Download Rhom-2 Expression Does Not Always Correlate With

From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
Rhom-2 Expression Does Not Always Correlate With Abnormalities on
Chromosome 11 at Band p13 in T-cell Acute Lymphoblastic Leukemia
By Thomas J. Fitzgerald, Geoffrey A.M. Neale, Susana C. Raimondi, and Rakesh M. Goorha
A frequent site for nonrandom recombination in T-cell acute
lymphoblastic leukemia (T-ALL) is chromosome 11 at p13.
The molecular characterization of a (7;l l)(q35;p13) translocation showed that the translocation breakpoint was 2 kb 5‘ t o
the T-ALLbCrlocus resulting in the juxtaposition of the T-cell
receptor (TCR) f3 gene t o the rhom-2 gene locus. Northern
blot analysis did not detect expression of the rhom-2 gene in
the leukemic blasts of the (7;ll) translocation. However,
using a sensitive polymerase chain reaction (PCR)-based
assay, the (7;ll) translocation showed a trace expression of
rhom-2 at a level of 0.01% of TCR-f3 message. Because
rhom-2 is considered a proto-oncogene, the significance of
the trace expression of rhom-2 in the (7;ll) translocation
was investigated by comparing the level of rhom-2 expression in 7 additional T-ALLs, normal thymocytes, and CEM
(pre-T) and HPB (mature-T) cell lines using the PCR assay.
The CEM cells, normal thymocytes, and one patient, whose
blasts had no cytogenetic abnormality of chromosome 11,
did not express rhom-2 indicating that rhom-2 is not normally
expressed in T cells. The other six T-ALLs fell into three
categories: (1) two T-ALLs overexpressed rhom-2 in the
presence of a translocation; (2) two T-ALLs had trace expression in the presence of a translocation; and (3) two T-ALLs
had trace expression with no observable abnormalities on
chromosome 11 at p13. Therefore, the data indicate that not
all translocations at the T-ALLbCrlocus result in overexpression of rhom-2. To account for the sharp contrast in rhom-2
expression seen in these T-ALLs, a model is proposed with a
negative regulatory element in the T-ALLbCr locus that is
disrupted in some of the cases leading t o overexpression of
rhom-2.
o 1992by The American Society of Hematology.
C
transposition of the TCR-P gene into the TALLbcr locus
results in an increased expression of rhom-2 and, hence,
rhom-2 may not play a role in the leukemeogenesis in this
patient.
HROMOSOMAL abnormalities are observed in 66%’
to 90%2 of acute lymphoblastic leukemias (ALL).
Cytogenetic analysis of tumors of T-cell origin has shown
translocations involving regions of chromosome 14ql1 and
7q34-q35, which involve the T-cell receptor (TCR) a/&and
P gene loci, re~pectively.~-~
Molecular characterization of
reciprocal translocations involving chromosome 7 at band
q35 have included chromosomes 1 at p32,6 9 at q34,7J 10 at
q24,9and 19 at p13.loA number of previously characterized
translocations involving members of the Ig supergene
family have shown juxtaposition of protooncogenes with the
rearranging gene loci, leading to continuous signals for cell
proliferation that contribute to
Chromosomal abnormalities involving chromosome 11 at
p13 have been detected in a number of T-cell ALLs. There
have been 17 translocations characterized at this locus and
they cluster within a 25 kb region?J3-16 Moreover, 14 of
these translocations cluster within a 7 kb region that is
This 7 kb region
hypersensitive to DNase I dige~tion.~
contains a breakpoint cluster region called T-ALLbcr.There
are two methylation-free regions flanking either side of this
breakpoint cluster17: one is 25 kb on the telomeric side of
T-ALLbcrand is the locus of the newly identified rhom-2
genels; the other is approximately 100 kb on the centromeric side of TALLbCT
and no gene has been identified
from this locus yet. The low degree of methylation and
DNase I hypersensitivity at the breakpoint locus on p13
may indicate that gene(s) are being actively transcribed
from this locus.
Raimondi et all9 reported cytogenetic data for a balanced
(7;ll) reciprocal translocation that was postulated to involve the TCR-P gene locus on chromosome 7 and an
unidentified locus on chromosome 11at p13. We characterized this (7;ll) translocation at the molecular level and
determined that the TCR-P gene locus had been juxtaposed with the TALLbCrlocus. Rhom-2 transcripts were
detected in T-ALL samples by a reverse transcription
polymerase chain reaction (PCR) amplification assay, but
we found a sharp contrast between the amount of rhom-2
transcripts detected. There was no evidence that the
Blood, Vol80, No 12 (December 15). 1992: pp 3189-3197
MATERIALS AND METHODS
Patient sample and cell lines. A 5-year-old male was diagnosed
as having an acute lymphoblastic leukemia of the T-cell type based
on immunophenotypic cell surface markers.19The blast cell karyotype was 46,XY,t(7;1 l)(q35;p14). The translocation was originally
labeled as t(7;11)(q35;p14) but data presented in this paper clearly
reassigns the breakpoint to the T-ALLhr locus at p13 on chromosome 11. Genomic DNA was isolated from a FicollIHypaque
purifiedz0 bone marrow sample (1.2 X IO7 cells) using the phenol
chloroform extraction methodz1 and total RNA was isolated using
the guanidinium isothiocyanate method.*’ The patient sample will
be referred to as t(7;11)-ALL. A mature TCRlCD3 surface
positive T-cell human peripheral blood-ALL (HPB) cell line,
which has both TCR-P alleles rearranged, the oral epidermoid
carcinoma cell line (KB), which has germline configuration for the
TCR-P gene, a CD3- ALL cell line (CEM), and a CD7+, CD3early pre-T leukemic cell line (DU-528) were used as controls. The
human-hamster somatic cell hybrids 0318, which contained human
chromosome 11, and 1003L, which contained human chromosome
From the Departments of virology and Molecular Biology, and
Pathology and Laboratoly Medicine, St Jude Children’s Research
Hospital; and the Department of Pathology, University of Tennessee,
Memphis, College of Medicine, Memphis, TN.
Submitted October 21, 1991; accepted August 20, 1992.
Supported in part by grants from the National Institutes of Health
(CA43237), Bristol-Myers Cancer Grant Research Award, and by the
American Lebanese and Syrian Associated Charities.
Address reprint requests to Rakesh M. Goorha, PhD, Department of
virology and Molecular Biology, St Jude Children’sResearch Hospital,
332 NLauderdale, PO Box 318, Memphis, TN38101.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
“advertisement” in accordance with 18 U.S.C. section 1734 solely to
indicate this fact.
0 1992 by The American Society of Hematology.
0006-497119218012-0026$3.00/0
3189
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
FITZGERALD ET AL
3190
7, were a gift from Dr A. Tereba (Promega, Madison, WI) and
were propagated as described by Hunt et al?
Southern transfer, slot blots, and DNAprobes. DNA (5 or 10 kg)
was digested to completion at 37°C with the indicated restriction
endonuclease using the buffer conditions specified by each supplier. Samples were electrophoresed in TAE buffer through 0.8%
agarose gels (FMC BioProducts, Rockland, ME) containing ethidium bromide. DNA was transferred to a nylon membrane (Nytran;
Schleicher & Schuell, Keene, NH) as described by Southern.21
Binding of DNA to the slot blot was carried out as described by
Maniatis et al.23DNA was fixed to the Nytran membrane using UV
light (Stratalinker, Stratagene, La Jolla, CA). Probes for Southern
blots were labeled with [‘Y-~*P]
dCTP by the random primer
method?I Southern blots were washed in 0.1 X SSC that contained
0.1% sodium dodecyl sulfate (SDS) at 60°C and then exposed to
XAR-5 X-ray film (Eastman Kodak, Co, Rochester, NY). The
TCR-P constant region probe was pB400 provided by Dr M.J.
Owen (ICRF Laboratories, Lincoln Inn Fields, London, UK).”
The rhom-2 probe18 was prepared by polymerase chain reaction
(PCR) amplification using 5’-GGGAACCAGTGGATGAGas the forGTG-3’ and 5’-TGAGATAGTCTCTCCGGCAG-3’
ward and reverse primers, respectively. The genomic probes, 5’BH,
3’BP, BHfl and 14BP2, were isolated as described in the results
section and the T-ALLbCrprobe was prepared by PCR amplification as described by Boehm et aLZ The genomic probes were shown
to be free of repetitive sequences by Southern blot hybridization.
Reverse transcription and PCR. Total RNA was isolated using
the guanidinium isothiocyanate method.21RNA was incubated in
the presence of 2 U of Ribonuclease inhibitor (RNasin; Promega,
Madison WI) and DNase I (RNase free; Pharmacia LKB, Piscataway, NJ) at 37°C for 20 minutes to remove any contaminating
DNA. RNA was phenol/chloroform extracted under acidic conditions and then precipitated with isopropyl alcohol. RNA was
resuspended in 10 mmol/L Tris HC1 (pH 8.0), 1 mmol/L EDTA
buffer and the concentration was calculated using the UV absorbance at 260 nm. Reverse transcription was carried out as described by Katz et a1?6 Amplification of DNA by the PCR was
performed as described by Saiki et al.” The primers for the rhom-2
gene were the same as described above and the forward and
reverse primers for the TCR-P constant region were 5’-GGACCTGAACAAGGTGTTCCC-3’and 5’-CAGAAGGTGGCCGAGACCCTC-3’, respectively.
Genomic fibraries and subcfones. A genomic library for the
t(7;11)-ALL DNA was prepared by complete digestion of DNA
with BamHI and ligation into EMBL3a bacteriophage arms (Stratagene). A second genomic DNA library was prepared by partial
digestion of DNA isolated from human placenta with Sau3A and
ligation into Xdash bacteriophage arms (Stratagene). Subcloningof
the primary clones was performed by digesting purified inserts
from the primary clones with the indicated restriction endonuclease and ligating the restriction fragments into the pBS SKIIbluescript plasmid (Stratagene).
Sequencing. DNA was sequenced in both directions directly in
the pBS SKII-plasmid initially using the M13-20 primer and
reverse primer. Sequence data were obtained sequentially using
oligonucleotide primers synthesized from the preceding sequences
using the dideoxy chain termination sequencing reaction as described by the Sequenase 2.0 protocol (US Biochemical Corp,
Cleveland, OH).
RESULTS
Analysis of the TCR-p gene shows multiple bands in the
t(7;11)-ALL DNA. To determine if the (7;11)(q35;p13)
translocation breakpoint was in the TCR-p locus, a South-
ern blot was prepared using BamHI-digested DNA. Hybridization of the Southern blot with a TCR-p probez4is shown
in Fig 1A. As controls, DNAs from the KB and HPB cell
lines were included. A germline band of 23 kb and two
smaller rearranged bands for the TCR-p gene were observed for the Kl3 and HPB cell lines, respectively (Fig 1A).
The TCR-P probe hybridized to 14 and 20-kb bands in the
t(7;11)-ALL sample showing that rearrangement had occurred on both TCR-p alleles.
Bacteriophage clones for the 14-kb and 20-kb TCR-p
alleles were obtained from a genomic library made from
patient DNA. A restriction map (Fig 1B) of the 20-kb clone
showed that a rearrangement had occurred in the first
joining region (Jpl), whereas the 14-kb clone showed
rearrangement in the second joining region (Jp2). Because
both clones isolated from t(7;11)-ALL showed rearrangement, a Southern blot with D N A from somatic cell hybrids
was used to identify the chromosomal origin of the 5’ end of
each of the two primaly clones. Thus, the clone with the 5‘
end that hybridized to D N A from the 0318 hybrid (containing human chromosome 11 but not chromosome 7) would
represent the derivative chromosome from t(7;11)-ALL.
The 5‘ terminal 1 kb HzndIIIIBamHI probe from the
20-kb clone hybridized to a 23 kb D N A band from the
control KB cells and the 1003L hybrid (chromosome 7
DNA), but not to the D N A from the 0318 hybrid (chromosome 11 DNA). Therefore, the 20-kb clone most likely
represents a normal rearrangement of one of the TCR-p
alleles, supported by the detection of a mature TCR-p
message by Northern blot analysis (data not shown).
A 5’ terminal BamHIIHinfI 1 kb fragment (BHfl) was
used as the probe for the 5‘ end of the 14 kb clone (Fig 1B).
The BHfl probe hybridized to a 7 kb band from D N A from
the control KB cells and the 0318 hybrid (chromosome l l ) ,
but did not hybridize to D N A from the 1003L hybrid (Fig
IC). Moreover, when the Southern blot used for Fig 1A was
rehybridized with the BHfl probe, the D N A from the
patient sample showed 7 and 14 kb bands (Fig 1A). The 7
kb band had the same mobility as the germline 7 kb band
that was observed in the KB (Fig 1C) and HPB (data not
shown) controls. Therefore, in the t(7;11)-ALL the BHfl
probe hybridizes to a germline 7 kb BamHI fragment in
addition to the rearranged TCR-P 14 kb BamHI fragment.
Because the 3’ end of the TCR-P gene is proximal to the
telomere, these results suggest that the 14 kb clone originated from derivative chromosome 11.
Identification of the t(7;11)-ALL translocation breakpoint.
The D N A sequence of the 2-kb BamHIIPst I subclone,
which contained the BHfl probe, was determined and then
matched to known germline sequences for the diversity,
joining,28 and variable regionsz9of the TCR-p gene. The 2
kb BamHIIPst I subclone contained germline Jp2 sequences through the Jp2.3 region (Fig 2B); however, 16 b p
of Jp2.3 had been deleted from the 5’ end. D N A sequences
5’ to the Jp2.3 region showed no homology with the known
TCR-p germline sequence, indicating that a rearrangement
had taken place but no identifiable TCR-p diversity or
variable region had been placed next to the Jp2.3 region
and might, therefore, represent chromosome 11 sequences.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
VARIED EXPRESSION OF RHOM-2 IN T-ALL
3191
A
TCR-p
C
BHfl
9.4 6.5 -
9.4 -
23.0
4.3
Fig 1. Southern blot of DNA from t(7;lWALL. (A)
Genomic DNA (10 pg) from KB cells (lane 1). HPB cells
(lane 2). and t(7;11)-ALL (lane 3). The Southern blot
was hybridized with the TCR-p constant region probe
as described in Materials and Methods. The blot was
stripped and rehybridized with the BHfl probe and
shown is t(7;11)-ALL (lane 4). (E) Restriction map of
germline TCR-p gene, 20-kb clone, and 14-kb clone.
The restriction map showed the location of the 5'BHl
and 3'BPl probes from the 20-kb clone, B H f l probe
and 14BpZ subclone from the 14-kb clone. The restriction sites are: B, BsmHI; H, Hindlll; Pd, Pst I; Hfl,
Hinfl; and Pvu 11. (C) Southern blot with genomic
DNA (10 pg) from KB cells (lane 1). 0318 somatic
hybrid cells (lane 2). and 1003L somatic hybrid cells
(lane 3)hybridized with the B H f l probe.
B
23.0
-
H
BHfl
H CB1
H Pst
6.5
-
4.3
-
Pst C82
PnlB
Ioermh,
B H
H Pal
H
P#
PnlB
l
20kb
H
5w
The Southern blot of DNA from somatic hybrids and the
DNA sequence from the 2-kb BumHIIAf I subclone
indicated that the breakpoint was at thc 5' end of J82.3;
therefore, the BHfl probc was used to isolate a 16-kb clone
from a placental genomic DNA library that represented the
germline p13 brcakpoint region on chromosome 11. To
determine if the t(7;l I)-ALL brcakpoint was in closc
proximity to the breakpoint cluster on chromosomc 1 lp13
(Fig 2A), we prepared the T-ALLkr probe using PCR
amplification.15Thc T-ALLhCrprobe hybridizcs to a 800 bp
region in which IO different breakpoints have been idcntif i ~ d . " . ' ~The
J ~ T-ALLkr and BHfl probes hybridized to the
samc 7-kb BumHI fragment from thc 16-kb clonc that
represented germline chromosome 11 at p13. A restriction
map of the 16-kb clonc showed that the t(7;11)-ALL
brcakpoint was 2 kb 5' of the T-ALLkr locus (Fig 2A).
Thc close proximity of the T-ALLkr locus and thc
t(7;l I)-ALL breakpoint was verified using PCR amplification. Thc primers for the PCR amplification were gcncrated from DNA sequence from thc 2-kb BumHIIAf I
B
rm
Pst
Pst
PnlB
l4kb
H
win
H
3pB
u.DII
subclone 50 bp 5' of the translocation breakpoint and the
T-ALLkr revcrse primer. The PCR amplification of the
16-kb clonc yielded a 2-kb product. This PCR product was
also observed when the amplification was carricd out with
genomic DNA from the 0318 hybrid and not with DNA
from the 1003L hybrid indicating that the PCR product was
from chromosomc 1 I (data not shown).
The DNA scqucncc of the 2-kb PCR product was
dctcrmincd and compared with the known DNA sequence
from the 2-kb BumHIlPvt I subclone and T-ALLk'. The
results showed that the DNA sequence of the 5' end of the
2-kb PCR product was identical to the 5' cnd of the 2-kb
BumHllP~fI subclone (data not shown); however, the
scqucncc dcviatcd at the expected breakpoint on t(7;ll)ALL (Fig 2B). Moreover, the 3' end of the 2-kb PCR
product was identical with the published DNA sequence for
T-ALLkr (data not shown). Thcsc rcsults clearly show that
the 5' end of the 2-kb BamHIIPsr I subclone is from
chromosome 11 and the t(7;l I)-ALL breakpoint is located
within 2 kb of the previously characterized T-ALLh locus.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
FITZGERALD ET AL
3192
A
Chromosome 11 Breakpoint Cluster Region
-2Kb
LlMlCRR
R HRB
I
BHfl
Ill
RRH
BHHBH
H
II I
I I I l l
I
TALL^^'
CTCCAGGCTGTGAGCACAGATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGC
1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1
GGTTGANGCTGGTGACTGCTGTGG~~~TTTTGGCCCAGGCACCCGGCTGACAGTGC
111111
GCTSA
+
/
I l l IIII Ill II IIII I
GCTGGTG~T~CT~T_GGG_IAAGCAG~AGGTCCAATGTGAACTCAATTTTACATT
TCR-JP
2.3
-
t (7;ll) ALL
Chromosome
11
Fig 2. Breakpoint region on chromosome 11 at p13. (A) Restriction map showing t(7;11)-ALL breakpoint (V),T-ALLbcr,methylationfree region
(HTF), and Rhom-2 (LIM/CRR) loci on chromosome 11 at p13. (B) Sequence and assignment of nucleotides of the t(7;ll) breakpoint site. DNA
primers were prepared from sequence data from the 14BP2 subclone and T-ALLb locus. The primers were used in a PCR amplification of DNA
from the 16 kb germline clone from chromosome 11 as described in Materials and Methods.The PCR product was sequenced and compared with
DNA sequences from the 2-kb BamHIIPst I subclone and germline Jf32.3 locus. The boxed 4 bp region on the DNA sequence from t(7; 11)-ALL
shows a putative N region.
Expression of the rhom-2 gene. The rhom-2 gene is a
recently identified gene on chromosome 11 at p13 that has
homology to a family of proteins with a cysteine-rich region
(LIM/CRR).l* Because rhom-2 is in close proximity to the
translocation breakpoint, we sought to determine if the
expression of rhom-2 was altered by the translocation.
Initial Northern blot analysis of RNA from t(7;11)-ALL,
pre-T leukemic cells DU-528, and KB cells showed no
detectable expression of rhom-2 for all three samples (data
not shown). As a more sensitive assay of expression of
rhom-2, we prepared cDNA using reverse transcriptase
with a rhom-2 specific primer and then amplified it using
PCR. As a control to show that the reverse transcription/
PCR amplification was a functional assay with RNA from
patient T A L L samples, RNAs from KB, HPB cells, and
t(7;11)-ALL were assayed for TCR-P message. Both Southern blot and slot blot analysis of PCR products from reverse
transcriptase/PCR amplification of RNA from HPB showed
a high level of TCR-P expression, whereas there was no
detectable level of the TCR-P message in the oral carcinoma KB cells (data not shown). A 260-bp PCR product
that hybridized with the TCR-f3 probe was observed on a
Southern blot (data not shown) when RNA from t(7;ll)ALL was reverse transcribed and amplified with primers for
the TCR-P message. The PCR amplification was absolutely
dependent on reverse transcriptase (RT) to generate the
cDNA showing that the 260-bp PCR product was not
generated from contaminating genomic DNA (Fig 3A,
second slot). To quantitate the level of expression detectable by this assay, we serially diluted RNA from t(7;ll)ALL with RNA from KB cells, such that the final amount of
RNA in each assay was 1 p,g, and performed the RT/PCR
amplification. The TCR-P message could still be detected
dilution of the RNA (Fig 3A).
using this assay after a
As an additional control we showed that the TCR-f3
message could be detected with the RT/PCR assay using
RNA from human thymocytes.
When the reverse transcription and PCR amplification of
RNA from t(7;11)-ALL was carried out using rhom-2
primers, we detected a trace expression of rhom-2 as judged
by slot blot analysis of the PCR product (Fig 3B). The
amount of rhom-2 message was approximately 0.01% of the
TCR-P message. The PCR detection of rhom-2 expression
was absolutely dependent on RT (Fig 4B). Moreover, the
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
3193
VARIED EXPRESSION OF RHOM-2 IN T-ALL
A
B
Rhom-2
-*
-RT
10-1
lo'*
t(7;11)-ALL
10-4
L 10-5
Thymocyte
I
L -RT
Fig 3. Reverse t r a n d p t i o n and PCR amplMwtion of t(7;ll)-ALL.
RNA from t(7;ll)-ALL and normal human thymocytes was isolated
and assayed for TCR-f? and mom-2 expression as described in
Materials and Methods. (A) TCR-f?: Forward and reverse primers
specific for TCR-f?constant region wore used for the amplification of
the Cp region of TCR-f?message. Serial dilution of RNA from t(7; 11)ALL with RNA from KB cells was made and then the RT/PCR
amplification assay performed. The PCR products were denatured
and bound to a nytran membrane using a slot blot and the membrane
was hybridized with the TCR-f3 probe. (E) Rhom-2: Forward and
reverse primersspecific for rhom-2 were used for the amplificationof
mom-2 message. The PCR products were denatured and bound to a
nytran membraneusing a slot blot and the membrane hybridizedwith
a rhom-2 probe.
rhom-2 PCR product had the expected 216 bp length as
determined by Southern blot analysis (data not shown), In
contrast to the t(7;11)-ALL, there was no detectable
rhom-2 message in human thymocytes (Fig 3B).
Because thcrc was a trace expression of rhom-2 in
t(7;l I)-ALL but not in normal human thymocytes (Fig 3B),
we sought to determine if this trace amount of rhom-2
messagc was significant. To address this question, we
identificd four additional paticnts with T-ALL that had
karyotypic abnormalities at the T-ALLherlocus. Two of the
patients, t(l1;14)-a [t( 11;14)(p13;pl I ) ] and t( 11;14)-b[t(l I;
14)(p13;qlI)], had translocations that juxtaposed the TCRa/fi locus to the T-ALLherlocus. The othcr two patients,
t2-ALL[t(7;1l)(q22;p13)]and t3-ALL[d( 1 l;ll)(pl l;pl3)],
had a karyotypic abnormality at the T-ALLherlocus but no
abnormalities were observed at the TCR or Ig loci. DNAs
isolated from leukemic blasts from these patients were
shown by Southern blot to have a rearrangement on the 7
kb RumHl fragment that contains the T-ALLkr locus (data
not shown). RNAs from t(7;11)-ALL, t(11;14)-a, t(11;
14)-b, t2-ALL. t3-ALL and human thymocytes were assayed for expression of rhom-2 and, as a positive control,
TCR-P (Fig 4). Slot blot hybridization of the PCR products
showed that human thymocytes and the leukemic blasts
from 4 of the patients expressed TCR-P message, whereas
the leukemic blasts from t( 11;14)-a, an early pre-Tleukemia, did not express the TCR-f3 message (Fig 4A).
When the RT/PCR amplification assay was carricd out
using rhom-2 primers, the slot blot (Fig 4B) and Southern
blot (data not shown) showed comparable levels of rhom-2
mcssagc for t(7;l I)-ALL and t2-ALL whereas t3-ALL had
a lowcr level of expression than t(7;1l)-ALL, and human
thymocytes showed no expression of rhom-2.
In contrast to the low level of expression of rhom-2 in
t(7;11)-ALL, the lcukemic blasts from t(11;14)-a and t(l1;
14)-b expressed levels of rhom-2 close to that of the TCR-f3
message (Fig 4A). Moreover, rhom-2 expression in t(11;
14)-a and t( 11;14)-b could be detected on a Northern blot
(data not shown). These data from t( 11;14)-a and t( 11;14)-b
are consistent with the overexpression of rhom-2 as shown
by Royer-Pokora et aLM
Because rhom-2 expression was detected not only in the
leukemic blasts of patients with karyotypic abnormalitieson
chromosome 11 at p13 (Fig 4), but also in blasts from
several patients with no observable abnormality on chromosome 11 at ~ 1 3 ,we
~ "surveyed two established cell lines and
three additional patients that did not have abnormalitieson
chromosome 11 to determine the basal level of rhom-2
message in leukemic samples (Fig 5). RNA from CEM
(CD3- early prc-T cell), HPB (CD3+ cell), t(7;11)-ALL
and three additional patients with T-ALL (t4-ALL, t5ALL, and t6-ALL) without abnormalities on chromosome
11 were assayed for TCR-p and rhom-2 expression (Fig 5).
Each of the samples showed expression of the TCR-f3gene.
When the assay was repeated using rhom-2 primers, HPB,
t(7;11)-ALL, and 14-ALL showed detectable levels of
rhom-2 expression (Fig 5). With a longer exposure of the
slot blot there was a detectable level of rhom-2 expression
in t6-ALL (data not shown). In contrast, CEM cells and
t5-ALL did not show detectable levels of rhom-2 message.
These results show that trace levels of rhom-2 can be
detected in leukemic blasts without cytogenetic abnormalities on chromosome 11 at p13.
DISCUSSION
The molecular characterization of chromosomal abnormalities in tumor cells has led to the identification of a
variety of new genes that fit the role of a protooncogene.
Several of these genes, such as the abl/bcr chimcra,3'
c-myc,32 and b ~ I - 2 have
, ~ ~ been shown to play a role in
tumorigenesis. Therefore, characterization of chromosomal
abnormalities can lead to the identification of new genes
that confer a selective advantage on a cell so that it can
expand as a tumor.
A variety of solid tumors and leukemias have karyotypic
abnormalitieson the p arm of chromosome 11. Abnormalities at llp13 through llp15 have been documented for
T-cell l e u k ~ m i a s , Y . 'Wilms'
~ ~ ~ ~ tumor,M
. ~ ~ ~ ~ squamous cell
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
3194
FITZGERALD ET AL
A
B
TCR-@
+RT
-RT
-
TCR-@
t(7;11)-ALL
t(11;14)-a
t(11;14)-b
-
.
)
t(7;11)-ALL
(.
[:
Rhom-2
-
t2-ALL
Rhom-2
t(11;14)-a
t(11;14)-b
+RT
-
r
-RT
0
0
t3-ALL
Thymocyte
L
+R1
-I3-
[:
carcinoma," and gastric and esophageal adenocarcinomas." There arc two nonrandom translocation brcakpoints
on the p arm of chromosomc 11 that are commonly
observed in T-cell lcukcmia. One of these translocation
breakpoints is at band
This translocation rcsultcd
in thc transposition of the rhombotin gcnc from chromosome 11 to thc TCR-8 locus on chromosomc 14. The othcr
translocation, which occurs more frequcntly, is at band p13.
There arc 17 individual breakpoints at this band that havc
been characterized molecularly; 14 of these brcakpoints arc
within, or in closc proximity, to the T-ALLkr locus."J3J7
Only onc of thcsc 17 brcakpoints had thc samc karyotypc as
t(7;11)-ALL,Ih whercas thc othcr 16 cases havc a t(11;
Fig 4. Rhom-2 expresslon in
1-ALb. RNA was isolated from
blastsfrom patients with translocations on chromosome 11 at
p13. (A) RNAs from t(11;14)-a
and t(11;14)-b were assayed for
TCR-6 and rhom-2 expression as
described in Materials and Methods. (E) RNAs from t(7;11)-ALL
12-ALL, t3-ALL, and normal lymphocytes were assayed for TCR-6
and rhom-2 expression. The slot
blot of the PCR products was
hybridized w i t h the indicated
probe.
14)(p13;ql1)karyotypc. Therefore, the transposition of the
T-ALLhCrlocus into thc TCR-a/8 locus occurs morc frcqucntly than transposition into the TCR-f3locus.
Thc data prcscntcd here show that a balanced rcciprocal
translocation, t(7;l l)(q35;p13) that occurrcd in the Icukemic cclls of a paticnt with T-ALL, transposed thc TCR-f3
gene into the T-ALLkr locus (Fig 6). Two clones that
rcprcsentcd rcarranged TCR-f3 gcncs from thc t(7;ll)ALL library were charactcrizcd. The 20-kb clone was
shown to bc a normal V(D)J rcarrangcment of one of the
TCR-f3allclcs. In contrast, the 14-kb clone was shown to be
from dcrivativc chromosomc 11. This rcarrangement recombined chromosomc 11 centromeric to T-ALLhCr
with Jf32.3
Rhom-2
TCR-/3
r
I
+RT
CEM
t(7;11)-ALL
t4-ALL
Fig 5. Basal levels of Rhom-2 expression. RNA
was isolated from CEM cells, HPB cells, t(7;11)-ALL
and blasts from three separate patients who did not
have chromosomal abnormalities on chromosome 11
at p13. The RNA was assayed for TCR-6 and rhom-2
expression as described in Materials and Methods.
The slot blot of the PCR products was hybridized
with the indicated probe.
t5-ALL
t6-ALL
-RT
I
I
+RT
-RT
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
VARIED EXPRESSION OF
RHOM-2
3195
IN T-ALL
Pst I
B
B
I
II I I1 I
DP1 JP1
f
I111
I I1 11111
Iin1
CP1
DP2JP2
CP2
w
RHRB
A
chromosome 7
B
111
I111
JP2
CP2
f
derivative
chromosome 11
-oj/ *
HTF1
RRH
BHHBH
H
BNSS R R HR
derivative
chromosome 7
-
LlMlCRR
TALL^^'
RHRB RRH
BHHBH
w/1 1 1 * 1 1 1
I
H
I
I I I1 I 1111
chromosome 11
11111
Fig 6. Restriction map of chromosomes 7 and 11 and derivative chromosomes 7 and 11. Restriction map of germline TCR-p gene on
chromosome 7 (thin bar) and T-ALLhr/rhom-2 locus on chromosome 11 (thick bar). Derivative chromosome 11 shows the position TCR-p
enhancer (A)with respect to the translocation breakpoint. Arrow heads on chromosome 11 map indicate previously characterizedbreakpoints;
HTF1, methylation free region; (0).
chromosomecentromere.Restriction sites: B, BamHI; R, EcoRI; H, Hindlll; N, Not I; S, Sac I; and Pst I.
of the TCR-fi gene locus (Fig 6). Because we did not find a
clone from derivative chromosome 7 that hybridized with
the TCR-6 probe, we concluded that the Dpl, J p l , and
C p l segments had been deleted. With light microscopy the
translocation was apparently balanced; therefore, derivative chromosome 7 must have recombined chromosome 7
centromeric to D p l with the rhom-2 locus (Fig 6). Deletion
of the D p l , J p l , and C p l segments have been documented
previously6J3and are thought to occur during the translocation event.
DNA sequences with homology to the recombinase
signal sequence39or a purine-pyrimidine stretch of nucleotides9 are the two signal motifs generally found at translocation breakpoints. The germline chromosome 11 DNA
sequence was analyzed for both structural motifs. A 30-bp
stretch of nucleotides immediately 5' of the t(7;11)-ALL
breakpoint contained 11 pairs of alternating purinepyrimidine nucleotides (Fig 2A, underlined). Although this
stretch of nucleotides did not form a perfect purinepyrimidine Z-DNA structural motif, it may have signaled
for recombination at this site. DNA sequence also had
homology to the recombinase signal sequence, heptamerlike sequence (CAATGTG) (Fig 2A) was found immediately downstream of the translocation breakpoint. Therefore, it is likely that this putative heptamer-like sequence
played a role in signaling for the translocation.
Because rhom-2 is in close proximity to the T-ALLbCr
breakpoint locus and has been postulated to be a protooncogene,ls the level of rhom-2 expression was determined for
eight different T-ALL samples, normal human thymocytes,
cell lines CEM (pre-T) and HPB (mature T) cells. The
CEM pre-T cell line, t5-ALL and normal thymocytes, which
have germline chromosome 11, did not have detectable
levels of rhom-2 expression indicating that rhom-2 is not
normally expressed in T-cells. However, the rhom-2 expression in the seven other T-ALLs fell into three categories:
(1) overexpression in the presence of a translocation; (2)
trace expression in the presence of a translocation; and (3)
trace expression with no observable abnormalities on chromosome 11 at p13. The first category, leukemic blasts that
overexpressed rhom-2 and had a translocation in the
TALLbcr locus, is consistent with the recently published
data of Royer-Pokora et
The second category, which
contained three of the seven T-ALLs, presented a sharp
contrast to the first category. These leukemic blasts express
a trace amount of rhom-2, approximately 0.01% of the
amount of TCR-p message, in spite of having a seemingly
similar translocation to the t( 11;14)-a and t( 11;14)-b translocation. Therefore, the data presents a conundrum: how
do two translocations into the same locus result in such
different expression levels of rhom-2?
Previously characterized translocations that recombined
the T C R - ( W / ~ ~ , 'or
~ Jp~gene16
, ~ O loci with the TALLbCrlocus
had the same configuration of derivative chromosomes as
shown in Fig 6, such that the known TCR enhancer element
is on a different derivative chromosome than rhom-2;
therefore, the TCR enhancer cannot influence the expression of rhom-2 in these translocations and the most plausible answer to this question is that the overexpression of
rhom-2 is attributable to the loss of a negative regulatory
element or generation of a cryptic promoter. The second
possibility is that the loss of regulation occurs without a
structural change in the rhom-2 gene. The observation of
Royer-Pokora et aI3O that two early pre-T ALLs overexpressed rhom-2 without having an abnormality in the
T-ALLbCrlocus is consistent with this hypothesis. The
translocation in t(7;11)-ALL, in contrast, did not affect
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
FITZGERALD ET AL
3196
draw the conclusion that trace levels of rhom-2 are functionregulation and consequently rhom-2 was not expressed at
ing as a protooncogene in t(7;11)-ALL, tZALL, and t3comparable levels as seen in t(11;14)-a and t(11;14)-b.
The rhom-2 gene has been postulated to be a protooncoALL.
gene based on a 50% homology with rhombotin.ls The
The T-ALLhCr
locus is a frequent site of recombination;
rhombotin and rhom-2 genes have homology in a cysteinetherefore, it stands t o reason that abnormalities at this
rich domain (CRR/LIM); this domain defines a new family
locus confer a selective advantage on the leukemic blast.
of proteins.ls This CRR/LIM structural motif does not
However, our data raise the question as to whether or not it
have the same amino acid spacing of cysteine and histidine
is the expressionof rhom-2 that contributes t o leukemeogenresidues as a Zn2+-finger DNA binding domain; however,
esis in all cases that have an abnormality a t the TALLbcr
the CRR/LIM is thought to be a metal binding d ~ m a i n . ~ O , ~ llocus. The t ( l l ; l 4 ) ( p l 3 ; q l l ) translocation appears to fit the
This CRR/LIM domain has been identified on the amino
model where the translocation results in the overexpression
terminal side of a DNA binding homeodomain on the
of a protooncogene. The t(7;11)(q35;p13) translocation
lin-l1,4O i ~ 1 - 3and
, ~ ~m e ~ - proteins
3 ~ ~ and has been hypothedoes not fit the model quite as well, especially in the
sized to play a role in protein-protein i n t e r a ~ t i o n . ~ ~
absence of any direct data showing that rhom-2 can
Although the rhom-2 gene has homology to rhombotin
transform T-cells. Because the TALLbCrlocus is flanked by
and the rhom-2 gene locus is 25 kb 3‘ to a frequent
a methylation free island” on both the 5‘ and 3’ side, and
recombination site in T-ALL, the question still exists
the rhom-2 gene was located at this methylation free region
whether or not the rhom-2 gene fulfills the role of a
3‘ of the T-ALLbcr’,
it is possible that an, as yet, unidentified
protooncogene in these T-cell leukemias. The functional
protooncogene is located 5’ to the TALLhcr.Therefore, it
definition of a protooncogene is a gene that, when overmay be prudent t o determine if a gene is present in the
, ~expressed
~
in a mutated form
expressed such as c - m y ~or
methylation free region 5’ of T-ALLhcr.
such as bcr-abl?l can transform a cell. There is n o evidence
at this time showing that the coding region of rhom-2 is
ACKNOWLEDGMENT
altered by these translocations. Moreover, our expression
data shows that trace amounts of rhom-2 transcripts are
The somatic hybrid cells 0318 and 1003L were generous gifts
present in 3 of 6 T-ALLs and overexpressed in 2 of 6
from Dr A. Tereba. We acknowledge the technical assistance of
T-ALLs. In the absence of data showing that the rhom-2
Karen M. Rakestraw. We thank Glenith Newberry for typing the
manuscript.
gene, upon transfection transforms cells, it is difficult to
REFERENCES
1. Third International Workshop on Chromosomesin Leukemia
1980 Chromosomal abnormalities in acute lymphoblastic leukemia. Cancer Genet Cytogenet 4101,1981
2. Rivera GK, Raimondi SC, Hancock ML, Behm FG, Pui CH,
Abromowitch M, Mirro J, Ochs JS, Look AT, Williams DL,
Murphy SB, Dah1 GV, Kalwinsky DK, Evans WE, Kun LE, Simone
JV, Crist WM: Improved outcome in childhood acute lymphoblastic leukemia with reinforced early treatment and rotational combination chemotherapy.Lancet 337:61, 1991
3. Raimondi SC, Pui CH, Behm FG, Williams D L 7q32-q36
Translocationsin childhood T-cell leukemia: Cytogeneticevidence
for involvement of the T-cell receptor P-chain gene. Blood 69:131,
1987
4. Smith SD, Morgan R, Link MP, McFall P, Hecht F Cytogenetic and immunophenotypic analysis of cell lines established from
patients with T-cell leukemia/lymphoma.Blood 67:650,1986
5. Erikson J, Finger L, Sun L, Ar-Rushdi A, Nishikura K,
Minowada J, Finan J, Emanuel BS, Nowell PC, Croce CM:
Deregulation of c-myc by translocation of the a-locus of the T-cell
receptor in T-cell leukemias. Science 2322384,1986
6. Fitzgerald TJ, Neale GAM, Raimondi SC, Goorha RM: c-tal,
a helix-loop-helix protein, is juxtaposed to the T-cell receptor
P-chain gene by a reciprocal chromosomaltranslocation: t( 1;7)(p32;
q35). Blood 78:2686,1991
7. Reynold TC, Smith SD, Sklar J: Analysis of DNA surrounding the breakpoints of chromosomal translocations involving the p
T-cell receptor gene in human lymphoblastic neoplasma. Cell
50:107,1987
8. Westbrook CA, Rubin CM, Le Beau MM, Kaminer LS, Smith
SD, Rowley JD, Diaz MO: Molecular analysis of TCRp and ABL
in a t(7;9)-containing cell line (SUP-T3) from a human T-cell
leukemia. Proc Natl Acad Sci USA 84:251,1987
9. Boehm T, Mengle-Caw L, Kees UR, Spurr N, Lavenir I,
Forster A, Rabbitts TH:Alternating purine-pyrimidine tracts may
promote chromosomal translocations seen in a variety of human
lymphoid tumors. EMBO J 8:2621,1989
10. Cleary ML, Mellentin JD, Spies J, Smith SD: Chromosomal
translocations involving the P T-cell receptor gene in acute
leukemia. J Exp Med 167:682,1988
11. Leder P, Battey J, Lenoir G, Moulding C, Murphy W, Potter
H, Stewart T, Taub R: Translocations among antibody genes in
human cancer. Science 222756,1983
12. Rabbitts TH, Boehm T, Mengle-Caw I: Chromosomal
abnormalities in lymphoid tumors: Mechanism and role in tumor
pathogenesis. Trends Genet 4:300,1988
13. Boehm T, Buluwela, Williams DL, White L, Rabbitts TH: A
cluster of chromosome llp13 translocationsfound via distinct D-D
and D-D-J rearrangements of the human T-cell receptor S chain
gene. EMBO J 7:2011,1988
14. Royer-Pokora B, Fleischer B, Ragg S, Loos U, Williams D L
Molecular cloning of the translocation breakpoint in T-ALL
(11;14)(~13;qll):Genomic map of TCR-a and -8 region on
chromosome 14qll and long-range map of region llp13. Hum
Genet 82264,1989
15. Harvey RC, Marteneire C, Sun LHK, Williams DL, Showe
LC: Translocations and rearrangements in T-cell acute leukemias
with the t(ll;l4)(pl3;qll) chromosomal translocation. Oncogene
4341,1989
16. Sanchez-GarciaI, Kaneko Y, Gonzalez-SarmientoR, Campbell K, White L, Boehm T, Rabbitts TH: A study of chromosome
llp13 translocation involving TCR-P and TCR-6 in human T-cell
leukemia. Oncogene 6577,1991
17. Foroni L, Boehm T, Lampert F, Kaneko Y, Raimondi SC,
Rabbitts TH: Multiple methylation-free islands flank a small
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
VARIED EXPRESSION OF RHOM-2 IN T-ALL
breakpoint cluster region on llp13 in the t(ll;l4)(pl3;qll) translocation. Genes Chromosomes Cancer 1:301,1990
18. Boehm T, Kaneko Y, Perutz MF, Rabbitts T H The rhombotin family of cysteine-rich LIM-domain oncogenes: Distinct
members are involved in T-cell translocations to human chromosomes llp15 and llp13. Proc Natl Acad Sci USA 88:4367,1991
19. Raimondi SC, Behm FG, Roberson RK, Pui CH, Rivera
GK, Murphy SB, Williams D L Cytogenetics of childhood T-cell
leukemia. Blood 72:1560,1988
20. Wigler M, Sweet R, Sim GK, Wold B, Pellicer A, Lacy E,
Maniatis T, Axel R: Transformation of mammalian cells with genes
from procaryotes and eucaryotes. Cell 16:777,1979
21. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman
JG, Smith JA, Struhl K (eds): Current Protocols in Molecular
Biology. New York, NY,Greene Publishing Associates and WileyInterscience, 1987
22. Hunt JD, Valentine M, Tereba A: Excision of N-myc from
chromosome 2 in human neuroblastoma cells containing amplified
N-myc sequences. Mol Cell Biol10823,1990
23. Sambrook J, Fritsch EF, Maniatis T Molecular Cloning: A
Laboratory Manual (ed 2). Cold Spring Harbor, NY, Cold Spring
Harbor Laboratory, 1989
24. Collins MKL, Kissonerghis AM, Dunne MJ, Watson CJ,
Rigby PWJ, Owen MJ: Transcripts from an aberrantly rearranged
human T-cell p-chain gene. EMBO J 4:1211, 1985
25. Boehm T, Foroni L, Rabbitts TH: An STS in the human
T-ALL breakpoint cluster region (T-ALLbCr)located at llp13.
Nucleic Acids Res 18:4298, 1990
26. Katz JM, Wang M, Webster RG: Direct sequencing of the
HA gene of influenza (H3N2) virus in original clinical samples
reveals sequence identity with mammalian cell-grown virus. J Virol
64:1808,1990
27. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn
GT, Mullis KT, Erlich H A Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science
239:487,1988
28. Toyonaga B, Yoshikai Y, Vadasz V, Chin B, Mak Tw:
Organization and sequences of the diversity, joining, and constant
region of the human T-cell receptor beta chain. Proc Natl Acad Sci
USA 82:8624,1985
29. Kimuro N, Toyonaga B, Yoshikai Y, Triebel F, Debre P,
Minden MD, Mak Tw: Sequences and diversity of human T-cell
receptor p chain region genes. J Exp Med 164:739,1986
30. Royer-Pokora B, Loos U, Ludwig WD: TTG-2, a new gene
encoding a cysteine-rich protein with the LIM motif, is overexpressed in acute T-cell leukemia with the t(ll;l4)(pl3;qll).
Oncogene 6:1887,1991
3197
31. Shtivelman E, Lifshitz B, Gale RP, Canaani E: Fused
transcript of ab1 and bcr genes in chronic myelogenous leukemia.
Nature 315:550,1985
32. Schmidt EV, Pattengale PK, Weir L, Leder P: Transgenic
mice bearing the human c-myc gene activated by an immunoglobulin enhancer: A pre-B cell lymphoma model. Proc Natl Acad Sci
USA 85:6047,1988
33. McDonnell TJ, Nunez G, Platt FM, Hockenbeny D, London L, McKearn JP, Korsmeyer SJ: Deregulated Bcl-2-immunoglobulin transgene expands a resting but responsive immunoglobulin-M and -D expressing B-cell population. Mol Cell Biol 101901,
1990
34. Boehm T, Greenberg JM, Buluwala L, Lavenir I, Forster A,
Rabbits TH: An unusual structure of a putative T cell oncogene
which allows production of similar proteins from distinct mRNAs.
EMBO J 92357,1990
35. Boehm T, Baer R, Lavenir I, Forster A, Waters JJ, Nacheva
E, Rabbits TH: The mechanism of chromosomal translocations
t(11;14) involving the T-cell receptor C6 locus on human chromosome 14qll and a transcribed region of chromosome llp14.
EMBO J 7:385,1988
36. Rose EA, Glaser T, Jones C, Smith CL, Lewis WH, Call KM,
Minden M, Champagne E, Bonetta L, Yeger H, Housman D E
Complete physical map of llp13 localizes a candidate Wilms’
tumor gene. Cell 60495,1990
37. Bradford CR, Kimmel KA, Van Dyke DL, Worsham MJ,
Tilley BJ, Burke D, Rosario F, Lutz S, Tooley R, Hayashida DJS,
Carey T E l l p deletions and breakpoints in squamous cell carcinoma: Association with altered reactivity with UM-E7 antibody.
Genes Chromosomes Cancer 3:272,1991
38. Rodriquez E, Rao PH, Lananyi M, Altorki N, Albino AP,
Kelsen DP, Jhanwar SC, Chaganti RSK llp13-15 is a specific
region of chromosomal rearrangement in gastric and esophageal
adenocarcinomas. Cancer Res 50:6410,1990
39. Finger LR, Harvey RC, Moore RCA, Showe LC, Croce CM:
A common mechanism of chromosomal translocation in T- and
B-cell neoplasia. Science 234:982,1986
40. Freyd G, Kim SK, Horvitz HR: Novel cysteine-rich motif
and homeodomain in the product of the Caenohabditis elagans cell
lineage gene lin-11. Nature 3442376,1990
41. Karlsson 0,Thor S, Norberg T, Ohlson H, Edlund T Insulin
gene enhancer binding protein Id-1is a member of a novel class of
proteins containing both a homeo- and a Cys-His domain. Nature
344:879,1990
42. Way JC, Chalfie M: mec-3, a homeobox-containing gene that
specific differentiation of the touch receptor neurons in C. elegans.
Cell 545,1988
43. Rabbitts TH, Boehm T LIM domains. Nature 346418,1990
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
1992 80: 3189-3197
Rhom-2 expression does not always correlate with abnormalities on
chromosome 11 at band p13 in T-cell acute lymphoblastic leukemia
TJ Fitzgerald, GA Neale, SC Raimondi and RM Goorha
Updated information and services can be found at:
http://www.bloodjournal.org/content/80/12/3189.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.