* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download MCDB 1041 3/15/13 Working with DNA and Biotechnology Part I
Epigenetics wikipedia , lookup
Genome evolution wikipedia , lookup
Epigenetics in learning and memory wikipedia , lookup
DNA barcoding wikipedia , lookup
Gene therapy wikipedia , lookup
Human genome wikipedia , lookup
Genetically modified food wikipedia , lookup
DNA profiling wikipedia , lookup
DNA polymerase wikipedia , lookup
Metagenomics wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Primary transcript wikipedia , lookup
Cancer epigenetics wikipedia , lookup
SNP genotyping wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Genealogical DNA test wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Genetic engineering wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Genomic library wikipedia , lookup
DNA vaccination wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Non-coding DNA wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
DNA supercoil wikipedia , lookup
Designer baby wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Point mutation wikipedia , lookup
Microsatellite wikipedia , lookup
Epigenomics wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Molecular cloning wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Microevolution wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Genome editing wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Helitron (biology) wikipedia , lookup
MCDB 1041 3/15/13 Working with DNA and Biotechnology Part I: Working with DNA You work in a clinic doing prenatal testing and genetic counseling. You use PCR analysis combined with restriction enzyme digests to determine whether fetuses are affected by cystic fibrosis, caused by a mutation on both copies of chromosome 7, in the cystic fibrosis (CF) gene. Below is a region of DNA (from the middle of the CF gene). Sequence of normal CF gene: 5’ ACGCCGCTACGT TAGACTTCGCTACAAGACGG 3’ 3’ TGCGGCG ATGCAATCTGAAGCGATGTTCTGCC 5’ Sequence of mutant CF gene 5’ ACGCCGCTACGT TAGAATTCGCTACAAGACGG 3’ 3’ TGCGGCG ATGCAATCTTAAGCGATGTTCTGCC 5’ 1. Circle the mutation in the sequence above. One of the restriction enzymes (R.E.) you can use cuts at the following sequence, at the stars: G*AATTC CTTAA*G 2. Mark on the sequence(s) above where this R.E. will cut the DNA. You have been charged with doing DNA analysis on three recently born babies. You determine that one child is normal (no mutations in the cystic fibrosis gene on chromosome 7), one is a carrier (one mutation), and one has cystic fibrosis (a mutation on each chromosome)—see the diagram below. The line in the diagram indicates the site of the mutation within the CF gene that you just found in questions 8 and 9 above. The CF gene DNA is isolated from cells from the fetus’ cells by PCR, and is 10 KB in length. The restriction enzyme shown above cuts the mutant CF gene into two pieces (7 kb and 3 kb). You cut your samples of DNA from each fetus, and then run the DNA on the gel. Ch. 7 Ch. 7 Ch. 7 normal Ch. 7 Ch. 7 Cystic fibrosis Ch. 7 carrier 3. What would you expect to see when you run the gel? Draw the bands each child has. Make sure to indicate the correct intensity of each band (ie, more DNA, darker band). Child A is normal. Child B has cystic fibrosis Child C is a carrier A B C 12 KB 11 KB 10 KB 9 KB 6 KB 3 KB 1 KB 4. Below is a pedigree showing inheritance of an autosomal recessive disease. Carriers are marked. The gene being analyzed is 15 KB in length normally. The mutation is a deletion of 2 KB. For each individual, imagine you have done PCR to amplify just this gene sequence from their DNA. For each numbered individual, draw in the band(s) of DNA on the gel that would result from the PCR. 1 2 1 __ 2 3 4 5 ladder 20 15 3 4 5 10 8 6 + 5. Let’s say you are testing newborns to see if they have or are carriers of an X-linked recessive disease, hemophilia (due to a mutation in “coagulation factor VIII” –also called “F8”-- which results in failure of blood to clot properly). a. Using the white boards: make up a pedigree for three generations that shows unaffected, affected and carrier individuals in a pedigree for hemophilia. You can copy your pedigree into the space below, so you can refer back to it later. b. Say that the F8 gene is 15 KB in length. If you wanted to analyze whether individuals in a family had or carried hemophilia before they showed any symptoms, what kind of mutations would you be able to assay using just PCR and gel electrophoresis. What kind of mutations could you assay using PCR, restriction enzyme digests and gel electrophoresis? c. Imagine that the mutation you are assaying that leads to hemophilia is a single base change that removes a restriction enzyme site. If that site is normally at the 5 KB point of the gene, indicate what results would be expected for unaffected, affected and carrier individuals by drawing a gel and drawing the pattern on the gel expected for your analysis of each individual in the pedigree. Part II Biotechnology: Genetically Modified Foods What is a genetically modified food? The U.S. is one of the primary producers of GMO foods in the world. The creation of GMOs involves using recombinant DNA technology to place genes from one organism into another of a different species to confer a useful trait. For example, the company Monsanto developed a pest-resistant potato plant by incorporating a gene from a soil bacterium into the genome of a potato plant: this gene produces a compound that kills the Colorado Potato Beetle. These potatoes are commercially grown in the U.S. The pesticide that used to be sprayed on the potatoes to fight the beetle is no longer necessary. How do you generate the recombinant DNA that is used to make a GMO? M C D B 1041 A ctivity 8: Biotechn Let’s take the creation of a product called “golden rice” as an example. Vitamin A deficiency is a problem in the developing world, especially for pregnant women and Part I: Genetically Modified Foods children. Nearly 400 million people in the world are at A risk of a vitamin A deficiency, hich can lead to especially Vitamin deficiency is a problem in thewdeveloping world, blindness and an increase in the severity of infections i n y oung c hildren. F oods l ike c arrots, s weet 400 million people in the world are at risk of a vitamin A deficiency, w potatoes, and spinach contain β-‐carotene (precursor to invitamin A), but hese foods re not children. always Foods like carr increase the severity of tinfections in ayoung available in the developing world. By adding a E-carotene gene called p hytoene s ynthase ( psy) f rom the dare affodil (precursor to vitamin A), but these foods not always ava plant, plus a promoter region that determines where the gene will be expressed, β-‐carotene will accumulate in the rice grain, and be converted Imagine into Vitamin before eing harvested. rice that would contain Vi your A goal is to bgenerate engineered phytoene synthase (psy) from the daffodil plant, plus a promoter region To make golden rice, we first need to generate expressed, recombinant DNA. Twill o do accumulate this, we use acterial E-carotene inthe thebrice grain.system described in class. We need to put different pieces of DNA together and then amplify them, which is why we use this technique as opposed to just PCR. The picture below represents a piece of double-stranded DNA from da phytoene synthase gene (psy), as well as additional sequences of DNA The picture at right represents a piece of double-‐ stranded DNA from daffodil. This DNA E P B H B includes the daffodil phytoene synthase gene (psy), as well as additional sequences of DNA. Each line represent 1 Kilobase (1KB). Each line represent 1 Kilobase (1KB). You can amplify this 12 KB seq using PCR. This DNA sequence can be cut by 4 different restriction enzymes E=Eco RI This DNA sequence can be cut by 4 different restriction enzymes (deno P=Pst1 of the nucleotide sequences that occur at two of these restriction enzym B=BglII the REs. H=HindIII). Letter on the DNA Restriction Enzyme Recognition Name of Below is a list of the nucleotide sequences that sequence occur at two of these restriction sites, along with Enzyme and cuttingenzyme sequence the actual names of the REs. The psy gene is bE etween the E and H restriction G* A Aenzyme T T C sites. Eco RI Letter on the DNA Restriction Enzyme Recognition Name of Restriction C T T A A *G sequence and cutting sequence Enzyme P C T G C A*G Pst I E G* A A T T C Eco RI G *A C G T C C T T A A *G H C T G C A*G Hind III of DNA shown below, find the restriction enzyme 1. In the strand G *A C G T C TATAAGATTGCGATGCCCTGCAGCTATTCGGCTGCCTAAAA 1. In the strand of DNA shown below, find the restriction enzyme sites. ATATTCTAACGCTACGGGACGTCGATAAGCCGACGGATTTT TATAAGATTGCGATGCCCTGCAGCTATTCGGCTGCCTAAAATCGGCCCCTAAGAATTCTTATCG ATATTCTAACGCTACGGGACGTCGATAAGCCGACGGATTTTAGCCGGGGATTCTTAAGAATAGC If this sequence (above) of DNA were cut with both enzymes, how ma If this sequence (above) of DNA were cut with both E and H restriction enzymes, many pieces would be These restriction enzymes producehow ³sticky ends´ created? ²where DNA nucleotides are not bound to their pair. Thus, they can be easily hooked up to another piece that has the complementary unbound nucleotides: 2. You search a database and learn that the psy gene you want to isolate begins at 2 KB and ends at 6 KB in the piece of double stranded DNA in the diagram above. If you cut the DNA with a variety of different restriction enzymes (shown below with the letter of the restriction enzyme that was used to cut the DNA): which band on the gel below contains your gene of interest? (write the lane and the band size) 2. Find the band (circle it) on the gel below that contains that should contain the psy gene of interest. E P B H H+ E B+P Ladder(DNA of known sizes for referen ce) 12 KB 11 KB 10 KB M C D B 1041 A ctivity 8: B iotechnology 9 KB Pa r t I : G enetically M odified F oods 6 KB Vitamin A deficiency is a problem in the developing world, especially for pregnan 3 KB 400 million people in the world are at risk of a vitamin A deficiency, which can le increase in the severity of infections in young children. Foods like carrots, sweet 1 KB E-carotene (precursor to vitamin A), but these foods are not always available in th Imagine your goal toband generate engineered that would 3. You cut the daffodil psy is DNA out of the gel and purify rice the DNA from the gel. contain Now you wVitamin ant to add A. B phytoene synthase (psy) the plant, plus a gel promoter region that determ 3. another You cut pthe daffodil psy out the geldaffodil and purify the specialized iece of DNA to DNA this pband iece: from the ofphyotene desaturase (DNA crt 1) from gene the from ausing soil baacterium . Tkit. hese expressed, E-carotene in the grain. You want to put the daffodil gene What two genes together will apsy llow fwill or tinto he accumulate rthe ice plasmid seed to cbelow. ontain beta rice crestriction arotene. enzymes should you use to cut the plasmid? Why? Thecrt1 picture represents a piece of double-stranded DNA from daffodil. This The gene is rbelow epresented Bgl II below, with letters to indicate the location of restriction enzyme sites (the Phosphomannose phytoene synthase ast twell as additional sequences of DNA. lines no longer represent 1gene KB, so (psy), just look he location of the RE sites). HindaIII isomerase 100 bases Eco RI selectable marker 100 bases E P B Pst I H B B P B E 150 bases Bgl II ori Crt gene. sequence xtends from (1KB). P to E sites.You can amplify this 12 KB sequence from Each line Coding represent 1 eKilobase 4. using How many pieces of DNA will result from cutting this circular plasmid? PCR. 5. If Your ultimate goal is to generate rice that expresses psy gene in the of the rice,bwhere you w ant these two genes tcan o be hbe ooked in by sequence, and put from irestriction nto tdaffodil he bacterial pseed lasmid shown elow, by E, P This DNA sequence cut 4 the different enzymes (denoted it with willthe provide b-carotene those it. that back from the beginning, outline the steps you should take the nucleotide crt1 gene in fto ront of eating the psy gStarting ene: occur of sequences at two of these restriction enzyme sites, alo toa. make this happen. [you may find it useful tose return toothe map you made in class on Wednesday to get W hat r estriction e nzymes s hould y ou u t o c ut ut t he c rt g ene? the REs. started] b. What restriction enzymes should you then use to cut the plasmid (you want to put BOTH genes into the Letter on the DNA Restriction Enzyme Recognition Name of Restriction You have: to be replicated as a unit) plasmid sequence and cutting sequence Enzyme Daffodil DNA E G* A A T T C Eco RI PCR primers that flank the PSY gene C T T A A *G Any of the above Restriction enzymes. 9:/$..$ P T G called C A*G Pst factors I A fragment of DNA containingCa promoter GLU that is only bound by transcription in the %&'()&'*+,,'(-$ .('*-"+(-$ G *A C G T C endosperm (basically the seed of the plant, which is the rice): 4#,5$...$ (-/-01+2/-$*+"3-"$ B P E H 60'$7.$ Bacterial plasmid (see diagram above) %(1$8$ GLU 9:/$..$ shown below, find the restriction In the strand of DNA enzyme sites. 1. Bacteria Rice seeds TATAAGATTGCGATGCCCTGCAGCTATTCGGCTGCCTAAAATCGGCCC ATATTCTAACGCTACGGGACGTCGATAAGCCGACGGATTTTAGCCGG !"#$ If this sequence (above) of DNA were cut with both enzymes, how many pieces w These restriction enzymes produce ³sticky ends´ ²where DNA nucleotides are not bound to their pair. Thus, they can be easily hooked up to another piece that has the complementary unbound nucleotides: 4. Once you cut and piece all your DNA sequences back together, you’ll have a plasmid that contains the crt and psy genes, and you can put this plasmid into bacteria to replicate. Later, when you want to isolate the DNA from the bacteria, you’ll need to know what size the DNA is. If the plasmid is 3.5 KB in size, the psy DNA is 4 KB, and the crt1 is 1 KB, draw a gel below showing the plasmid WITH the two pieces of DNA, and in a separate lane, the result of cutting the plasmid with the enzymes HindIII and Pst1. A C +P uncut cBut with H 12 9 KB KB 11 KB 8 KB 10 7 6 6 KB 4 3 KB 3 1 KB 1 9 KB Getting more copies of the recombinant DNA: The bacteria now replicate in culture, and the scientist selects the bacterial colonies that contain the recombinant DNA. 5. You might have noticed that instead of an antibiotic resistance selectable marker on the plasmid there is a phosphomannose isomerase selectable marker. Why might you want to use the phosphomannose isomerase selectable marker instead of the antibiotic resistance gene normally present in these plasmids? Creating the genetically modified plant In making transgenic plants, it is relatively easy to get the recombinant piece of DNA into the plant. The plasmid containing the recombinant DNA is incorporated into the genome of a bacterium called Agrobacteria. These bacteria naturally infect plant seeds. If the Agrobacteria are made to contain the gene of interest, as described above, then when the bacteria infects the plant, it transfers in this recombinant DNA. If the bacterial infection doesn't work, there is another technique in which the recombinant DNA is essentially injected into the plant seeds (called the "biolistic" method). 6. Your ultimate goal is to generate rice that expresses the psy gene from daffodil in the seed of the rice, where it will provide b-‐carotene to those eating it. Starting back from the beginning, outline the steps you should take to make a plasmid that contains the psy gene from daffodils. In 2000, rice that contained daffodil phytoene synthase (psy) and bacterial phyotene desaturase (crt 1) was introduced to the world. This rice is called Golden Rice. Its introduction was met with praise from some groups and opposition from other groups (like Greenpeace). Members of Greenpeace are opposed to all genetically modified foods. China and India are starting to farm Golden Rice and researchers are now trying to figure out to add vitamins A and E, iron, and zinc into bananas, cassava, rice, and sorghum. Interestingly, 12 years later, the use of golden rice is still minimal. A lot of this has to do with politics. If you are interested, here are several links where you can read more about golden rice: Pro: http://www.goldenrice.org/ Con: http://www.i-sis.org.uk/rice.php Right here in Boulder county, people have also debated the use of farm lands to grow genetically modified crops (beets in this case). The originally proposed ban was NOT upheld this past December, so such crops can still be grown in Boulder county. See these links for some interesting articles in the Boulder Daily Camera: Pro: http://www.dailycamera.com/ci_18912267 Con: http://www.commondreams.org/view/2011/05/08-2 MCDB 1041 Activity 7: to turn in to your LA as a group Your names: 1. Please copy here (from Part 1 #5), the pedigree and gel you created to identify people who were carriers or had hemophilia 2. You are in the grocery store in the US and you see a sale on golden rice. Presuming it tastes the same as regular rice, would you buy it and eat it? If you were taking a trip to a developing country and it was legal to do so, would you bring golden rice seed to the community? Why or why not? Please consider both science and politics!