد‬
‫الجمع بين هذه األفكار من تقنيات و علم الوراثه وعلم الكيمياء الحيويه و الفيزياء الحيويه مع انه‬
‫‪72‬‬
‫ليس هناك ترابط بين هذه المجاالت كما كان من قبل‪ .‬الشكل التالي يمثل مخطط عالقه بين بعض‬
‫تلك المجاالت‬
‫‪‬‬
‫‪‬‬
‫الكيمياء الحيوية‪ :‬هي دراسة المواد الكيميائية والعمليات الحيوية اللذان يحدثان في الكائنات‬
‫الحيَّة‪.‬‬
‫تأثير اإلختالفات الوراثي ِة على الكائنات الحية‪.‬‬
‫علم الوراثة‪ :‬هو دراسة‬
‫ِ‬
‫مكون طبيعي (ومثال على ذلك‪ - :‬جين واحد)‪.‬‬
‫كثيرا ما يمكننا هذا من االستدالل علي غيا ِ‬
‫ب ّ‬
‫دراسه "المسوخ" الكائنات التي تفتقر الي واحد او أكثر من العناصر الفنية فيما يتعلق بما يسمي "‬
‫البري ِ " أَو نمط ظاهري طبيعي‪ .‬التفاعالت الوراثية مثل ‪ epistasis‬يمكن أَن تفند‬
‫بالنوعِ ّ‬
‫تفسيرات بسيطة في أغلب األحيان مثل هذه الدراسات "القاضية"‪.‬‬
‫‪‬‬
‫علم األحياء الجزيئي ‪ :‬دراسه االسس الجزيئيه من عمليه النسخ واالستنساخ والترجمه‬
‫الجينيه‪ .‬العقيدة المركزية ل ِع ْل ِم األحياء الجزيئي ِ حيث َّ‬
‫أن مادّة وراثية نُ ِس ْ‬
‫خت إلى آر إن أي‬
‫البروتين‪ ،‬على الرغم ِم ْن ْ‬
‫ْ‬
‫أن هناكَ صورة َ ُمبَالَغة في تبسيط علم‬
‫ترجمت إلى‬
‫وبعد ذلك‬
‫ِ‬
‫األحياء الجزيئي ‪ ،‬وال يزال يوفر نقطه انطالق جيده لفهم الميدان‪ .‬بيد ان هذه الصوره‬
‫يجري تنقيحها في ضوء االدوار الجديده الناشئه للرنا ‪.‬‬
‫ُمعظم العم ِل في علم األحياء الجزيئي كمي ‪ ،‬تم انجاز الكثير من العمل المشترك في البيولوجيا‬
‫الجزيئيه وعلوم الحاسوب والمعلوماتية الحيوية وعلم األحياء الحسابي ‪ .‬اعتبارا من مطلع العشرين‬
‫األبرز لعلم األحياء الجزيئي‪.‬‬
‫ِ‬
‫‪ ،‬ودراسه بنية الجينات وعلم الوراثه الجزيئية كان الحق ِل الثانوي ِ‬
‫لعلم األحياء على الجزيئات ‪ ،‬إما دراسة مباشرة‬
‫تركز على نحو متزايد العديد من الحق ِل األخرى ِ‬
‫َ‬
‫وعلم األحياء التطوري ِ ‪ ،‬أو بشكل غير‬
‫لتفاعالتهم في أماكن تواجدهم مثل في علم األحياء الخلوي‬
‫ِ‬
‫علم األحياء الجزيئي ِ تستعمل إلستنتاج الخواص التأريخية من السكان أوَ‬
‫مباشر ‪ ،‬حيث تقنيات ِ‬
‫علم وراثة السكان و علم الوراثة العرقي‬
‫النوع‪ ،‬كما في مجاالت علم األحياء المتطورة مثل ِ‬
‫‪ . phylogenetics‬وهناك ايضا تقاليد عريقه دراسه الجزيئات البيولوجية "من الصفر" في‬
‫الفيزياء الحيوية ‪.‬‬
‫[عدل] تقنيات األحياء الجزئية‬
‫منذ أواخر خمسينات وأوائل الستّينات ‪ ،‬تعلم علماء االحياء الجزيئي كيفية تمييز وعزل ومعالجة‬
‫المكونات الدنا (‪ )DNA‬مستودع‬
‫المكونات الجزيئية للخاليا والكائنات الحية‪ .‬تتض ّمن هذه‬
‫ّ‬
‫المعلومات الوراثية ؛ الرنا (‪ )RNA‬الشبيه بالدي إن أي (‪ . )DNA‬الذي ت َتراو ُح وظائفَها ِم ْن‬
‫ال َع َمل كالنسخة العاملة المؤقتة ل (‪ )DNA‬دنا إلى هيكلية فعلية ومهام انزيمية كذلك الوظيفيه‬
‫والهيكليه من أجهزة النقل‪ .‬والبروتين هو الهيكل الرئيسي والنوع االنزيمي للجزيئات في الخليه‪.‬‬
‫‪73‬‬
‫تسلسل مواقع القطع ‪ Recognition Sites‬لبعض اإلنزيمات القاطعة‬
‫اإلنزيم القاطع‬
‫‪BamHI‬‬
‫‪EcoRI‬‬
‫‪HaeIII‬‬
‫‪HindIII‬‬
‫‪HpaI‬‬
‫‪HpaII‬‬
‫‪MboI‬‬
‫‪NotI‬‬
‫‪SfiI‬‬
‫‪TaqI‬‬
‫المصدر‬
‫‪Bacillus amyloliquefaciens H‬‬
‫‪Escherichia coli RY13‬‬
‫‪Haemophilus aegyptius‬‬
‫‪Haemophilus influenzae Rd‬‬
‫‪Haemophilus parainfluenzae‬‬
‫‪Haemophilus parainfluenzae‬‬
‫‪Moraxella bovis‬‬
‫‪Nocardia otitidis-caviarum‬‬
‫‪Streptomyces fimbriatus‬‬
‫‪Thermus aquaticus‬‬
‫المقطع الذي تُميزة‬
‫‪GGATCC‬‬
‫‪GAATTC‬‬
‫‪GGCC‬‬
‫‪AAGCTT‬‬
‫‪GTTAAC‬‬
‫‪CCGG‬‬
‫‪GATC‬‬
‫‪GCGGCCGC‬‬
‫‪GGCCNNNNNGGCC‬‬
‫‪TCGA‬‬
‫خريطة القطع المحددة ‪Map RFLP's‬‬
‫لقد أنشاء العلماء خريطة تسمى خريطة القطع المحددة لكثير من الكائنات الحية‪.‬و هذه الخريطة‬
‫تبين مكان القطع و محلها مقارنة بالقطع األخرى ‪.‬و عملت هذه الخريطة عن طريق تقطيع جميع‬
‫الكروموسومات بإضافة أنواع مختلفة من اإلنزيمات القاطعة ثم رتبت هذه القطع بشكل منتظم‪.‬و كان‬
‫الهدف من هذه الخريطة هو لتحديد نقاط و عالمات على طول الشريط الطويل من الدي إن أي التي‬
‫تتركب منه الكروموسومات و لكي يستطيعوا أن يقارنوا بين هذه القطع في الكائنات المختلفة‪.‬‬
‫خريطة للقطع المحدودة لـليمبدا فيج و فيروس‬
‫االدينوفيرس‪.‬توضح مواقع القص لثالث أنواع من‬
‫اإلنزيمات القاطعة ‪and ,EcoRI ,BamHI‬‬
‫‪)) HindIII‬‬
‫‪74‬‬
‫قطعة بطول ‪48‬ز‪ 5‬كيلوبيس من البكاتريوفيج ليمبدا()قطع باإلنزيم القاطع ايكو واحد في خمس‬
‫أماكن و نتج عنه ست قطع متفاوتة الطول و الحجم‪.‬و لقد وضعت هذه القطع على لوح من االقروز و‬
‫فصلة و اخرج حجمها كما هو موضح في الشريط األسود في أسفل الصورة‪.‬‬
‫فصل قطع الدي إن أي على لوح من الجل بالكهرباء(‪)Gel Electrophoresis‬‬
‫استعمل العلماء تقنية فصل البروتينات عن بعضها البعض بطريق انتقالها(رحالن) و انفصالها عن‬
‫بعضها البعض‪ ،‬و ذلك عن طريق تعريضها إلى تيار كهربائي و هي على لوح من المادة الهالمية‬
‫المعروفة بالجل‪.‬ولقد استعمل العلماء نفس الفكرة في فصل قطع الدي إن أي عن بعضها‬
‫البعض‪.‬ومن المعروف أن الحمض النووي عبارة عن شحنة سالبة و لذلك فعند و ضع بعض من‬
‫‪75‬‬
‫الدي إن أي في طرف من أطراف لوح الجيل ثم‬
‫وتعريضها لتيار كهربائي بحيث يكون القطب‬
‫السالب عند الطرف الذي وضعنا فيه الدي إن أي و‬
‫القطب الموجب عن الطرف األخير من ألواح فان‬
‫الدي إن إي ينتقل تلقائيا بتجاه الطرف الذي فيه‬
‫القطب الموجب و تتوقف حركة قطع الدي إن أي‬
‫على حسب إحجامها على طول اللوح‪.‬فالقطع‬
‫الصغيرة تتحرك بشكل اكبر من القطع الكبيرة‪ .‬و‬
‫بذلك يمكن فصل هذه القطع عن بعضها البعض‪.‬و‬
‫يمكن تحديد ا لحجم الفعلي لكل قطعة عن طريق‬
‫إضافة قطع معروفة الحجم من الدي إن أي و التي‬
‫تكون مقياس يرجع إليه الستنتاج أحجام القطع‪.‬‬
‫‪76‬‬
‫وهناك نوعان أساسيان من ألواح الجيل‪.‬األول يسمى بجيل االقروز (‪ ) Agarose gel‬و الثاني‬
‫بجيل البولي اكريليميد(‪.) Polyacrylamide gel‬و نظرا لصغر الفراغات التي بين البولي‬
‫اكريليميد فانه يستخدم لفص القطع الصغيرة الحجم من الدي ان أي و في العادة التي تكون اصغر‬
‫من ‪500‬جزيء من الحمض النووي و التي تتفاوت بين بعضها البعض بجزيء أو جزيئين‬
‫(انظر الرسم ‪..)A‬بينما يستخدم االقروز لألحجام األكبر من الدي إن أي‪ .‬و التي يتراوح حجمها بين‬
‫‪ 300‬إلى ‪ 10000‬جزيء من الدي إن أي (انظر الرسم ‪..)B‬ومادة االقروز هي مادة سكرية‬
‫مستخرجة من الطحالب و عند تحضيرها فإنها تشبه في قوامها الجيالتين الذي نأكله و لكنها أقوى‬
‫في قوامها بعض الشيء و لكنها قابلة للتهتك أو االنقطاع عند نقلها بغير حرص‪ .‬و لقد واجهه العلماء‬
‫صعوبات في فصل القطع الكبيرة من الدي إن أي و ذلك الن هذه القطع و عند وضعها على جيل‬
‫االقروز و بعد تسليط التيار الكهربائي عليها تتوقف ألنها تتمدد بشكل متعرج على شكل ثعبان‬
‫ملتوي طرف باتجاه القطب السالب و األخر بتجاه القطب الموجب‪.‬و لقد حلت هذه المشكلة عن‬
‫طريق تعريض جل االقروز إلى مستويات متفاوتة من القوة الكهربائية على طول اللوح و بذلك فان‬
‫قطعة الدي إن أي الطويلة عندما تتعرض إلى تيار كهربائي مختلف يجعلها تعدل من تمددها‬
‫المتعرج قبل أن تدخل في التيار الكهربائي الجديد و يستمر هذا التفاوت في التيار و التعديل في‬
‫قوام القطعة حتى تصل إلى المكان الذي يجب أن تقف فيه حسب حجمها‪ .‬و يسمى هذا النوع من‬
‫الفصل بالفصل عن طريق المجال الكهربائي المتردد (‪Pulsed-field gel electrophoresis‬‬
‫)‪ .‬و أمكنت هذه التقنية من فصل قطع كبيرة من الدي إن أي و حتى فصل قطع من الكروموسومات‬
‫على الجل و تتراوح القطع التي يمكن فصلها بهذه‬
‫الطريقة بين ‪ 220000‬إلى ‪ 2.5‬مليون جزيء من‬
‫الدي إن أي (انظر الرسم ‪.)C‬‬
‫ال تكون القطع المفصولة بالبولي اكريليميد و‬
‫االقروز واضحة للعيان و لذلك فان لوح الجيل‬
‫يعرض إلى مادة لصباغة الدي ان أي و اشهر هذه‬
‫المواد هو مادة برميدات االثيديوم ( ‪Ethidium‬‬
‫‪) Bromide‬و التي تلمع عند تعريضها لألشعة فوق‬
‫البنفسجية‪.‬و هناك طريقه أكثر دقه لمشاهدة القطع‬
‫على لوح الجيل و هذه الطريقة تعتمد على إضافة‬
‫مادة مشعة نووية إلى الدي إن أي قبل أن يوضع على لوح الجيل و لكن هذه الطريقة تحتاج إلى‬
‫احتياطيات معينه لكي ال تضر بمن يستخدمها‪.‬‬
‫‪77‬‬
‫معرفة التسلسل النووي(‪) DNA sequencing‬‬
‫ال شك أن العلماء يحتاجون إلى معرفة التركيبة‬
‫التسلسلية لكل جين و هذا يمكنهم من معرفة المزيد‬
‫عن البروتين الذي يصنعه ذلك الجين وعن التركيبة‬
‫التنظيمية لعمل الجين و قد يصلون على ضوءه إلى‬
‫معرفة األمور التي تتحكم في عمله‪.‬كما انه بمعرفة‬
‫التسلسل النووي للجين يمكن مقارنته بالجينات التي‬
‫سبق اكتشافها و هذا قد يعطي معلومات غزيرة عن‬
‫وضيفة هذا الجين و يختصر الكثير من االبحاث‬
‫و يتجنب اعادة اجرائها‪.‬وهناك طريقتان أساسيتان‬
‫لمعرفة التسلسل النووي ألي قطعة من الدي إن أي‪.‬األولى تسمى بالطريقة اإلنزيمية‬
‫(‪ ) method Enzymatic‬و األخرى بالطريقة الكيميائية(‪.) Chemical‬و لقد طغت الطريقة‬
‫األولى حتى أصبحت هي الطريقة األكثر استعماال‪.‬‬
‫الطريقة اإلنزيمية (‪:) Enzymatic method‬‬
‫يطلق على هذه الطريقة أيضا طريقة سنجر‬
‫(‪) Sanger procedure‬نسبة إلى د‪.‬فريدريك‬
‫سنجر و الذي أسس هذه الطريقة‪.‬كما أنها أيضا تعرف‬
‫التسلسل عن طريق دي ديوكسي ( ‪dideoxy‬‬
‫‪.)sequencing‬و تترتكز هذه الطريقة على مفهوم يختلف الديوكسي نيوكلويتيد عن دي ديوكسي‬
‫أن شريط الدي إن أي في األساس مبنى من جزيئات بيوكلوتيد بعدم و جود مجموعة (هيدروكسي)في‬
‫النقطة الثالثة من حلقة السكر الخماسية الشكل‪.‬‬
‫من الديوكس‬
‫نيوكلويتيد (‪) deoxynucleotides (dNTPs‬و يوجد على النقطة الثالثة من حلقة السكر‬
‫الريبوزي مجموعة مؤكسدة أي مجموعة هيدروكسيه( ‪)OH‬و هذه النقطة هي التي ترتبط في‬
‫لتكون شريط طويل من الدي إن أي‪.‬و‬
‫النقطة الخامسة من الجزيء الذي يليها و هكذا يتم الترابط ّ‬
‫لقد قام د‪.‬ستنجر باالستفادة من هذه الخاصية فبدّل الجزيء من (‪)OH‬إلى (‪ ) H‬عن طريق إضافة‬
‫دي ديوكسيو بيوكلوتيد(‪ )ddNTPs‬بدل من ديوكسي نيوكلوتيد(‪ ) dNTPs‬و ذلك عن طريق نسخ‬
‫الشريط مرة أخرى و هذا يؤدي الى توقف ترابط الجزيئات و يكون في طرف كل جزيء نوع‬
‫واحد من األحماض النووية‪.‬‬
‫و إليك الخطوات األساسية للقيام بهذا االختبار بالترتيب‪:‬‬
‫‪ -1‬القيام بنسخ الدي ان أي و ذلك على الشكل التالي‪:‬‬
‫أ‪ -‬أضف إلى عينة الدي إن أي قطع من البريمر(‪)specific primer‬يعرف انه سوف يلتصق‬
‫معرف(ملتصق بطرفة) بعنصر مشع‪.‬‬
‫بالدي إن أي المراد نسخة و ّ‬
‫‪78‬‬
‫ب‪ -‬قسم العينة إلى أربع أنابيب اختبار و كل أنبوبة اكتب عليها السماء التالية ‪(dGTP, dATP,‬‬
‫‪.dCTP, and dTTP).‬‬
‫ج‪ -‬أضف إنزيم البولمريز (‪) DNA polymerase‬‬
‫د‪-‬أضف إلى كل أنبوبة نوع واحد من الدي ديوكسي نيوكليتيد حسب اسم األنبوب‪.‬و أضيف معه‬
‫كمية من ديوكسي نيولكليتيد‪.‬سوف يحدث التفاعل و يبداء البريمر ببنان و تركيب و رص هذه‬
‫األحماض النووية‪.‬وعند إضافته لدي ديوكسي نيوكليتيد فان الشريط يتوقف على هذه النقطة‪.‬ثم‬
‫يحدث تفاعل أخر لنسخ شريط أخر و عند إضافة دي ديوكسي نيوكليتيد يتوقف التفاعل و هكذا‬
‫تستمر العملية و ينتج عندي في النهاية قطع منسوخة و متفاوتة الطول في كل أنبوب اختبار‪.‬‬
‫‪ -2‬أضيف كمية من كل األربعة أنابيب في حقل خاص على لوح االقروز ثم امرر تيار كهربائي و‬
‫من ثم تظهر على طول اللوح القطع المنسوخة و المتفاوتة األطوال كل حقل يعطيني ترتيب القطع‪.‬‬
‫‪-3‬تعريضها لألشعة(‪ )Autoradiography‬لكي يتسنى رؤية الدي إن أي و الذي عليه مادة‬
‫مشعة‪.‬‬
‫‪ -4‬ابدأ بقراءة لوح االقروز من أسفل إلى أعلى‪.‬وكل ما مر على نسخة من الدي إن أي اعرف‬
‫ترتيب و نوع الديديوكسي نيوكليتيد الذي في طرفة و‬
‫استمر في القراءة إلى أن ينتهي لوح االقروز‪.‬‬
‫و لتسهيل عملية القراءة استخدم الكمبيوتر لكي يقرأها‬
‫بشكل إلي و ذلك بتعريض لوح االقروز إلى أشعة‬
‫ليزر و عن طريق وحدة استشعار و مضخم للنبضات‬
‫(‪ ) photomultiplier‬يستطيع الكمبيوتر أن يحدد‬
‫نوع الدي ديوكسي نيوكليتيد و ثم يرتبها و يطبعها و‬
‫يعطيك رسما ً بيانيا ً الماكن كل حمض نووي و‬
‫باأللوان‪.‬و ال تستخدم المواد المشعة في القراءة اآللية‬
‫بالكمبيوتر بل يستعاض عنها بمادة‬
‫مضيئة(‪ ) fluorescent‬توضع على البريمر على‬
‫أن يكون لكل دي ديوكسي نيوكليتيد لون مختلف عن اآلخر(أي أربعة ألوان من المادة المضيئة) و‬
‫بذلك يمكن أن تمر جميع القطع في ممر واحد كما هو واضح في الرسم الجانبي‪ .‬و نظرا إلى أن‬
‫جهاز الكمبيوتر قابل للخطاء فانه يلزم التدقيق و المراجعة لتفادي حدوث األخطاء‪.‬و لقد قامة أجهزة‬
‫كمبيوتر عمالقة تعمل على مدار الساعة و تحت مظلة مشروع الجينوم البشري بالكشف‬
‫الكامل(‪ %99‬تقريباً)من التسلسل النووي لجميع الدي إن أي الموجود في اإلنسان و قد سبق ذلك‬
‫الكشف عن التسلسل النووي لكثير من الكائنات الحية و العمل جاري لمعرفة المزيد‪.‬‬
‫‪79‬‬
‫أنواع البالزميد التي تنمو في خميرة الخبز‬
‫الناقالت (‬
‫‪) Vectors‬‬
‫الناقل و التي تسمى باللغة اإلنجليزية "فيكتور" هي في الغالب فيروسات أو قطع من الحمض النووي‬
‫موجودة في البكتيريا‪.‬كما أن هناك أنواع صناعية تم صنعها في المختبرات الطبية و هي في العادة مواد شبه‬
‫صناعية ألنها في األصل مصنعة من مواد موجودة في الطبيعة‪.‬و من لديهم اهتمام بالبروتكوالت و الطرق‬
‫التعامل مع هذه الناقالت اقترح عليك مراجعة هذه الصفحة والتي تحتوي على العديد من الروابط‬
‫المتعلقة بالعناية بالناقالت ( اضغط هنا )‬
‫البالزميد ( ‪) Plasmid‬‬
‫و هي من اشهر الناقالت ‪،‬و هو عبارة عن قطعة صغيرة من الحمض النووي قابلة للتكاثر بمعزل عن بقية‬
‫الحمض النووي الموجود في الكروموسومات ‪.‬و هي شبيهة بالفيروس الصغير و لكنها ال تحتوي على طبقة‬
‫خارجية من البروتين‪.‬‬
‫‪ .‬و البالزميد عبارة عن قطعة من الحمض النووي موجود في البكتيريا خاصة في االي كولي(‪ )E.Coli‬و‬
‫بعض أنوع الخميرة ( ‪. )Yeast‬و لدية القدرة على التكاثر الذاتي و بمعزل من بقية الكروموسومات‬
‫الموجودة في الخلية‪.‬كما أن هناك بالزميدات تستطيع التكاثر داخل البكتيريا و الخميرة في آن واحد‪ .‬و يوجد‬
‫نوعان من البالزميد على حسب نوع الحمض النووي فيها فهناك البالزميد المصنوع من الدي إن أي‬
‫(‪ ) DNA‬و نوع أخر مصنوع من األر إن أي (‪ .) RNA‬و هناك أنواع عديدة من البالزميد فمنها الصغير‬
‫و منها الكبير كما أن منها ما ال يحتوي على أي جين بينما هناك أنواع كبيرة تحتوي على عدة جينات‪.‬و‬
‫باإلضافة إلى وحدة التكاثر الذاتي الموجد على البالزميد هناك الكثير من الجينات التي قد تكون على‬
‫البالزميد و هي مفيدة للعلماء في عملية نسخ الجينات و القطع النووية فمثال فد يوجد على البالزميد جين‬
‫خاص يكافح المضادات الحيوية كالمبيسيلين و التترسيكلين ‪.‬و هذه الجينات الحامية من المضادات الحيوية‬
‫تساعد في التعرف و عزل البكتيريا التي تحتوي على البالزميد الذي عليه الجين الذي كنا ننوي استنساخه‬
‫(للمزيد راجع عملية نسخ الجينات و القطع النووية)و يعتقد نظريا أن الفيروسات المنتشرة في األصل كانت‬
‫بالزميدات حيث أنها اكتسبت غالف بروتيني خارجي و أصبحت فيروساً‪.‬‬
‫‪80‬‬
‫الناقالت الفيروسية ( ‪: )Viral Vectors‬‬
‫إن اشهر هذه األنواع هي الفيروسات البكتيرية المعروفة بالفيج ( ‪ .) Phage‬و هي عبارة عن قطعة من‬
‫الدي ان أي مغطاة بغالف بروتيني‪ .‬ومن اشهر أنواع الفيج ما يسمى بفيج لمدا (‪ )lambda phage‬و هو‬
‫فيروس موجود في االي كولي ‪ .E. coli‬وهذا النوع من الناقالت تستطيع أن تحمل قطعة من الدي إن أي‬
‫حورت هذه الفيروسات لكي تستطيع‬
‫حتى غاية كيلوبيز‪.‬و لقد ّ‬
‫حمل كمية اكبر من الدي إن أي‪.‬فعال سبيل المثال الكوزميد (‬
‫‪ )Cosmids‬عبارة عن تهجين جزء(قطعة من الدي ان تسمى‬
‫الالصقة ‪cohesive sequence‬و تعرف مختصرة بالكوز ‪Cos‬‬
‫‪ )sequence‬من فيج ليمبدا(‪ ) Phage‬مع بالزميد (‪ ) Plasmid‬و‬
‫الذي يستطيع نقل حتى ‪ 40‬كيلوبيز (‪ ) 40kb‬و الباك الفيروسي‬
‫المسمى بكروموسوم بي ‪ 1‬الصناعي (‪P1-derived PAC‬‬
‫‪ ) Artificial Chromosomes /‬عبارة عن تحوير للفيج بي ‪1‬‬
‫( ‪P1‬‬
‫‪YIP, yeast integrating plasmid = selectable marker‬‬
‫‪Bacteriop‬‬
‫‪+cloning sites‬‬
‫‪ ) hage‬و‬
‫إضافته إلى‬
‫‪YRP, yeast replicating plasmid = YIP + ARS origin of‬‬
‫البالزميد‪..‬‬
‫‪replication‬‬
‫‪YEP, yeast expression plasmid = YIP + 2 micron origin‬‬
‫‪of replication‬‬
‫‪YCP, yeast centromere plasmid = YRP + centromere‬‬
‫‪sequence‬‬
‫‪Cos sequence from Lambda phage +‬‬
‫‪Plasmid‬‬
‫‪P1 Phage + Plasmid‬‬
‫‪Modified E.coli fertility plasmid‬‬‫‪factor‬‬
‫‪Cosmid‬‬
‫‪PAC‬‬
‫‪BAC‬‬
‫الناقالت الكروموسومية الصناعية (‪:) Artificial Chromosomes‬‬
‫نظرا للحاجة إلى نقل إحجام كبيرة من الدي إن أي فقد قام بعض العلماء بتحوير بعض الناقالت الطبيعية‬
‫لكي تقوم بهذه المهمة‪.‬و يوجد حاليا ناقالت على شكل كروموسوم و فيها القطع األساسية لكي تعمل على‬
‫شكل كروموسوم‪.‬و من هذه األنواع ما يعرف بــ الياك او كروموسوم الخميرة الصناعي( ‪Yeast‬‬
‫‪ ) Artificial Chromosomes / YAC‬و الذي يستطيع نقل أكثر من ‪ 500‬كيلوبيز (‪.) 500 kb‬و‬
‫الياك عبارة عن قطعة من الدي ان أي مترابطة و تحتوي على طرفين للكروموسوم(‪ )2 Telomeres‬و‬
‫مركز للكروموسوم(‪ )Centromere‬و مركز للتكاثر( ‪Autonomous replicating sequence‬‬
‫‪81‬‬
‫‪.)ARS‬بينما الباك البكتيري( ‪) Bacterial Artificial Chromosomes / BAC‬و الذي يستطيع حمل‬
‫حتى ‪ 150‬كيلوبيز (‪ ) 150 kb‬هو تحوير للبالزميد المعروف ببالزميد تناسل بكتيريا االيكولي( ‪E.coli‬‬
‫)‪.)fertility plasmid-factor‬‬
‫نوع الناقل‬
‫البالزميد‬
‫‪Vector‬‬
‫‪Standard plasmid‬‬
‫لمبدا بكتيريوفيج محور‬
‫‪Lambda Bacteriophage‬‬
‫حجم الدي ان‬
‫أي الذي‬
‫يستطيع حملة‬
‫‪10 -0‬‬
‫‪KB‬‬
‫‪Kb 23-0‬‬
‫‪44-30‬‬
‫‪Cosmid‬‬
‫كوزميد‬
‫‪Kb‬‬
‫‪100-70‬‬
‫‪Bacteriophage P1‬‬
‫بكتريوفيج بي ‪1‬‬
‫‪Kb‬‬
‫‪-130‬‬
‫‪P1Artificial chromosome‬‬
‫كروموسوم بي ‪ 1‬الصناعي‬
‫‪150Kb‬‬
‫‪PAC‬‬
‫‪P1‬‬
‫‪ Bacterial Artificial‬بحد أقصى‬
‫كروموسوم البكتيريا‬
‫‪Kb 300 Chromosome BAC‬‬
‫الصناعي‬
‫‪2-0.2 Yeast Artificial Chromosome‬‬
‫كروموسوم الخميرة‬
‫‪Mb‬‬
‫الصناعي‬
‫‪YAC‬‬
‫المرجع‪Human Molecular Genetics by T.Strachan and A.Read1996:‬‬
‫النسخ واالستنساخ(‪:)Cloning‬‬
‫يشتهر بين الناس كلمة االستنساخ نظرا الرتباطها بخلق الكائنات أو إنشاء نُسخ منها‪.‬و لكن‬
‫بالمصطلح الطبي فان كلمة نسخ أو استنساخ تعنى عملية إنشاء صورة طبقا األصل من‬
‫المادة التي يراد نسخها‪.‬و قد يكون النسخ لقطعة من الدي إن أي أو نسخ كائن حي متكامل‪.‬و‬
‫ال شك أن لغتنا العربية تفرق بين كلمة نسخ و استنساخ و لكننا سوف نستخدم كلمة نسخ أو‬
‫استنساخ في حديثنا لنعني نفس الشيء‪ .‬و في كلمة استنساخ باللغة العربية تعني (‬
‫‪82‬‬
‫‪)Cloning‬وينتج عنه نسخة أو مستنسخ (‪.)Clone‬‬
‫عندما قام الدكتور‪ ...‬و فريقه العلمي بنشر (‪) Nature 385, 810-13, 1997‬خبر‬
‫استنساخ النعجة "دولي" في احد مختبرات اسكتلندا ( مختبر روزيلين ) عام ‪ 1997‬زاد‬
‫اهتمام العالم بموضوع االستنساخ و زاد الفضول العلمي في الحديث عن استنساخ اإلنسان‬
‫و فجر ذلك الخبر الكثير من التحفظات الدولية من كثير من المراكز الدينية و العلمية على‬
‫الجانب األخالقي من عملية استنساخ اإلنسان‪.‬‬
‫و بعد ذلك اخبر أصبحت كلمة استنساخ تستخدم بين العامة في الحديث عن عملية خلق‬
‫نسخة أخرى من الحيوان أو اإلنسان و بذلك بدأ البس بين الكثيرين في معنى هذه الكلمة‪.‬و‬
‫ال شك فان العلماء كانوا و مازالوا يستعملون هذه الكلمة في اإلشارة إلى عملية صنع نسخة‬
‫من أي مادة وراثية و ليس بالضرورة خلق أو نسخ كائن حي بالكامل‪ .‬و لذلك فالعلماء‬
‫يقسمون االستنساخ أو النسخ إلى ‪ 3‬أنواع ‪:‬‬
‫‪ 1‬نسخ أو استنساخ القطع من الدي إن أي عن طريق الهندسة الوراثية و بما يعرف‬‫بتهجين الدي إن أي (‪Recombinant DNA technology ) .‬‬
‫‪ 2-‬االستنساخ التكاثري أو الجنسي‬
‫‪Reproductive cloning‬‬
‫‪ 3-‬االستنساخ العالجي‪Therapeutic cloning‬‬
‫‪83‬‬
‫نسخ أو استنساخ القطع من الدي إن أي عن طريق الهندسة الوراثية‪.‬‬
‫إن ما يهتم به العلماء في باب االستنساخ هو نسخ قطع من الدي إن أي كانت هذه القطع عبارة عن‬
‫جين(مورث)أو جميع الجينوم(أي كل الدي إن أي الموجود في الكائن الحي)‪.‬و اشهر العمليات التي تجرى‬
‫هي نسخ قطعة من الدي إن أي‪ .‬و يحتاج العلماء للقيام بنسخ القطع ألنهم يحتاجون إلى كمية كبيرة من هذه‬
‫النسخ و ذلك لندرة استخالصها في كل مرة من داخل الخلية و ذلك لوجود التعقيدات اإلنشائية‬
‫للكروموسومات ‪.‬و على سبيل المثال فان الجين المنتج لسلسة بيتا في الهيموجلوبين و المعروف بمورث‬
‫ببيتا جلوبين( ‪ )Beta-Globin Gene‬يمثل فقط ‪ %0.00005‬من حجم الدي إن أي الكلي في الخلية(و‬
‫الذي يتراوح ب ‪3‬باليين قاعدة نووية)‪.‬كما أن الجين العمالق و المعروف بجين الدستروفين(‬
‫‪ ) Dystrophin Gene‬و الذي يتراوح حجمه بال‪ 2.5‬ميقابيز (‪ ) 2.5Megabases‬ال يمثل أكثر من‬
‫‪ %0.08‬من الحجم الكلي للدي إن أي في الخلية‪.‬و لذلك فان العلماء يحتاجون إلى إجراء نسخ لهذه الجينات‬
‫أو القطعة من الدي إن أي لكي يتسنى لهم التعامل بها و إجراء التجارب عليها‪.‬و هناك طريقتان رئيسيتان‬
‫للنسخ‪:‬‬
‫‪-1‬‬
‫النسخ عن طريق استخدام الخاليا الحية(‪)Cell-Based DNA cloning‬‬
‫‪ -2‬النسخ عن طريق غير الخاليا الحية(‪ )Cell-Free DNA cloning‬و ذلك باستخدام البي سي أر(‬
‫‪.)Polymerase chain reaction PCR‬سوف نورد لهذه الطريقة صفحة مستقلة إنشاء هللا‪.‬‬
‫النسخ عن طريق استخدام الخاليا (‪)Cell-Based DNA cloning‬‬
‫يرتكز النسخ باستخدام الخاليا الحية على ثالث خطوات‪:‬‬
‫‪ -1‬تصميم قطعة مهجنة من الدي إن أي المراد نسخها و‬
‫دي إن أي من ناقل (‪ )Vector‬و لدية القدرة على‬
‫التكاثر‪.‬و ذلك عن طريق استخدام اإلنزيمات‬
‫القاطعة(‪.)Restriction enzymes‬‬
‫‪1- Construction of‬‬
‫‪recombinant DNA‬‬
‫‪molecules by in Vitro‬‬
‫‪attachment to‬‬
‫‪Replicon(Vector).‬‬
‫‪ -2‬نقل القطعة المهجنة و التي هي بداخل الناقل إلى خلية‬
‫حية و في العادة تستخدم البكتيريا(‪ ) Bacteria‬خاصة‬
‫النوع المعروف بااليكولي (‪ E,coli‬او الخميرة(‬
‫‪2-Transformation using‬‬
‫‪bacteria or yeast‬‬
‫‪84‬‬
‫‪.)Yeast‬‬
‫‪ -3‬اختيار المستعمرات البكتيرية التي تحتوي على الناقل‬
‫و القطعة المهجنة و السماح لها بالتكاثر‪.‬عن طريق أطباق‬
‫الزراعة(‪ )Culture Plates‬أو في محاليل سائلة‪.‬‬
‫‪3- Selective propagation of‬‬
‫‪cell clones.‬‬
‫‪-4‬استخالص القطع المهجنة و استخراج الدي ان أي منها‬
‫بكميات كبيرة‪.‬‬
‫‪3- Isolation of recombinant‬‬
‫‪DNA clones‬‬
‫‪ -1‬تصميم القطع مهجنة من الدي إن‬
‫يعتمد النسخ باستخدام الخاليا الحية على قدرة القطعة المراد‬
‫نسخها على االنقسام أو التكاثر الذاتي عندما توضع داخل‬
‫الخلية الحية‪.‬و ال شك أن قطع الدي إن أي العادية ليس لديها‬
‫القدرة على التكاثر الذاتي و لذلك فان العلماء قاموا بتجاوز‬
‫هذا األمر بان ادخلوا القطعة التي يريدون نسخها في ناقل‬
‫من النواقل( ‪ ) Vectors‬المعروفة بقدرتها على التكاثر‬
‫الذاتي(راجع موضوع النواقل)‪.‬و بغض النظر عن نوع‬
‫الناقل فان طريقة إدخال قطعة الدي ان أي المراد نسخها‬
‫إلى الناقل تقريبا واحدة‪.‬و هذه الخطوات ببساطة كما يلي‪:‬‬
‫‪ -1‬بعد أن يتم تحديد القطعة المراد نسخها يضاف‬
‫إليها إنزيم قاطع محدد و ليكن مثال إنزيم ( أ )فيقوم‬
‫هذا اإلنزيم بقطع الدي إن أي في مكان محدد حسب‬
‫التسلسل النووي‪.‬‬
‫يضاف نفس اإلنزيم للناقل و الذي يقوم بقطعة‬
‫‪-2‬‬
‫أيضا في نفس التسلسل النووي‪.‬‬
‫تضاف القطع المراد نسخها بعد قطعها باإلنزيم‬
‫‪-3‬‬
‫ّ‬
‫المقطع‪ .‬فتتداخل التسلسالت‬
‫القاطع إلى الناقل‬
‫النووية بين الناقل و بين قطع الدي إن أي المراد‬
‫نسخها‪ .‬فنشاء من ذلك قطعة مهجنة من الناقل و بداخله القطعة المراد نسخها‪.‬و ترتبط قطعة الدي‬
‫‪85‬‬
‫إن أي البالزميد من أطرافها برابطة هيدروجينية و هي رابطة ضعيفة لذلك يضاف إنزيم يسمى‬
‫ليقيز أو الالصق( ‪ )Ligase‬لكي يحول الترابط بين قطعة الدي إن أي و التناقل إلى رابطة‬
‫قوية(‪) Covalent Bond‬‬
‫إن أكثر لناقالت استخداما هي البالزميد و لكن يمكن استخدام الفيج أو الياك أو أي ناقل أخر‪.‬و الذي يحدد‬
‫نوع الناقل المراد استخدامه هو في العادة كبر القطعة المراد استنساخها‪.‬ففي حالة القطع الصغيرة يستخدم‬
‫البالزميد أو الفيج بينما يستخدم الياك أو الباك في حالة القطع الكبيرة‪.‬‬
‫‪-2‬‬
‫نقل القطعة المهجنة و التي هي بداخل الناقل إلى خلية حية‬
‫في الغالب تستعمل البكتيريا خاصة النوع المعروف االيكولي(‪ )E.Coli‬في عملية‬
‫الزراعة و ذلك لسهولة إدخال الناقل إليها‪ ،‬و إلى سرعة انقسامها (تنقسم البكتريا تقريبا‬
‫كل ‪ 20‬دقيقة)‪ ،‬إضافة إلى توفر طرق االختيار خاصة التي تعتمد على خاصة الحماية‬
‫من المضادات الحيوية‪.‬و يدخل البالزميد أو الفيج تلقائيا إلى داخل البكتيريا بينما الناقالت األخرى تحتاج‬
‫إلى مساعدة ‪،‬و في العادة بتغيير تركيز األمالح المحيطة بالبكتيريا أو تعرض إلى نبضة كهربائية لكي‬
‫يسمح الجدار المحيط بالبكتيريا بدخول الناقالت‪.‬و من طبيعة البكتريا إنها تنقسم تلقائيا و بشكل سريع و‬
‫كذلك البالزميدات‪.‬‬
‫‪ -3‬اختيار المستعمرات البكتيرية التي تحتوي على الناقل‬
‫و القطعة المهجنة‬
‫مع تكاثر الخاليا البكتيرية و تكاثر البالزميد التي بداخلها‬
‫ينتج لدينا أعداد كثيرة من المستعمرات البكتيرية و بها‬
‫البالزميد المهجن‪.‬و لكن قد يكون في داخل الطبق الذي‬
‫زرع فيه البكتريا بعض البكتريا التي ال تحتوي على‬
‫البالزميد المهجن و لكي يمكن التعرف على البكتيريا التي‬
‫تحتوي على البالزميد المهجن فنه في العادة يقام باستعمال‬
‫ناقالت عليها جينات واقية من المضادات الحيوية‪ ،‬كالجين‬
‫الواقي من المضاد الحيوي امبيسيلين أو التترسيلين و‬
‫غيرها‪ .‬و بذلك فالمضاد الحيوي سوف يمنع تكاثر أي‬
‫خلية بكتيرية ال تحتوي على البالزميد المهجن و الذي‬
‫علي الجين الواقي من المضاد الحيوي‪.‬‬
‫‪ -4‬استخالص القطع المهجنة و استخراج الدي ان أي‬
‫منها بكميات كبيرة‪.‬‬
‫بعد أن يُتعرف على المستعمرات التي تحتوي على‬
‫البالزميد المهجن فانه يمكن نقلها إلى طبق جديد و يحافظ‬
‫عليها و تغذى لكي تستمر بالتكاثر‪.‬و هذه البكتيريا يكون‬
‫فيها أعداد كثيرة من البالزميد و بذلك تنتهي عملية النسخ‪.‬و يستفاد من هذه القطع المنسوخة في القيام‬
‫بالمزيد من البحوث أو التجارب عليها كان يقام مثال إنتاج مكتبة من الدي إن أي أو محاولة استنتاج التسلسل‬
‫‪86‬‬
‫النووي للقطعة‪.‬كما يمكن تحوير هذه العملية بحيث يحتوي البالزميد على قطعة من سي دي إن‬
‫أي(‪ )cDNA‬بدل و من ثم تحوير المراحل األخيرة من الزراعة إلنتاج بروتين بدال من الدي إن أي‪ .‬و هذه‬
‫الطريقة هي التي تستعمل في إنتاج بعض الهرمونات كهرمون النمو ‪.‬‬
‫تقنية ‪PCR‬‬
‫‪Polymerase Chain Reaction‬‬
‫تفاعل البليمريز التتابعي‬
‫تحفظ المعلومات الوراثيـة و انتـاج المـواد لصـنع الخاليـا و الحفـاظ‬
‫عليهــا فــي داخــل الحمــض النــووي (‪ . ) DNA‬و تقــوا الخليــة‬
‫بمضاعفة كميـة الحمـض النـووي وقـت انقسـاا الخليـة بشـكل‬
‫تلقائي و بشكل سـريع مـع وجـود نظـاا تصـحيح ل خطـاء خـالل‬
‫النسخ‪ . .‬و تبلـ سـرعة النسـخ والمضـاعفة إلـى ‪ 1000‬قاعـدة‬
‫نيتروجينية بالثانيـة ( داخـل النظـاا الحيـوي ) و هـي كمـا ركرنـا‬
‫تحدث في الخلية في وقت التكاثر واالنقساا فقط ‪.‬‬
‫ومــع التطــور فــي مجــال التكنولوجيــا الحيويــة والــذي يقــوا علــى‬
‫التعامـــل مـــع الحمـــض النـــووي (‪ ) DNA‬بشـــكل أساســـي ‪،‬‬
‫استدعى رلك العلماء على أن يبحثوا عن طريقة أو تقنيـة تقـوا‬
‫‪87‬‬
‫على مضاعفة كمية الحمض النووي (‪ ) DNA‬بشكل كبير ‪ ،‬فكان هناك عـدة محـاوالت لتنشـيط الخليـة علـى‬
‫االنقساا المستمر بإضافة عوامل النمو ‪ ، growth factors‬ولكن هذه الطريقة لم تكن رات جده لـدى العلمـاء‬
‫ألسباب كثيرة‪ .‬إلى أن توصل العـالم د‪ .‬كـري مـولس ‪ Dr. Kerry Mullis‬فـي عـاا ‪ ( 1985‬و قـد حصـل علـى‬
‫جائزة نوبل في الكيمياء عاا ‪)1993‬بنشر اختراعه لتقنية البي سي ار ‪ PCR‬فكانت هـذه التقنيـة بوابـة لكثيـر‬
‫من التطورات المتسارعة في مجال التكنولوجيا الحيوية ‪ ،‬من أهم األسباب التي ساعدت هـذه التقنيـة علـى‬
‫االنتشار عدا اعتمادها على النظاا الحيوي(أي الخلية) و التحكم بكمية الحمض النووي (‪ ) DNA‬و وسـرعة‬
‫‪.‬‬
‫في اإلنتاج ولكن كان من عيوب هذه التقنية عدا وجود نظاا إصالح أخطاء االرتباط الخاطئ ‪miss match‬‬
‫ما هو ‪: PCR‬‬
‫هو تقنية مخبريه تم اكتشافها عاا ‪1983‬ا تقريبـا تقـوا علـى إكثـار نسـخ الحمـض النـووي (‪ ) DNA‬خـارج‬
‫النظاا الحيوي ‪ .‬أي أنها طريقة لنسخ الحمض النووي في المختبـر‪ .‬و لـذلك فهـي تقنيـة حيويـة الستنسـا‬
‫قطعة من محددة من الحمض النـووي و مضـاعفة إنتاجهـا لكـي يتسـنى إجـرى عليـه اختبـارات و فحوصـات‬
‫إضافية‪.‬‬
‫ما هي متطلبات‪: PCR‬‬
‫لتقوا بإنتاج الحمض النووي (‪ ) DNA‬بواسطة ‪ PCR‬يتتطلب عليك توفير ‪:‬‬
‫‪ .1‬جهاز للتحكم بدرجات حرارة التفاعل بشمل دقيق و متتالي ( الدورة الحرارية ‪ : ) Thermocycle‬ويقوا‬
‫هذا الجهاز بتغير درجة الحرارة بشكل سريع ‪ ،‬آلن تغير درجة الحرارة هو األساس الذي تقوا عليه فكرة هذه‬
‫التقنية ‪.‬‬
‫‪ .2‬البليمريز ‪ :‬وهو اإلنزيم الذي يقوا ببناء وترتيب القواعد النيتروجينية ( حدات الحمض النووي (‪، ) ) DNA‬‬
‫ويجب أن يكون هذا اإلنزيم مقاوا للحرارة العالية ليتمكن من العمل ‪ .‬و قد اكتشف انزيم مقاوا للحرارة و‬
‫اسم تاج ‪Tag‬‬
‫‪ .3‬مجموعة متفرقة من القواعد النيتروجينية‪ ) A T C G ( :‬ليتمكن اإلنزيم من ترتيبها في مواقعها أثناء‬
‫عملية نسخ الحمض النووي (‪. ) DNA‬‬
‫بريمر ‪ : Primer‬وهو قطعة صغيرة من الحمض النووي (‪ ) DNA‬ليتمكن اإلنزيم من بداء البناء و‬
‫‪.4‬‬
‫النسخ عليها ‪.‬‬
‫‪.5‬‬
‫والشيء األهم هو وجود نسخة من الحمض النووي (‪ ) DNA‬المراد نسخه ‪.‬‬
‫باإلضافة إلى محلول أو وسط ليتم به‬
‫‪.6‬‬
‫التفاعل ‪ :‬وهذا المحلول يختلف بين تفاعل و أخر ‪.‬‬
‫‪88‬‬
‫عملية‬
‫النسخ ‪:‬‬
‫بعد وضع‬
‫الحمض‬
‫النووي‬
‫المراد‬
‫نسخة‬
‫مع‬
‫البريمر و‬
‫و إنزيم‬
‫البوليمري‬
‫زو‬
‫مجموعة‬
‫مع‬
‫األحماض‬
‫النووية‬
‫في أنبوب‬
‫داخل‬
‫جهاز‬
‫التحكم‬
‫الحراري‬
‫فان هناك‬
‫‪ 3‬مراحل‬
‫منفصلة‬
‫تمر بها‬
‫عملية‬
‫النسخ‪:‬‬
‫‪ .1‬مرحلة‬
‫التفكيك‬
‫‪Denatur‬‬
‫‪ : e‬رفع الحرارة إلى ‪ْ 94‬ا ورلك لفك الحمض النووي (‪ ) DNA‬األصل ‪.‬‬
‫‪ .2‬مرحلة االلتصاق ‪ : anneal‬إنزال الحرارة إلى ما بين ‪ْ 60-55‬ا ليقوا البريمر باأللتزاق فيزيائيا بواسطة‬
‫الروابط الهيدروجينية مع الحمض النووي (‪ ) DNA‬األصل ‪.‬‬
‫مرحلة االمتداد ‪ : extend‬ثم يقوا برفع درجة الحرارة إلى ‪ْ 75‬ا ليقوا البلمريز بعمله في بناء‬
‫‪.3‬‬
‫الحمض النووي (‪ ) DNA‬الجديد ‪.‬‬
‫وهذه المراحل الثالث تعتبر دورة كاملة وفيها يصبح الحمض النووي (‪ ) DNA‬األصل قد تضاعف ‪ ،‬وتعتمد كمية‬
‫ناتج الحمض النووي (‪ ) DNA‬على عدد الدورات ( والصورة التالية توضح العملية ) ‪.‬‬
‫لمشاهدة هذه العملية اضغط على هنا‪.‬‬
‫تطبيقات ‪: PCR‬‬
‫لتقنية ‪ PCR‬تطبيقات كثيرة في مجال أبحاث الحمض النووي (‪ ) DNA‬و الوراثة ومنها ‪:‬‬
‫‪ .1‬الكشف عن ا لطفرات الوراثية ‪ :‬ورلك عن طريق وضع بريمر خاص للطفرة لتكثير الجين الخاص بها ‪ .‬ومنه‬
‫نقوا بمعرفة المرض إرا كان على زوجين الكروموسومات أو على احدهما ( ‪. ) allele‬‬
‫‪89‬‬
‫‪.2‬‬
‫تعين البصمة الوراثية ‪.‬‬
‫‪.3‬‬
‫الكشف عن الفيروسات ‪ :‬وهذه الطريق هي األدق في تحديد نوع وجنس الفيروس وكميته‪.‬‬
‫‪ .4‬هو العنصر األهم في عملية التجميع الجيني ( ‪ Recombinant‬الحمض النووي (‪ : ) ) DNA‬حيث نقوا‬
‫بتكثير الجين المراد إدخاله على البالزمد أو الحمض النووي (‪ ) DNA‬المضيف ‪.‬‬
‫‪.5‬‬
‫استخدامه في تغير نهايات الجين لتصبح متوافقة مع إنزيمات القطع ( ‪. ) Restriction enzyme‬‬
‫‪ .6‬هو العملية األساس في تحديد تتابع القواعد النيتروجينية في الحمض النووي (‪ ( ) DNA‬الحمض النووي‬
‫(‪. ) Sequencer ) DNA‬‬
‫‪.7‬‬
‫معرفة طول الحمض النووي (‪. ) DNA‬‬
‫‪.8‬‬
‫تقنية الحمض النووي (‪ ) DNA‬المكمل ( ‪c‬الحمض النووي (‪. ) ) DNA‬‬
‫‪.9‬‬
‫تحديد الجين المطلوب من خليط من الجينات ‪.‬‬
‫‪ .10‬يستخدا في تقنية (‪.) microarrays‬‬
‫‪ .11‬في مشروع الخارطة الجينية البشرية (‪. ) human genome project‬‬
‫‪ .12‬الساوثرين بلوت (‪. ) southern plot‬‬
‫‪ .13‬تقنية ارتباط الحمض النووي (‪ – ) DNA‬بروتين ( الحمض النووي (‪. ) DNA ) -Protein Interaction‬‬
‫‪ .14‬في مجال الطب الشرعي ( اختبار األمومة ‪ ،‬حاالت االغتصاب ‪ ،‬تحديد الهوية ‪ ...‬الخ ) ‪.‬‬
‫وغيرها من التطبيقات المخبرية والبحثية ‪.‬‬
‫أنواع ‪: PCR‬‬
‫هناك نوعان من ‪: PCR‬‬
‫‪ PCR .1‬العادي ‪ :‬وهو ما تم شرحه والتطرق اليه في الخطوات السابقة ‪.‬‬
‫‪ : rtPCR .2‬وهو اختصار لـ ( ‪ : ) Real Time PCR‬وهذا النوع يقوا على نفس المبدأ ولكن الخالف الوحيد‬
‫يكون مربتط الجهاز بكمبيوتر لتحديد الوقت الحقيقي لبدا التفاعل ومن ثم الكمية الحقيقية لعدد نسخ‬
‫الحمض النووي (‪ ) DNA‬ويعتمد رلك على وجود قواعد نيتروجينية حرة مشعة لتحديد رلك ‪ .‬مما يسهل‬
‫على الباحثين الوقت لتحدد وجود الجين المطلوب أو ال ‪ ،‬وكمية الجين بدون الوصول إلى نهاية الدورات‬
‫الحرارية المحددة ‪.‬‬
‫لسماع تسجيل فديو لتسمية البي سي ار بهذا االسم‪ .‬اضغط هنا‬
‫قام بإعداد هذه الصفحة مشكوراً‪ :‬األستاذ معاذ محمود من االردن‪2007-6-17 .‬‬
‫‪90‬‬
‫صفحة الهندسة الوراثية الرئيسية‬
‫االستنسا التكاثري (‪ ) Reproductive cloning‬استنسا الكائنات الحية بالكامل‬
‫يعرف االستنسا التكاثري أو الجنسي بأنه إنتاج لكائن حي له نفس المادة الوراثية( ‪) Nuclear DNA‬‬
‫لكائن حي أخر المنسو منه‪ .‬لقد قاا الفريق العلمي بمختبر روزلين بعملية استنسا جنسي في عملية‬
‫استنسا للنعجة دولي‪.‬و تعرف هذه العملية أيضا بنقل نواة الخلية الجسمية ( ‪somatic cell nuclear‬‬
‫‪ .) transfer" (SCNT‬و بشكل مبسط نقل نواة من خلية من خاليا الجسم غير الجنسية أي غير التي توجد‬
‫في المبيض (في األنثى )و من خاليا الخصية(في الذكر)‪.‬و الخلية التي استعملت الستنسا دولي كان‬
‫من خاليا الثدي لنعجة أخرى‪.‬و من ثم أخذت أيضا بويضة من المبيض و قاا العلماء من التخلص من النواة‬
‫التي بداخل تلك البويضة ثم قاموا بزرع النواة التي أخذوها من ثدي في داخل البويضة‪ .‬ثم قاموا بصعق تلك‬
‫البويضة بالكهرباء لكي ينشطوا عملية االنقساا‪ .‬و بعد أن بدأت هذه البويضة في االنقساا قاموا بغرزها‬
‫داخل رحم نعجة و بعدها نما الجنين في الرحم فأصبح"بإرن هللا" نعجة كاملة‪.‬‬
‫علميا فان دولي (أو أي حيوان أو إنسان )يستنسخ بهذه الطريقة ليس في الحقيقة نسخة مطابقة لالا أو‬
‫األب الذي اخذ منه النواة‪ .‬فهناك بعض من المادة الوراثية موجود خارج النواة و هو بالتحديد موجود في داخل‬
‫البويضة التي أزيل منها النواة‪.‬و هذه المادة الوراثية موجودة على جسيمات صغيرة تسمى بالميتوكوندريا‬
‫(‪ .) Mitochondria‬و مع أن الميتوكوندريا مصنع هاا للطاقة إال انه يكثر فيها الطفرات مع تقدا العمر وقد‬
‫يكون لها عالقة بالهرا‪.‬‬
‫صفحة الهندسة الوراثية الرئيسية‬
‫االستنسا العالجي ‪Therapeutic cloning‬‬
‫و يقصد بذلك استنسا كائنات حية ألخذ خاليا جذعية(‪ )Stem Cells‬و ال يسمح لها للوصول إلى تخليق‬
‫كائن حي كامل‪ .‬و أهمية هذه الخاليا تنبع في قدرة هذه الخاليا في إنتاج أي خاليا أو أعضاء كالكلية و الكبد‬
‫و الخاليا الدموية و التي يرجى في استخدامها عالج الكثير من األمراض التي ال يوجد لها عالج شافي‪ .‬و‬
‫لقد قامة إحدى الشركات العلمية في والية ماسيشيوستز بالواليات المتحدة األمريكية ( ‪Advanced Cell‬‬
‫‪ ) Technologies‬في شهر نوفمبر من عاا ‪ 2001‬باإلعالن عن محاولة ناجحة الستخالص خاليا جذعية من‬
‫أجنة مستنسخة و رلك بعد أن قامة باستخداا ‪ 8‬بويضات بشرية تم تفريغها من نواها ثم زرع بداخلها نوى‬
‫خاليا من الجلد‪.‬و لقد نجحوا في إنتاج خاليا جذعية من بويضة واحدة بينما فشلة البويضات السبع‪.‬و يمكنك‬
‫الرجوع إلى صفحة الخاليا الجذعية للمزيد من المعلومات‪.‬‬
‫‪91‬‬
‫| الشرعية | المتالزمات | األا و الطفل | الطبية الوراثة‬
‫نحن من‬
‫وسرطان الثدي الوراثة‬
‫يعتبر سرطان الثدي عند النساء ثاني السرطانات شيوعا عند النساء‪.،‬بينما هو من السرطانات النادرة لدى‬
‫الرجال فهو يمثل فقط ‪ %1‬من مجموع المصابين بسرطان الثدي‪.‬وفي األسطر القادمة سوف نناقش سرطان‬
‫الثدي من الناحية الوراثية و دور الجينات(المورثات)في اإلصابة بالمرض ولن نتطرق إلى األساليب العالجية‪.‬‬
‫الوراثة و سرطان الثدي‬
‫ال شك لدى العلماء أن سرطان الثدي من األمراض التي تنتقل بالوراثة المتعددة األسباب‪.‬فالمرأة تصاب بسرطان‬
‫الثدي إذا كان لديها استعداد وراثي يجعلها قابله لإلصابة ثم تعرضه إلى شيء ما في البيئة المحيطة بها‪.‬وعلماء الوراثة‬
‫يحاولون البحث عن الجينات التي تجعل المرأة لديها قابليه لإلصابة كما أنهم يقوم المهتمون بسرطان بشكل عام البحث‬
‫عن المسببات البيئية‪.‬‬
‫مع أننا قلنا أن سرطان الثدي ينتقل بالوراثة المتعددة األسباب إال أن هناك بعض العائالت لديها قابلية عالية لإلصابة‬
‫نتيجة لوجود عامل وراثي قوي‪.‬و بذلك قد ينتقل المرض(على شكل جين)من جيل إال أخر‪.‬و يقوم علماء الوراثة‬
‫بإجراء األبحاث الوراثية على هذه العائالت الكتشاف أنواع جديدة من الجينات‪.‬و قد تقراء في الصحف بين حين و‬
‫أخر عن اكتشاف جين جديد يسبب سرطان الثدي فتتضافر الجهود لمحاولة اكتشاف األسباب الحقيقية للسرطان والتي‬
‫قد تفيد في اكتشاف طرق حديثة للوقاية من سرطان أو إنتاج عالج جديد وفعال لهذا المرض الخبيث‪.‬‬
‫و عند تكرر سرطان الثدي في عائلة ما فليس بالضرورة أن تكون هذه اإلصابة نتيجة عن وجود عوامل وراثية قوية‬
‫في تلك األسرة‪.‬فقط تكون ناتجة عن تضافر عدة أسباب مع بعضها البعض(أي الوراثة المتعددة األسباب)أو ناتجة عن‬
‫مسرطنة في البيئة‪.‬فلذلك نستطيع أن نقول أن معظم المصابين بسرطان الثدي حدث‬
‫تعرض كل المصابين إلى مواد‬
‫ّ‬
‫لهم السرطان نتيجة لعوامل وراثية وبيئية مع بعضها البعض‪.‬بينما القليل من المصابين لديهم عوامل وراثية فقط أو‬
‫بيئية فقط‪.‬الحظ أننا استعملنا كلمة عوامل ولم نقل أسباب و السبب في ذلك هو أن الشخص الذي أصيب بسرطان كان‬
‫عنده لديه االستعداد منذ الوالدة لإلصابة بسرطان نتيجة لعطب أو خلل أو تغير في احد الجينات(ويسمى هذا التغير‬
‫بالطفرة) ولكن هذا التغيير لوحده ال يسبب في العادة بأي مرض ولكن مع مرور العمر أو بعد التعرض إلى شيء ما‬
‫في البيئة(بعض الفيروسات او المواد الكيميائية او األشعات النووية) أدى إال إصابة النسخة الثانية من الجين بالعطب‬
‫فسبب له اإلصابة بالسرطان‪.‬ولذلك تعتبر السرطانات و سرطان الثدي‬
‫‪92‬‬
‫الفحص قبل الزواج‪..‬‬
‫*بقلم ‪ :‬د ‪.‬زهير عبدهللا رهبيني )*(‬
‫كان الدكتور فالح بن زيد الفالح عضو مجلس الشورى قد أعد دراسة لتطوير النظام الصحي في‬
‫المملكة‪ ،‬قدمها إلى مؤتمر الرؤية المستقبلية الذي نظمته وزارة التخطيط ‪.‬‬
‫متنام مثل‬
‫وقد ذكر الدكتور الفالح في دراسته تطور النظام الصحي في المملكة والذي ينمو بشكل‬
‫ٍ‬
‫بقية الخدمات األخرى‪ ...‬النص التالي‪« :‬وبالرغم من هذا التطور الجيد والواضح في الخدمات‬
‫الصحية في المملكة العربية السعودية إال أن هناك مجموعة من المؤشرات التي تدل على قصور‬
‫النظام الصحي في المملكة ‪...».‬‬
‫واكتفى بذكر المؤشر األول وهو أنهَّ «ال يزال معدل وفيات الرضع (‪ 21‬في األلف )مرتفعا ً قياسا ً‬
‫إلى دول أخرى تماثل المملكة في درجة التطور ‪».‬‬
‫َّ‬
‫إن عدد الوفيات( وفيات الرضع) حتى عام ‪1405‬هـ ‪ 52‬لكل ألف مولود حي‪ ،‬وانخفضت في عام‬
‫‪1420‬هـ إلى ‪ 21‬لكل ألف مولود حي‪ .‬وال شك أن هذا إنجاز للنظام الصحي السعودي وذلك يرجع‬
‫إلى وضع االستراتيجيات للحد من الوفيات بسبب األمراض المعدية مثل استكمال برامج التطعيم‬
‫والتحصين ضد األمراض المعدية المعروفة وأيضا ً بسبب العناية األفضل بالحوامل والوالدة في‬
‫مراكز صحية مهيأة ‪.‬‬
‫إن البرامج الصحية االستراتيجية المتدرجة هي من أهم العوامل في التقليل والحد من اإلصابة‬
‫باألمراض وكذلك في التشخيص والعالج المبكر ‪.‬‬
‫وأقصد بالبرامج العملية الصحية واإلعالمية والتوعوية واالقتصادية وغيرها للتقليل والحد من‬
‫األمراض ومن هذه البرامج التي ال بد من اإلشادة بها برنامج التطعيم لألطفال حيث شمل البرنامج‬
‫خططا ً استراتيجية للحد من األمراض المعدية تتضمن النواحي الصحية والتوعوية واإلرشادية‬
‫والترتيب القائم بين وزارة الصحة ووزارة الداخلية بإضافة المولود إلى بطاقة والده بعد االنتهاء من‬
‫التطعيم األساسي ‪.‬‬
‫كل هذه األمور جعلت برنامج التطعيم يعتبر برنامجا ً ناجحا ً حيث كانت اإلصابة بشلل األطفال في‬
‫عام ‪1405‬هـ هي ‪ 29، 0‬لكل مائة ألف واآلن ال توجد إصابة تذكر وهلل الحمد والمنة ‪.‬‬
‫ونقص التهاب الكبد الوبائي (ب) حتى سن ‪ 12‬سنة من ‪ 7، 6‬لكل مائة ألف إلى‪3 ، 0‬لكل مائة‬
‫ألف من السكان ‪.‬‬
‫ً‬
‫ً‬
‫إذا ً كان السبب في نجاح النظام الصحي للتطعيم أنه كان برنامجا متكامال وليست مواعيد للتطعيم‬
‫فقط بعد توفيق هللا وعونه ‪.‬‬
‫أعود إلى عدد الوفيات في عام ‪1419/1420‬هـ وأقصد معدل وفيات الرضع حيث أنه اليزال‬
‫مرتفعا ً ‪ (21‬لكل ألف مولود حي) قياسا ً إلى دول أخرى تماثل المملكة في درجة التطور الصحي ‪.‬‬
‫إن السبب الحقيقي لهذا العدد ليس واضحا ً من المصادر الطبية المسؤولة في المملكة ولعل هذا يرجع‬
‫وضع لها سجل وطني مثل أمراض‬
‫إلى عدم وجود نظام دقيق للمعلومات إال لبعض األمراض التي ِ‬
‫األورام والسرطان ‪.‬‬
‫ً‬
‫ُ‬
‫إن تقارير الوفاة عادة غير دقيقة خاصة للرضع ألنها تمأل أحيانا حسب السبب األخير للوفاة مثل‬
‫توقف الجهاز التنفسي والدوري وال تعطي معلومات عن السبب المباشر للوفاة مثل‪ :‬أن سبب الوفاة‬
‫أحيان كثيرة تمأل تقارير الوفاة من‬
‫قد يكون بسبب األمراض المعدية أو الوراثية أو لغيرها‪ ،‬وفي‬
‫ٍ‬
‫قِبَل الطبيب المناوب الذي قد ال يكون لديه دراية كافية عن حالة المريض السابقة ‪.‬‬
‫َّ‬
‫إن انخفاض معدل الوفيات للرضع ب ‪ %60‬من عام ‪1405‬ه إلى ‪1420‬ه يعود كما ذكرت إلى‬
‫التطور الصحي ووضع البرامج للحد من األمراض المعدية‪ ،‬ولكن تبقى ما نسبته ‪ %40‬لم نعرف‬
‫لها سببا ً مباشرا ً وهي في نظري عائدة بالدرجة األولى إلى األمراض الوراثية وأخص منها أمراض‬
‫‪93‬‬
‫التمثيل الوراثية (أمراض االستقالب أو أمراض األيض ‪).‬‬
‫لقد قام مستشفى الملك فيصل التخصصي ومركز األبحاث بالرياض بدراسة استمرت لمدة ثالث‬
‫سنوات من‪ 1414‬هـ ‪1417‬هـ وذلك بأخذ عينات دم في اليوم الثاني أو الثالث لكل مولود يولد في‬
‫ثالثة مراكز (أثنين في الرياض وواحد في جدة)‪ ،‬وكان الفحص يشمل ثالثين مرضا ً من أمراض‬
‫التمثيل الغذائي‪ ،‬وقد تم مسح ثالثين ألف مولود خالل الثالث سنوات المذكورة وكانت النتيجة هي‬
‫إصابة (مولود واحد) لكل ‪ 1400‬مولود حي (ألف وأربعمائة مولود حي ‪).‬‬
‫ً‬
‫ولوضع معادلة بسيطة وهي ان طفالً واحدا ً من ألف وأربعمائة طفل يكون مصابا بأحد األمراض‬
‫الثالثين التي جرت عليها الدراسة‪ ،‬فكم يكون عدد المصابين إذا عرفنا أن أمراض التمثيل الغذائي‬
‫المعروفة تتجاوز خمسمائة مرض؟! وكم تكون اإلصابة بأحد األمراض الوراثية إذا عرفنا أنها‬
‫تتجاوز اآلن أكثر من عشرة آالف مرض؟‬
‫إن أمراض الدم الوراثية تعتبر جزءا ً بسيطا ً جدا ً من األمراض الوراثية الموجودة في المملكة‪ ،‬بل‬
‫إن كثيرا ً من األمراض الوراثية الكثيرة األخرى هي أخطر منها وموجودة في مناطق معينة معروفة‬
‫لذوي االختصاص بسبب كثرة الحاالت لهذه األمراض من مناطق معينة ‪.‬‬
‫إن أمراض الدم الوراثية موجودة في المنطقة الشرقية وجيزان وحول المدينة المنورة ولكن هناك‬
‫أمراضا ً وراثية أخرى وخطيرة في نفس الوقت في مناطق أخرى من المملكة العربية السعودية ‪.‬‬
‫وعلى سبيل المثال وليس الحصر فأمراض الحموضة في الدم )‪ (Organic Acidemia‬موجودة‬
‫بنسبة كبيرة في منطقة القويعية والمنطقة الجنوبية‪ ،‬وبعض أمراض ارتفاع األمونيا الوراثي أكثر‬
‫شيوعا ً في منطقة وادي الدواسر وفي الخرمة‪ ،‬وبعض أمراض األحماض األمينية معروفة في‬
‫منطقة الباحة‪ ،‬وأمراض التمثيل الغذائي للمواد الدهنية موجودة في المنطقة الشمالية‪ ،‬وأمراض‬
‫تخزين الجاليكوجين موجودة في منطقة المدينة المنورة‪ ،‬وأمراض ارتفاع حمض الالكتيك (أمراض‬
‫الميتوكندريا) أكثر في منطقة القصيم ‪.‬‬
‫كل األمثلة السابقة معروفة لكل من يعمل عن قرب في مجال طب الوراثة‪ ،‬كما أن كثيرا ً من‬
‫المتالزمات الناتجة عن الطفرات الوراثية أصبح لها نمط جغرافي معروف في المملكة ‪.‬‬
‫إن عيادات الوراثة في مستشفى الملك فيصل التخصصي والتي تضم حاليا ً عشر عيادات في‬
‫األسبوع لرؤية ومتابعة أكثر من مائة مريض أسبوعيا ً تستقبل ما ال يقل عن( عشرين حالة جديدة‬
‫أسبوعياً) من أمراض الوراثة الطبية والتشوهات عند الوالدة والمتالزمات المختلفة‪ ،‬وهذا يعتبر‬
‫يحول من الحاالت إلى المستشفى المذكور فكم هو العدد الفعلي للمرضى غير‬
‫جزءا ً بسيطا ً لما َّ‬
‫المحولين في وزارة الصحة أو المرضى الذين يتابعون في المستشفيات والخدمات الصحية األخرى‬
‫في كل من الحرس الوطني ووزارة الدفاع ووزارة الداخلية والمستشفيات الجامعية والقطاع‬
‫الخاص ‪.‬‬
‫إنني أرى أن على وزارة الصحة أن تضع استراتيجيات طويلة المدى تحتوي على برامج الفحص‬
‫المبكر لما قبل الزواج وأثناء الحمل وبعد الوالدة وذلك للحد من النفقات العالجية الباهظة على‬
‫األطفال المعوقين في وقت انخفضت فيه ميزانية الصرف الصحي على األفراد وذلك بسبب الزيادة‬
‫السنوية في عدد السكان التي تصل إلى ‪ ،%7، 3‬فقد كان معدل الصرف الصحي على الفرد عام‬
‫‪1404‬هـ يصل إلى ‪ 1085‬رياالً وانخفض في عام ‪1419‬هـ إلى ‪ 610‬رياالت سعودية‪ ،‬وال شك‬
‫أن وضع البرامج الصحية الوقائية سيقلل من اإلنفاق العام على الصحة على المدى البعيد ‪.‬‬
‫إذا ً يتضح مما سبق أن برنامج الفحص قبل الزواج أو البرامج الوقائية األخرى مهمة وال أظن أنه‬
‫يختلف عليها اثنان‪ ،‬وال أظن أن أهميتها ليست واضحة للمسؤولين في وزارة الصحة التي تقع عليها‬
‫مسؤولية تطبيق مثل هذه البرامج بالدرجة األولى ‪.‬‬
‫لقد قامت الوزارة بالبدء ببرنامج الفحص قبل الزواج لبعض األمراض الوبائية وأمراض الدم‬
‫‪94‬‬
‫الوراثية استنادا ً على قرار مجلس الوزراء الصادر في محرم ‪1423 /‬هـ ‪.‬‬
‫وقبل أن أعطي رأيي في البرنامج المذكور البد من شكر القائمين على هذه البرامج ألنها بدأت‬
‫تضعها ضمن النظام الصحي السعودي‪ ،‬كما أن الفحص قبل الزواج لم يبدأ حقيقة كبرنامج متكامل‬
‫كما هو الحال لبرنامج التطعيم مع اختالف آلية البرنامجين ‪.‬‬
‫إن الزواج ليس فحصا ً طبيا ً فقط بل هو ارتباط شرعي واجتماعي وله مداخالت كثيرة يجب التعامل‬
‫معها كبرنامج وطني في مجتمع متحفظ على مثل هذه األمور ‪.‬‬
‫فهو أوالً مقتصر على أمراض الدم الوراثية التي تنتشر في مناطق معينة في المملكة فليس من‬
‫األولوية أن تعمم على مناطق أخرى في المملكة ال يوجد بها مثل تلك األمراض‪ ،‬فمثالً منطقة‬
‫القصيم ليست من المناطق التي يوجد بها أمراض الدم الوراثية فلماذا يعمم مثل هذا الفحص على‬
‫تلك المنطقة !!‬
‫إن من أهداف أي نظام صحي أن تقوم أهدافه على معقولية التكاليف وأن تقوم على أسس علمية‬
‫صحيحة ‪.‬‬
‫نعم يمكن تطبيق مثل هذا البرنامج على المناطق التي تنتشر بها هذه األمراض وأن تكون بشكل‬
‫متكامل ومتوازن يراعي الجوانب الشرعية واألسرية واالجتماعية والطبية واالقتصادية وغيرها ‪.‬‬
‫لو أردنا تطبيق هذا البرنامج على المنطقة الشرقية ومنطقة جيزان وحول منطقة المدينة المنورة‬
‫حيث تكثر بها أمراض الدم الوراثية فهل وضعنا االعتبارات اآلتية ‪:‬‬
‫‪1‬كل برنامج للفحص قبل الزواج في العالم يجب أن يضم عيادات استشارية للمشورة الوراثية عند‬
‫ظهور أي عينة إيجابية فليس من العدل أن يكون الفحص اجباريا ً أو شبه إجباري وكما ال توجد مثل‬
‫هذه العيادات التي يجب أن تدار بأيد متدربة في هذا المجال ‪.‬‬
‫إن علم الطب الوراثي أصبح علما ً مستقالً يضم تحته تخصصات كثيرة منها الطب الوراثي‬
‫األكلينيكي وتخصص أمراض التمثيل الغذائي وتخصص الوراثة الجزيئية‪ ...‬ومنها تخصص‬
‫معروف في المشورة الطبية الوراثية ‪ (Genetic Counselling).‬فالسؤال كم عيادة استشارية‬
‫موجودة وموازية لمثل عدد الحاالت التي ستظهر إيجابية‪ ،‬هل هناك برنامج لتدريب الكوادر‬
‫السعودية لتغطية مثل هذا البرنامج الحقا ً ‪.‬‬
‫وهنا أريد أن أؤكد أن الفحص قبل الزواج ليست عينة دم تؤخذ ولكنه برنامج صحي متكامل ‪.‬‬
‫إن برنامج الفحص قبل الزواج يرتب إداريا ً من قبل اللجنة الوطنية لألمراض الوراثية التي تضم‬
‫تسعة أعضاء اثنان منهم يحملون شهادة التخصص في الطب الوراثي وكنت أتمنى أن يكون معظم‬
‫أعضاء اللجنة أو على األقل أكثر من ‪ 50%‬منهم لهم عالقة بالتخصص المذكور وذلك ألن وضع‬
‫برنامج الفحص قبل الزواج يحتاج إلى أصحاب التخصص للنظرة الشمولية لألمراض الوراثية‬
‫بالمملكة ‪.‬‬
‫‪2‬إن الفحص قبل الزواج وتبعاته الالحقة يجب أن يتم بسرية كاملة لتفادي الوصمة االجتماعية‪،‬‬
‫فهل أخذ في االعتبار كيف يتم ذلك ضمن البرنامج المذكور خصوصا ً في مجتمعنا حيث االعتبارات‬
‫االجتماعية واألسرية ال تخفى على أحد ‪.‬‬
‫ولعلي أوضح أكثر لو أن (س) أقبل على الزواج من (ص) وبالفحص قبل الزواج تبين أن (س)‬
‫يحمل موروثات الدم المنجلية‪ ،‬فكيف تحفظ سرية هذا الفحص في مجتمعنا الذي قد يكون لمثل فصل‬
‫هذا الزواج تبعات اجتماعية لم نأخذ حسابها ضمن البرنامج ‪.‬‬
‫وكمقدمة لفكرة الفحوصات المختلفة الموجودة فإنه كما هو معروف أن اإلنسان يتكون من أجهزة‬
‫وأعضاء تتركب من ماليين الخاليا‪ .‬والخلية هي الوحدة األساسية للمخلوق الحي حيث تحتوي‬
‫بداخلها على النواة والتي تحمل الحقيبة الوراثية ‪.‬‬
‫والحقيبة الوراثية تتكون من ست وأربعين صبغة وراثية في الخاليا الجسدية مثل خاليا الدم و الجلد‬
‫‪95‬‬
‫والشعر وغيرها أما الخاليا الجنسية (الحيوانات المنوية والبويضات) فتحتوي على ثالث وعشرين‬
‫صبغة وراثية (كروموسومات ‪).‬‬
‫تكون البروتينات‬
‫تحتوي الكروموسومات على المورثات (الجينات) وهي الشيفرة الوراثية التي ّ ِ‬
‫المختلفة في الجسم مثل األنزيمات أو الهرمونات أو هيموجلوبين الدم وغيرها من مئات البروتينات‬
‫التي تقوم بوظائف الجسم المختلفة ‪.‬‬
‫إن المرض الوراثي يعني تغيُّرا ً في الشيفرة الوراثية وهو ما يعرف بالطفرة التي تتسبب في إنتاج‬
‫بروتين ناقص أو غير طبيعي ‪.‬‬
‫ومثال ذلك أن حدوث طفرة في مورثة الهيموجلوبين قد يؤدي إلى هيموجلوبين غير طبيعي يظهر‬
‫عمليا ً بشكل مرض الدم المنجلي أو أنيميا حوض البحر المتوسط( التالسيميا) أو غيرها من أمراض‬
‫الدم الوراثية ‪.‬‬
‫ويمكن فهم السابق بالمعادلة اآلتية‪ :‬طفرة في المورثة (الجين) ‪ 3‬بروتين غير طبيعي ‪ 3‬وظيفة غير‬
‫طبيعية (مرض ‪).‬‬
‫ويمكن تلخيص فحوصات حاملي المرض فيما يلي ‪:‬‬
‫‪1‬العالمات السريرية‪ :‬يمكن للمتخصص في الطب الوراثي معرفة بعض األعراض التي تظهر‬
‫على حاملي بعض األمراض الوراثية خصوصا ً األمراض الوراثية السائدة (أي أن مورثة واحدة‬
‫كافية لنقل المرض إلى ‪ 50%‬من األطفال) أو األمراض الوراثية المرتبطة بالصبغة السينية‬
‫)‪(Chromosome X‬ويمكن مساندة الفحص السريري بالدراسات المختبرية كالتخطيط‬
‫الكهربائي للعضالت أو التخطيط الكهربائي للعين أو عمل األشعات وغيرها من الفحوصات ‪.‬‬
‫‪2‬تحليل لناتج المورثة‪ :‬ومثال ذلك أمراض الدم الوراثية حيث باإلمكان قياس نوع الهيموجلوبين في‬
‫الدم ومعرفة نسبه الطبيعية وغير الطبيعية وبالتالي يمكن معرفة الحامل للمرض‪ ،‬ولكن تبقى هذه‬
‫الطريقة محدودة ألمراض معينة حيث إن كثيرا ً من األمراض الوراثية ال يعرف فيها طبيعة نوع‬
‫البروتين المصاب‪ ،‬أو أنه يُعرف ولكن تبقى الطريقة مكلفة وتؤدى فقط في مختبرات األبحاث ‪.‬‬
‫‪3‬التغيرات الثانوية لبعض المواد الكيميائية في الدم‪ :‬بعض األمراض الوراثية قد تؤدي إلى تغيرات‬
‫كيميائية ثانوية يمكن معرفتها على المريض أو حامل المرض مثل ازدياد مادة الكرياتين في بعض‬
‫أمراض حثل العضالت ‪.‬‬
‫ولكن تبقى هذه الطريقة أيضا ً محدودة كما أن حساسية االختبار ليست دقيقة أيضا ً ‪.‬‬
‫‪4‬المورثات ‪:‬بعد اكتشاف الخارطة الوراثية أو الجينوم البشري (المجين) أصبح باإلمكان معرفة‬
‫أماكن المورثات لكثير من األمراض الوراثية كما أن الطفرات الجينية قد تمت دراستها على كثير‬
‫من األمراض‪ .‬ويمكن إجراء تحليل الطفرات الوراثية مباشرة على كثير من األمراض ‪.‬ولكن يجب‬
‫التنبيه على أن الطفرات الوراثية أو التغيرات في المورثات تختلف من مجتمع إلى آخر‪ ،‬وعلى‬
‫سبيل المثال فإن الطفرات في مورثة التليف الكيسي الرئوي ُو ِجد أنها تختلف في المجتمع السعودي‬
‫عنها في الغرب حسب الدراسات التي تمت ونشرت ‪.‬‬
‫وفي نظري إن هذه أهم طريقة لفحص حامل المرض وأنها أفضل طريقة يمكن تطبيقها على‬
‫الفحص قبل الزواج لكثير من األمراض الوراثية المنتشرة في المملكة (غير أمراض الدم الوراثية‬
‫التي يمكن النظر إلى الهيموجلوبين غير الطبيعي مباشرة ‪).‬‬
‫ولكن قبل تطبيق هذه الفحوصات البد من دراسة الطفرات الوراثية لكثير من األمراض في المملكة‬
‫وهذا الجهد يقع على وزارة الصحة ومراكز األبحاث والجامعات في المملكة ‪.‬‬
‫وهنا أريد أن أؤكد أن األمراض الوراثية ليست فقط أمراض الدم الوراثية بل هي عشرات من‬
‫األمراض التي تنتشر في المملكة حسب العوائل والقبائل في المناطق المختلفة ‪.‬‬
‫إن المتخصص في الطب الوراثي أصبح يعرف ما هي األمراض الوراثية المنتشرة في كل منطقة‬
‫‪96‬‬
‫وفي كل قبيلة من واقع اإلحاالت اليومية إلى المستشفيات التخصصية ‪.‬‬
‫ويمكن تطبيق الفحوصات السابقة بأن يحدد فحص ما قبل الزواج ألمراض الدم الوراثية للمنطقة‬
‫الشرقية ومنطقة جيزان وحول منطقة المدينة المنورة‪ ،‬أما المناطق األخرى فينظر في طريقة فحص‬
‫المورثات مباشرة ألمراض وراثية محددة حسب انتشارها في كل منطقة ‪.‬‬
‫إن األنظمة الصحية في العالم متعددة وال يوجد نظام مثالي إال أن النظام الصحي ألي بلد البد أن‬
‫يعكس الرؤية االستراتيجية المتكاملة للمؤسسة التنفيذية ولكن القاسم المشترك لألنظمة الصحية‬
‫الجيدة هو طبيعة تحقيقها ألهداف معينة منها ‪:‬‬
‫‪1‬التغطية الشاملة والعادلة لكل المواطنين ‪.‬‬
‫‪2‬أن تكون ذات تكلفة معقولة ‪.‬‬
‫‪3‬أن تتم على أسس علمية صحية ‪.‬‬
‫ولو حاولنا إنزال هذه األهداف على الفحص قبل الزواج كبرنامج من برامج النظام الصحي فالبد أن‬
‫يكون برنامج الفحص قبل الزواج شامالً لكل مناطق المملكة مدنها وقراها ‪.‬‬
‫ولكن البد أن يكون الفحص عادالً بحيث ينظر لألمراض الشائعة في كل منطقة أو قبيلة‪ ،‬فليس من‬
‫العدل أن يُنظر إلى أمراض غير موجودة في حين أنها أحوج إلى الفحص المبكر ألمراض أخرى‬
‫أكثر أهمية بالنسبة لهم ‪.‬‬
‫إن برامج الفحص قبل الزواج موجودة ومطبقة في دول أوروبا والواليات المتحدة األمريكية وكندا‬
‫وغيرها ولكنهم يصنفون هذه الفحوصات حسب العرق الموجود وعلى سبيل المثال فاألمريكان ذوو‬
‫البشرة السوداء لهم فحوصات معينة واألمريكان من أصول أوروبية لهم فحوصات خاصة بهم كما‬
‫أن يهود أمريكا لهم فحوصات متعلقة بأمراضهم ‪.‬‬
‫والبد أن يكون البرنامج ذا تكلفة معقولة‪ ،‬وهنا أؤكد أن تعميم الفحص على أمراض الدم الوراثية‬
‫لكل مناطق المملكة يضع األموال في غير مكانها الصحيح وإهدار للجهد‪ ،‬إذ كيف يمكن فرض‬
‫الفحص بتكاليف قد تكون باهظة على منطقة ال يوجد بها مثل هذه األمراض‪ .‬كما أن اختيار‬
‫األمراض أو المورثات للفحص يجب أن يقوم على ضوابط وأسس ودراسات علمية صحية لذلك‬
‫البد من مشاركة أهل الخبرة في مثل هذه البرامج وأخص منهم العلماء وأطباء الوراثة والمرشدين‬
‫الوراثيين واألخصائيين االجتماعيين وغيرهم حيث إن هذا البرنامج هو برنامج وطني يحتاج‬
‫لمشاركة الجميع من ذوي االختصاص ‪.‬‬
‫هنا يتبادر إلى الذهن السؤال التالي‪ :‬هل برنامج الفحص قبل الزواج يكون اختياريا ً أم إجبارياً؟‬
‫والجواب في الحقيقة يحتاج إلى مقال آخر ولكن أُلخص ما أراه في النقاط التالية ‪:‬‬
‫‪1‬إن أكثر الدول التي سبقتنا إلى وضع برامج الفحص قبل الزواج جعلته اختياريا ً وليس إجبارياً‪،‬‬
‫ومن جعله إجباريا ً لم يربط نتيجة الفحص على العالقة الزوجية مباشرة بل جعلوا الفحص إجباريا ً‬
‫واإلقدام على الزواج اختياريا ً بغض النظر عن نتيجة الفحص ‪.‬‬
‫والسبب في نجاح تلك البرامج على الرغم من أنها اختيارية أنهم تبنوها كبرنامج متكامل يشمل‬
‫القضايا التعليمية والتوعوية منذ المراحل األولى من الحياة فهو جزء من التعليم وجزء من البرامج‬
‫التوعوية اإلعالمية وجزء من الرعاية الصحية األولية وغيرها‪ .‬لذلك أصبح هناك قناعة جماهيرية‬
‫ووطنية في تلك الدول بأهمية هذه الفحوص وتطبيقاتها في الحياة ‪.‬‬
‫‪2‬إن الزواج هو قضية شرعية وقانونية لذلك كان لعلماء الدين واالجتماع آراؤهم القوية في مثل‬
‫هذه الفحوصات في تلك الدول ‪.‬‬
‫إن العالقة الزوجية واالرتباط القلبي بين الرجل والمرأة المقدمين على الزواج ال يمكن منعها بجعل‬
‫الفحص إجباريا ً أو اختياريا ً إذا لم يكن هناك قناعة نفسية لمثل هذه اإلجراءات ‪.‬‬
‫ومع الحماس لمثل هذا البرنامج في المملكة فإني لم أسمع رأي علمائنا األفاضل بإقرار إجبارية‬
‫‪97‬‬
‫الفحص قبل الزواج ورأي اإلسالم في جعله إجباريا ً وليس اختيارياً‪ ،‬وأقصد هنا هيئة كبار العلماء‬
‫أو غيرها من الهيئات الشرعية في المملكة العربية السعودية ‪.‬‬
‫‪3‬يوجد في الدول التي تطبق برامج الفحص قبل الزواج العيادات االستشارية ألمراض الوراثة‬
‫وخاصة العيادات االستشارية لما قبل الزواج فكثيرا ً ما يأخذ المقدمون على الزواج موعدا ً لمناقشة‬
‫كل األمور التي لها عالقة باألمراض الوراثية‪ ،‬وال أقصد أن نؤسس عندنا مثل هذه العيادات بدون‬
‫النظرة الشرعية لمجتمعنا ولكن باإلمكان االستفادة من الفكرة وتكييفها لتتماشى مع عاداتنا وتقاليدنا ‪.‬‬
‫وهنا سؤال آخر‪ :‬ما هو أفضل وقت لعمل هذه الفحوصات‪ ،‬هل يكون بعد الوالدة أم في سني‬
‫الدراسة أم قبل الزواج مباشرة؟‬
‫إن أخذ العينات من المواليد الجدد من أجل المعرفة هل هم يحملون مورثات مرضية معينة أم ال‬
‫تعتبر مسألة شائكة قانونيا ً في المجتمعات غير اإلسالمية حيث ينظر إلى هذه المورثات بدون أخذ‬
‫الحق من اإلنسان نفسه وهو في هذه الحالة المولود الجديد مما أثار قضايا قانونية‪ ،‬باإلضافة إلى‬
‫حفظ سرية المعلومات وما يتبع ذلك من قضايا تخص اإلنسان وعالقته بشركات التأمين ‪.‬‬
‫كما أن أخذ العينة للفحص كما هو مقرر عندنا في المملكة غير مناسب والسبب أن العالقة النفسية‬
‫واالجتماعية بين الخاطب ومخطوبته في أحيان كثيرة تكون قد بدأت قبل الفحص وفي رأيي أن هذا‬
‫قد يسبب إحراجا ً كبيرا ً إذا انقطعت هذه العالقة بسبب فحص الدم‪ ،‬فالمجتمع واألقارب ال يعرفون‬
‫عرف السبب كانت مصيبة وإذا لم يعرف كانت‬
‫سبب هذا الفصل مما يثير تساؤالت كثيرة فإذا ُ‬
‫المصيبة أكبر ‪.‬‬
‫وأنا أؤكد هنا أن الناس ال زالوا يجهلون طبيعة األمراض الوراثية ومعنى المرض وحامل المرض‬
‫فبكل بساطة يمكن أن يوصم اإلنسان بأنه مريض وراثيا ً وتبقى وصمة اجتماعية في حين أنه ربما‬
‫يحمل مورثات للمرض فقط وهذا شيء طبيعي فكل إنسان يحمل عددا ً من هذه المورثات المرضية‬
‫التي يمكن أن ينقلها كمرض إلى أبنائه إذا كانت زوجته تحمل نفس الطفرات الوراثية ‪.‬‬
‫ومن هنا فإنني أرى أن يكون أنسب وقت لعمل هذه الفحوصات على الرجال والنساء هو عندما‬
‫يكون المواطن طالبا ً أو طالبة في الثانوية العامة وقبل أن يرتبطا بالزواج ‪.‬‬
‫وهذه التجربة أثبتت نجاحها عندما طبقت على اليهود االشكنازي في والية نيويورك بالواليات‬
‫المتحدة األمريكية فقد انتشرت بين هذا العرق أمراض وراثية خطيرة وكانت هناك إشكاالت في‬
‫التشخيص أثناء الحمل ومن ثم اإلسقاط العالجي إذا ثبت إصابة الجنين بأحد هذه األمراض فوضع‬
‫المتخصصون برنامجا ً متكامالً وهو أخذ عينات الدم لفحص المورثات لما يقارب عشرة أمراض‬
‫وراثية من طلبة وطالبات الثانوية وترسل هذه العينات إلى مركز للتحاليل برقم معين وال يذكر‬
‫خاللها اسم الشخص مطلقا ً ‪.‬‬
‫والسبب في عدم ذكر االسم هو للحفاظ على السرية تماما ً وال يعرف رقم العينة إال صاحبها ‪ ،‬وبعد‬
‫ذلك تحفظ المعلومات حتى يأتي موعد الخطوبة وقبل كل ذلك يتم التأكد من الرقمين في مركز‬
‫التحاليل هل هي متوافقة أم غير متوافقة وعندها يُشرع أيضا ً بإعطاء المشورة الوراثية بشكل غير‬
‫مباشر ويترك الخيار أخيرا ً للرجل والمرأة ‪.‬‬
‫لقد أثبتت التجربة السابقة نجاحها حيث كانت هذه األمراض شائعة وبعد هذه التجربة خالل العشرين‬
‫سنة الماضية قلت بشكل كبير حتى أنها أصبحت تحت مستوى انتشارها العام في الواليات المتحدة‬
‫األمريكية ‪.‬‬
‫إن السبب المباشر في نجاح هذا البرنامج أنه لم يرتبط بأسبوع أو أسبوعين قبل الزواج بل كانت‬
‫هناك استراتيجية بعيدة المدى كما أن البرنامج يحفظ السرية الكاملة لمن يريد الفحص ويتضمن‬
‫القضايا الدينية واالجتماعية والتعليمية أي أنه برنامج متكامل وليس مجرد عينة دم تؤخذ قبل‬
‫الزواج‪ .‬إن هذه التجربة يمكن تطويرها وترتيبها بحيث تصبح أكثر مالءمة لوضعنا الديني‬
‫‪98‬‬
‫واالجتماعي وربما اختيار الموعد األنسب عند تعميمها على مختلف مناطق المملكة بحسب‬
‫األمراض الشائعة في كل منطقة أو قبيلة ‪.‬‬
‫وفي النهاية لعلي أخلص إلى النقاط اآلتية ‪:‬‬
‫أوالً‪ :‬تبني الفحص قبل الزواج كبرنامج متكامل ‪.‬‬
‫ثانياً‪ :‬البدء ببرنامج الفحص المبكر للمواليد وجعله إجباريا ً قبل التوسع في برنامج الفحص قبل‬
‫الزواج ‪.‬‬
‫ثالثاً‪ :‬إشراك عدد أكبر من استشاريي الطب الوراثي في اللجنة الوطنية لألمراض الوراثية بحيث‬
‫يمثلون ‪ %50‬على األقل من أعضاء اللجنة ‪.‬‬
‫رابعاً‪ :‬النظر في وقت الفحص وجعله في مرحلة مبكرة قبل الشروع في الزواج وتحديد الخاطب‬
‫لمخطوبته والحفاظ على سرية المعلومات وتفادي الوصمة االجتماعية ‪.‬‬
‫خامساً‪ :‬الشروع في إنشاء عيادات استشارية للفحص قبل الزواج تضم طبيبا ً متخصصا ً ومرشدا ً‬
‫وراثيا ً على األقل ‪.‬‬
‫سادساً‪ :‬مشاركة الوزارات األخرى مع وزارة الصحة في دعم هذا البرنامج وأخص بالذات وزارة‬
‫التربية والتعليم ووزارة الثقافة واإلعالم لوضع استراتيجيات تعليمية وتوعوية عن األمراض‬
‫الوراثية والفحص المبكر لألمراض الوراثية التي تشمل فحص ما قبل الزواج وأثناء الحمل‬
‫والفحص المبكر للمواليد الجدد ‪.‬‬
‫سابعاً‪ :‬وضع برامج أكاديمية من خالل الكليات الصحية والطبية للتخصص في هذا المجال سواء في‬
‫مجال التشخيص أو العالج أو المشورات الطبية ‪.‬‬
‫هذه بعض االقتراحات والرؤية المستقبلية لبرنامج الفحص قبل الزواج فما كان صوابا ً فمن هللا وما‬
‫كان خطأ ً فمني ومن الشيطان ‪.‬‬
‫وصلى هللا على نبينا محمد وآخر دعوانا أن الحمد هلل رب العالمين ‪.‬‬
‫(*) استشاري طب األطفال والطب الوراثي بمستشفى الملك فيصل التخصصي ومركز األبحاث‬
‫بالرياض‪.‬‬
‫مستقبلية‬
‫‪.....‬رؤية‬
‫‪.....‬الرجوع‬
‫الفحص قبل الزواج‪ ..‬البد أن يصبح برنامجا ً صحيا ً وطنيا ً يأخذ في االعتبار خصوصية مجتمعنا‬
‫الزواج‪..‬‬
‫قبل‬
‫الفحص‬
‫مستقبلية‬
‫رؤية‬
‫الفحص قبل الزواج‪ ..‬البد أن يصبح برنامجا ً صحيا ً وطنيا ً يأخذ في االعتبار خصوصية مجتمعنا‬
‫‪99‬‬