Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Identification and characterization of novel interaction
Document related concepts
Promoter (genetics) wikipedia , lookup
Epitranscriptome wikipedia , lookup
Metalloprotein wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
G protein–coupled receptor wikipedia , lookup
Point mutation wikipedia , lookup
Biochemical cascade wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Paracrine signalling wikipedia , lookup
Magnesium transporter wikipedia , lookup
Gene regulatory network wikipedia , lookup
Biochemistry wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Signal transduction wikipedia , lookup
Expression vector wikipedia , lookup
Phosphorylation wikipedia , lookup
Nuclear magnetic resonance spectroscopy of proteins wikipedia , lookup
Bimolecular fluorescence complementation wikipedia , lookup
Gene expression wikipedia , lookup
Western blot wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Proteolysis wikipedia , lookup
Interactome wikipedia , lookup
Transcript
Identification and characterization of novel interaction partners of CcpA in Bacillus subtilis Identifizierung und Charakterisierung neuartiger Interaktionspartner von CcpA in Bacillus subtilis Der Naturwissenschaftlichen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg zur Erlangung des Doktorgrades Dr. rer. nat vorgelegt von Andrea Wünsche aus Kecskemet Als Dissertation genehmigt von den Naturwissenschaftlichen Fakultäten der Universität Erlangen-Nürnberg Tag der mündlichen Prüfung: 06.07.2012 Vorsitzender der Promotionskommission: Prof. Dr. Rainer Fink Erstberichterstatter: Prof. Dr. Andreas Burkovski Zweitberichterstatter: Prof. Dr. Jörg Stülke TABLE OF CONTENTS I Abbreviation index .............................................................................................................................. IV 1 Zusammenfassung ........................................................................................................................ 1 2 Summary ....................................................................................................................................... 2 3 Introduction .................................................................................................................................. 3 3.1 4 Carbon catabolite regulation in bacteria .......................................................................................... 3 3.1.1 CCR in E. coli.................................................................................................................................. 5 3.1.2 CCR in B. subtilis ............................................................................................................................ 7 3.2 Differential regulation by CcpA in B. subtilis ................................................................................ 10 3.3 Scope of the thesis ............................................................................................................................. 11 Materials and methods ............................................................................................................... 12 4.1 Materials ........................................................................................................................................... 12 4.1.1 Chemicals ...................................................................................................................................... 12 4.1.2 Auxiliary Material ......................................................................................................................... 14 4.1.3 Instruments .................................................................................................................................... 14 4.1.4 Commercially available systems („kits“) ...................................................................................... 15 4.1.5 Proteins and Enzymes .................................................................................................................... 16 4.1.6 Oligonucleotides, plasmids and bacterial strains ........................................................................... 16 4.2 Media, buffers and solution ............................................................................................................. 22 4.2.1 Media ............................................................................................................................................. 22 4.2.1.1 Stock solutions for minimal media .................................................................................. 22 4.2.1.2 Additives ......................................................................................................................... 23 4.2.2 Buffers ........................................................................................................................................... 24 4.2.2.1 General buffers ................................................................................................................ 24 4.2.2.2 Buffers and solutions for agarose gel electrophoresis ..................................................... 24 4.2.2.3 Buffers and solutions for Laemmli polyacrylamide gel electrophoresis ......................... 24 4.2.2.4 Buffers and solutions for Schaegger polyacrylamide gel electrophoresis ....................... 25 4.2.2.5 Buffers for staining of PAA gels with coomassie brilliant blue ...................................... 25 4.2.2.6 Buffers for protein purification of SPINE samples ......................................................... 25 4.2.2.7 Buffers for protein purification ....................................................................................... 25 4.2.2.8 Buffers for silver staining ................................................................................................ 26 4.2.2.9 Buffers for immunoblotting............................................................................................. 26 4.3 Methods ............................................................................................................................................. 26 4.3.1 General methods ............................................................................................................................ 26 4.3.2 Growth of bacteria ......................................................................................................................... 27 4.3.2.1 Preparation and transformation of chemically competent E. coli .................................... 27 4.3.2.2 Preparation and transformation of naturally competent B. subtilis.................................. 27 4.3.3 Nucleic acid purification and modification.................................................................................... 28 4.3.3.1 Preparation of chromosomal DNA from B. subtilis ........................................................ 28 4.3.3.2 Polymerase chain reaction (PCR) .................................................................................... 28 4.3.3.3 Colony PCR .................................................................................................................... 28 II TABLE OF CONTENTS 4.3.3.4 Restriction........................................................................................................................ 29 4.3.3.5 Dephosphorylation........................................................................................................... 29 4.3.3.6 Ligation............................................................................................................................ 29 4.3.3.7 DNA gel electrophoresis ................................................................................................. 29 4.3.3.8 DNA Sequencing ............................................................................................................. 29 4.3.4 4.3.4.1 SDS polyacrylamide gel electrophoresis (PAGE) ........................................................... 30 4.3.4.2 Silver staining of PAA gels ............................................................................................. 30 4.3.4.3 Immunoblot analysis........................................................................................................ 31 4.3.4.4 Growth of bacteria for protein overexpression ................................................................ 31 4.3.4.5 Sonication ........................................................................................................................ 31 4.3.4.6 Purification of CcpA(His)6 from B. subtilis ..................................................................... 32 4.3.4.7 Purification of CodY(His)6 from B. subtilis .................................................................... 32 4.3.4.8 Purification of RpoA(His)6 from B. subtilis .................................................................... 32 4.3.4.9 Purification of αNTD(His)6 from B. subtilis .................................................................... 32 4.3.4.10 Purification of αCTD(His)6 from B. subtilis .................................................................... 33 4.3.4.11 Purification of HPr seryl phosphorylated form from B. subtilis ...................................... 33 4.3.4.12 Purification of Strep-tagged CcpA .................................................................................. 34 4.3.4.13 Purification of Avi-tagged CcpA ..................................................................................... 34 4.3.4.14 Determination of protein concentration ........................................................................... 35 4.3.4.15 Storage and dialysis of proteins ....................................................................................... 35 4.3.4.16 Surface plasmon resonance measurements (SPR) ........................................................... 35 4.3.5 Proteomic analysis ......................................................................................................................... 36 4.3.5.1 Growth conditions and preparation of protein extracts .................................................... 36 4.3.5.2 Strep protein interaction experiment (SPINE) ................................................................. 36 4.3.5.3 MS analysis of SPINE eluates ......................................................................................... 36 4.3.6 Enzyme assays ............................................................................................................................... 37 4.3.6.1 Bacterial two hybrid assay ............................................................................................... 37 4.3.6.2 Liquid β-galactosidase assay in E. coli ............................................................................ 39 4.3.6.3 Liquid β-galactosidase assay in B. subtilis ...................................................................... 39 4.3.7 5 Protein purification and characterization ....................................................................................... 30 Software and computer analyses .................................................................................................... 40 Results .......................................................................................................................................... 41 5.1 Strategy for the isolation and the identification of CcpA interacting proteins involved in transcriptional activation of ackA by in vivo crosslinking ........................................................................... 41 5.2 Isolation of CcpA complexes involved in transcriptional activation of ackA by SPINE............. 43 5.2.1 Construction of WH1012 and optimization of in vivo crosslinking ............................................... 43 5.2.2 Isolation of StrepCcpA-complexes by SPINE ............................................................................... 45 5.3 Identification of StrepCcpA interaction partners from SPINE by mass spectrometry .............. 46 5.4 Interaction partners of StrepCcpA in vivo ..................................................................................... 48 5.4.1 Analysis of the interaction of StrepCcpA with HPr in vivo ........................................................... 48 TABLE OF CONTENTS III 5.4.2 Analysis of the interaction of StrepCcpA with Crh in vivo ........................................................... 50 5.4.3 Interaction of StrepCcpA with the α subunit of the RNA polymerase (RpoA) in vivo ................. 51 5.4.4 Interaction of StrepCcpA with CodY in vivo ................................................................................. 52 5.5 BACTH analysis of direct interactions between CcpA and putative interaction partners ........ 54 5.5.1 Interaction analysis of CcpA with RNA polymerase subunits α, β and β′ ..................................... 54 5.5.2 Interaction analysis of CcpA with mutants of the α subunit of RNA polymerase......................... 56 5.5.3 Interaction analysis of CcpA with CodY by BACTH ................................................................... 58 5.5.4 Interaction analysis of CodY with α subunit of RNA polymerase by BACTH............................. 59 5.5.5 Interaction analysis of CcpA with tricarboxylic acid (TCA) cycle enzymes ................................. 59 5.6 Characterization of the complex formation of CcpA, CodY and the α subunit of the RNA polymerase by in vitro measurements ........................................................................................................... 61 5.6.1 Construction of overexpression vectors for purification of the α subunit of the RNA polymerase and CodY ..................................................................................................................................................... 61 5.6.2 5.7 SPR analyses of interactions of CcpA, RpoA and CodY............................................................... 64 5.7.1 SPR analyses of interactions between CcpA and RpoA ................................................................ 64 5.7.2 SPR analyses of interactions between CcpA and CodY ................................................................ 65 5.7.3 SPR analyses of interactions between CodY and RpoA ................................................................ 67 5.8 6 Purification of CcpA, RpoA, αNTD, αCTD, HPrSer46P and CodY ............................................. 63 SPR analyses of immobilized CcpA with HPrSer46P and αNTD ................................................ 68 5.8.1 SPR analysis of Strep-tagged CcpA .............................................................................................. 68 5.8.2 Immobilization of CcpA via Avi-tag on an SPR chip ................................................................... 70 5.8.2.1 Enzymatic biotinylation of proteins in vivo based on BirA ............................................. 70 5.8.2.2 Construction and purification of in vivo biotinylated Avi-tagged CcpA ......................... 71 5.8.2.3 SPR measurements of Avi-tagged CcpA with HPrSer46P and αNTD............................ 71 Discussion .................................................................................................................................... 73 6.1 SPINE analysis of StrepCcpA ......................................................................................................... 73 6.2 Binary protein-protein interactions analyzed by BACTH ............................................................ 75 6.3 Interactions of CcpA, CodY and RpoA involved in activation of ackA ....................................... 77 7 References ................................................................................................................................... 81 8 Publications ................................................................................................................................. 93 9 Appendix ..................................................................................................................................... 94 IV ABBEVIATION INDEX Abbreviation index αCTD αNTD ADP Amp AMP APS ATP B. bp BSA CAA cAMP CcpA CCR Cm Crh DMSO DNA DNase dNTP DTT E. EDTA Erm et al. FBP Fig. g Glc-6-P HABA HPr HPrSer46P IPTG Km kDa LB NTA OD600 ONPG p. a. PAA PAGE PCR PTS PVDF RNAP RpoA RpoB RpoC rpm RT RU SDS Spec SPR C-terminal domain of the α subunit of the RNA polymerase C-terminal domain of the α subunit of the RNA polymerase Adenosindiphosphate Ampicillin Adenosinmomophosphate Ammoniumperoxodisulfate Adenosintriphosphate Bacillus base pair bovine serum albumin casamino acids cyclic Adenosinmomophosphate Catabolite control protein A carbon catabolite regulation Chloramphenicol catabolite HPr-like protein dimethylsulfoxide desoxyribonucleic acid desoxyribonuclease desoxyribonucleotide Dithiothreitol Escherichia Ethylendiaminotetraacetate Erythromycin ”et alii“ (and others) fructose 1,6-bisphosphate figure gravity (9.81 m/s2) glucose-6-phosphate Hydroxy-azophenyl-benzoic-acid histidine containg protein histidine containg protein phosphorylated at serine 46 residue Isopropyl-ß-D-thiogalactopyranoside Kanamycin kilo dalton Luria-Bertani (broth) Nitrilotetraacidic acid optical density at 600 nm o-Nitrophenyl-β-D-galactopyranoside “pro analysi” polyacrylamide polyacrylamid-gelelektrophoresis polymerase chain reaction phosphoenolpyruvate:sugar phosphotransferase system Polyvinylidendifluoride RNA polymerase α subunit of the RNA polymerase β subunit of the RNA polymerase β′ subunit of the RNA polymerase revolutions per minute room temperature response units sodiumdodecylsulfate Spectinomycin Surface plasmon resonance ABBREVIATION INDEX Str Tab. TAE TCA Tc TE TEMED Tris wt x-Gal % (v/v) % (w/v) V Streptomycin Table Tris-acetate-EDTA-buffer tricarboxylic acid cylce Tetracycline Tris-EDTA N,N,N’,N’-Tetramethyl-ethylendiamine 2-Amino-Hydroxymethylpropan-1,3-diol wild type 5-Bromo-4-Chloro-3-indolyl-ß-D-galactopyranoside Volume / volume Weight / volume Units bp °C Da g h l m M min mol sec U V W Unit prefixes base pair degree centigrade dalton gram hour liter meter molar minute mol second unit volt watt k m µ n p Amino acid nomenclature (IUPAC-IUB, 1969) A C D E F G H I K L alanine cysteine aspartatic acid glutamic acid phenylalanine glycine histidine isoleucine lysine leucine M N P Q R S T V W Y methionine asparagine proline glutamine arginine serine threonine valine tryptophan tyrosine kilo (103) milli (10-3) micro (10-6) nano (10-9) pico (10-12) ZUSAMMENFASSUNG 1 1 Zusammenfassung In Gram-positiven Bakterien mit niedrigem GC-Gehalt, wie Bacillus subtilis, wird KohlenstoffKatabolitenregulation überwiegend vom Katabolit Kontroll Protein A (CcpA), einem globalen Transkriptionsregulator, vermittelt. CcpA reprimiert oder aktiviert die Expression von hunderten von Genen, die hauptsächlich im Kohlenstoff- und Stickstoffmetabolismus involviert sind. Die Phosphoproteine HPrSer46P und CrhP sowie die niedermolekularen Effektoren Fruktose-1,6bisphosphat (FBP) und Glukose-6-Phosphat (Glc-6-P) stimulieren die DNA-Bindefähigkeit von CcpA in Gegenwart einer bevorzugten Kohlenstoffquelle, wie beispielsweise Glukose. Die Bindung dieser Phosphoproteine an CcpA führt zu Strukturänderungen und ermöglicht die Bindung des CcpAPhosphoprotein-Komplexes an die sogenannten catabolite responsive elements (cre). In vorangegangenen Arbeiten lieferten CcpA-Mutationsanalysen Hinweise für differenzielle Aktivitäten einiger CcpA-Punktmutanten, da die Regulation von einigen aber nicht von allen Genen aufgehoben wird und daher auf eine Beteiligung zusätzlicher Interaktionen von CcpA schließen lassen. Zur Identifizierung solcher bislang unbekannter CcpA-Komplexe, die sowohl bei der Repression als auch bei der Aktivierung von CcpA regulierten Genen beteiligt sind, wurde deshalb ein in vivo crosslinking durchgeführt. Um das Verhältnis von CcpA reprimierten zu aktivierten Genen anzugleichen, wurde die Anzahl einer Sequenz, die ackA Promotorregion, als repräsentatives durch CcpA aktiviertes Gen, erhöht. Durch massenspektrometrische Analysen konnte HPr als CcpA Interaktionspartner bestätigt werden. Unter den bisher unbekannten möglichen CcpA Interaktionspartnern befanden sich alle Untereinheiten der RNA Polymerase sowie der globale Regulator CodY. In detaillierten Untersuchungen mittels bakteriellem Two-Hybrid-System wurde nur eine direkte Interaktion zwischen CcpA und der α-Untereinheit der RNA Polymerase (RpoA) detektiert. Die Bindung zwischen CcpA und RpoA konnte ebenfalls mittels in vivo crosslinking Experimenten und Immunoblotanalysen nachgewiesen werden. CcpA-RpoA Komplexe waren unabhängig vom Vorhandensein von Glukose im Kultivierungsmedium detektierbar. Im Gegensatz dazu war die Interaktion zwischen CcpA und CodY hauptsächlich bei Zugabe von Glukose nachweisbar und Komplexe zwischen CcpA und HPr konnten ausschließlich durch Zugabe von Glukose zum Medium detektiert werden. In qualitativen und quantitativen Oberflächenplasmonenresonanzanalysen wurde die Bindung von CcpA sowohl an die N-, als auch an die C-terminale Domäne von RpoA (αNTD bzw. αCTD) bestätigt. Interaktionen jeder einzelnen RpoA Domäne (αCTD und αNTD) mit CodY konnten ebenfalls nachgewiesen werden. Die ermittelten KD-Werte dieser Bindungen liegen zwischen 5 und 8 µM, die Interaktion zwischen CcpA und CodY wiederum ist mit einem KD-Wert von ca. 60 µM vergleichsweise schwach. Anhand der in dieser Arbeit ermittelten Ergebnisse wurde ein Model für einen Transkriptionsinitiationskomplex am ackA-Promotor postuliert. 2 SUMMARY 2 Summary In Gram-positive bacteria with a low GC-content, e. g. Bacillus subtilis, carbon catabolite regulation (CCR) is mainly mediated by the carbon catabolite control protein A (CcpA). CcpA is a global transcriptional regulator that represses or activates hundreds of genes involved in carbon and nitrogen metabolism. In response to the availability of preferred carbon sources like glucose the phosphoproteins, HPrSer46P and CrhP, and the low-molecular weight effectors fructose-1,6bisphosphate (FBP) and glucose-6-phosphate (Glc-6-P) stimulate CcpA function. The phosphoprotein-CcpA interaction triggers structural changes and converts CcpA into its DNA binding structure which allows binding of catabolite responsive elements (cre). Distinct point mutations in CcpA abolish regulation of some but not all target genes suggesting additional interactions of CcpA. Therefore, in vivo crosslinking and mass spectrometry were applied to identify CcpA complexes which are active in both repression and activation. This experiment was accomplished with multiple copies of a promoter region of a gene which is activated by CcpA to compensate for the large excess of promoters which are repressed by CcpA. For this purpose a B. subtilis strain with multiple copies of the ackA promoter was subjected to in vivo crosslinking and proteins interacting with CcpA were analyzed by mass spectrometry. Among these with CcpA interacting proteins identified by mass spectrometry HPr, all RNA polymerase subunits as well as the global regulator CodY were observed. In bacterial two-hybrid assays combining each RNA polymerase subunit with CcpA only a binding between CcpA and the α subunit (RpoA) was detected. In vivo crosslinking combined with immunoblot analyses revealed CcpA-RpoA complexes in cultures with or without glucose whereas CcpA-HPr and CcpA-CodY complexes occurred only or predominantly in cultures with glucose. Surface plasmon resonance (SPR) analyses confirmed binding of CcpA to the N- (αNTD) and C-terminal domains (αCTD) of RpoA as well as to CodY. Furthermore, binary interactions of CodY with the αNTD and the αCTD were detected by SPR. The KD values of complexes of CcpA or CodY with the αNTD or the αCTD are between 5 and 8 µM. CcpA and CodY form a loose complex with a KD of 60 µM. These data were combined to propose a model for a transcription initiation complex at the ackA promoter. INTRODUCTION 3 3 Introduction 3.1 Carbon catabolite regulation in bacteria Bacteria have evolved elaborate mechanisms that facilitate survival in different habitats and adaption to changing environmental conditions by utilization of many different compounds as a source of carbon and energy (Görke & Stülke, 2008; Rojo, 2010; Stülke & Hillen, 2000). Consequently, the expression of metabolic pathways is optimized for efficiency and ecological fitness in response to the availability of water, osmolarity, oxygen and nutrient (Rojo, 2010; Stülke & Hillen, 2000). Therefore, bacteria possess different regulatory mechanisms that ensure survival under changing conditions. One of these evolved regulatory mechanisms is the carbon catabolite regulation (CCR) which helps bacteria to selectively use the carbon sources that are most easily accessible when they are exposed to a more or less complicated mixture of available nutrients (Deutscher, 2008; Görke & Stülke, 2008; Gunnewijk et al., 2001; Stülke & Hillen, 2000). This is important for competition in natural environments, as selection of the preferred carbon source supports a high growth rate and thus success in competition with other microorganisms (Brückner & Titgemeyer, 2002; Stülke & Hillen, 2000). In the presence of glucose the expression of genes required for the utilization of secondary carbon sources is repressed and the activities of pre-existing enzymes are reduced to prevent waste of resources (Görke & Stülke, 2008; Stülke & Hillen, 2000). CCR has been most intensively studied in the Gram-negative model organism Escherichia coli (Magasanik, 1961; Saier, 1989) as well as in the AT-rich Gram-positive model organism Bacillus subtilis (Fujita, 2009; Lorca et al., 2005). Although, in both species the physiological outcome is very similar, CCR is mediated by completely different regulatory mechanisms. In contrast to E. coli, in which CCR is mediated by prevention of transcriptional activation of catabolic genes in the presence of glucose, in B. subtilis, CCR is mediated by the catabolite control protein A (CcpA) a regulator of the LacI / GalR family (Chambliss, 1993; Henkin et al., 1991; Hueck et al., 1995; Weickert & Adhya, 1992). In both species the regulation of signals leading to CCR is mediated by the phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS) which also transports preferred carbon sources, like glucose, into the cell (Cases et al., 2007; Deutscher et al., 2006; Görke & Stülke, 2008; Postma et al., 1993; Saier & Reizer, 1994; Titgemeyer & Hillen, 2002). The PTS contains two components which are constitutively transcribed: Enzyme I (EI) and the histidine-containing protein (HPr) and are common to all PTS carbohydrate uptake systems. Enzyme II (EII) is the sugar-specific component and is a multidomain membrane bound permease 4 INTRODUCTION which phosphorylates and translocates the sugar through the cytoplasma membrane. Bacteria usually contain several different EIIs whereby each EII complex consists of three to four domains: two hydrophilic domains (domains A and B) and one or two hydrophobic integral membrane domains (domains C and D if present). At least 15 different EII complexes for such carbohydrates were identified in both model organisms E. coli and B. subtilis (Deutscher et al., 2006; Reizer et al., 1999). For transport of carbohydrates EI autophosphorylates from phosphoenolpyruvate (PEP) and transfers the phosphoryl group to the residue His15 of HPr. Then the EIIAGlc domain is phosphorylated by HPr and further passes the phosphoryl group to the EIIBGlc domain. The concomitant phosphorylation and translocation of glucose by EIICGlc result in intracellular glucose-6-phosphate (Glc-6-P), where it can directly enter the glycolytic pathway (Fig. 3.1) (Postma et al., 1993). glucose His15~ P PEP EI CC HPr EIIA EI~ P HPr ~ pyruvate B P glucose-6~ P CM Figure 3.1: The bacterial phosphoenolpyruvate: glucose phosphotransferase system (PTS). The phosphoryl group is transferred from phosphoenolpyruvate (PEP) via Enzyme I (EI) to His15 of HPr. Then the Enzyme IIA domain (EIIAGlc) is phosphorylated by HPr and further passes the phosphoryl group to the Enzyme IIB domain (EIIBGlc), enables translocation as well as phosphorylation of PTS carbohydrates like glucose. The phosphoryl groups are highlighted in blue. CM: cytoplasmic membrane (adapted from Stülke & Hillen, 2000). In both E. coli and B. subtilis, the expression and activities of enzymes required for the uptake and catabolism of PTS substrates is mainly positively controlled by transcriptional regulators, which possess two copies of a structural motif, termed PTS-regulatory domain (PRDs) (Stülke et al., 1998). The activity of these regulators is controlled by EII- and HPr-dependent phosphorylation of both PRD copies which are differently involved in the control of activity (Kotrba et al., 2001; Stülke et al., 1998). The PDRs comprise antiterminators such as LicT (Deutscher et al., 1997; Schnetz et al., 1996) SacT (Débarbouillé et al., 1990), SacY (Crutz et al., 1990; Steinmetz et al., 1989) and GlcT (Schmalisch et al., 2003; Stülke et al., 1997) and transcriptional activators such as LevR (Débarbouillé et al., 1991a; Débarbouillé et al., 1991b) and LicR (Tobisch et al., 1997; Tobisch et al., 1999a) from B. subtilis (Kotrba et al., 2001). Phosphorylation of PRDs by the INTRODUCTION 5 sugar specific EIIB inactivates the antiterminators, such as GlcT and SacY, in the absence of their specific substrate and prevents induction (Bachem & Stülke, 1998; Schmalisch et al., 2003). However, when the specific substrate is available, EII phosphorylates the substrate while the PRD remains unphosphorylated. The unphosphorylated PRD of the antiterminator GlcT prohibits the formation of the terminator structure by binding to sequences in the mRNA leader region, the so called RAT (ribonucleic-antiterminator) (Langbein et al., 1999). PRD containing activators are similar, but contain a DNA binding site instead of an RNA binding site (Fujita, 2009; Stülke et al., 1998; Stülke & Hillen, 2000). HPrHisP also contributes to CCR by phosphorylation of PRDs. In the presence of the specific sugar and in the absence of glucose, HPrHisP phosphorylates the antiterminator LicT or the activator LevR and activates them. In contrast, in the presence of glucose the concentration of HPrH15P is low and prevents the induction (Débarbouillé et al., 1991b; Martin-Verstraete et al., 1998; Stülke et al., 1998; Tortosa et al., 2001). This regulatory mechanism is called inducer prevention since in the presence of glucose, the activation of the PRD containing regulators by their inducers is prevented. In addition, HPrHis15P is necessary for glycerol utilization. In the absence of a PTS sugar HPrHis15P phosphorylates the glycerol kinase GlpK and concurrently stimulates the kinase activity of GlpK which generates glycerol-3-P, the inducer of the glpFK operon. However, in the presence of PTS sugars GlpK activity is reduced and thus the utilization of glycerol is abolished (Darbon et al., 1999; Darbon et al., 2002; Stülke & Hillen, 1999). 3.1.1 CCR in E. coli In E. coli CCR is mainly determined by the phosphorylation state of the glucose-specific phosphotransferase enzyme EIIAGlc. When cells grow in the presence of a PTS sugar like glucose the phosphorylgroup from EIIAGlc is transferred to the EIIB domain of the permease EIIBCGlc which catalyzes transport and simultaneous phosphorylation of the sugar and thus EIIAGlc is mainly present in the unphosphorylated form (Postma et al., 1993). Unphosphorylated EIIAGlc interacts with transporters of non-preferred sugars such as the lactose permease (LacY) or glycerol kinase (GlpK) and inhibits their activity, excluding the inducer of the respective catabolic operon from the cell (Görke & Stülke, 2008; Saier & Roseman, 1976). This mechanism is termed inducer exclusion because intracellular formation of the inducer for the respective catabolic system and accordingly, the uptake of non-preferred sugars is prevented. Furthermore, non-PTS substrates like Glc-6-P or lactose increase the ratio of pyruvate / PEP, which also leads to increasing amounts of unphosphorylated EIIAGlc and thus exerts CCR (Bettenbrock et al., 2007; Hogema et al., 1998). In contrast, when glucose is being exhausted the ratio of PEP / pyruvate is high and the amount of phosphorylated EIIAGlc increases while the amount of non-phosphorylated 6 INTRODUCTION EIIAGlc decreases. Phosphorylated EIIAGlc activates the membrane bound enzyme adenylate cyclase Cya, which leads to cyclic AMP (cAMP) synthesis. The signal molecule cAMP forms a complex with the transcription activator CAP (catabolite activating protein, or also called cyclic AMP (cAMP) receptor protein (CRP)). High cAMP concentrations trigger the formation of cAMP-CAP complexes, which bind and activate the promoters of catabolic genes and operons. Non-preferred sugars can then enter the cell and induce the expression of their catabolic pathways (Fig. 3.2) (Busby & Ebright, 1999; Tagami & Aiba, 1998). GlpK LacY P ~ PEP glucose His15 EIIAGlc HPr EI EIICGlc EIIBGlc pyruvate EIIAGlc HPr EI ~ ~ P P Glc-6~ P AMP CAP Cya cAMP CAP-cAMP CM Activation of catabolic genes and operons Figure 3.2: CCR in E. coli CCR in E. coli is mainly mediated by the EIIAGlc domain of the glucose-specific enzyme EIIGlc. In the presence of glucose EIIAGlc is dephosphorylated and binds to metabolic enzymes and transporters of secondary carbon sources, such as glycerol kinase (GlpK), lactose permease (LacY) thereby preventing uptake and catabolism of these carbohydrates. When glucose is being exhausted phosphorylated EIIAGlc is accumulating and is being able to activate the adenylate cyclase (Cya). Active Cya generates cyclic AMP (cAMP) which binds CAP. The CAP-cAMP complex binds to promoters of catabolic genes and activates them. This mechanism is termed inducer exclusion because it prevents the intracellular formation of the inducer of the respective catabolic system. Glc-6-P: glucose-6-phosphate, CM: cytoplasmic membrane (adapted from Görke & Stülke, 2008). INTRODUCTION 3.1.2 7 CCR in B. subtilis In B. subtilis CCR is mainly exerted by direct transcriptional regulation of the transcription of genes that are relevant for the transport and metabolism of carbon sources (Deutscher, 2008; Deutscher et al., 2006; Fujita, 2009; Görke & Stülke, 2008). Whereas the phosphorylation state of EIIAGlc is crucial for CCR in E. coli, HPr phosphorylation is essential to CCR-related signal transduction in B. subtilis. HPr contains two phosphorylation sites: residue histidine 15 and residue serine 46. The catalytic residue His15 phosphorylated by EI at a high level of PEP is involved in sugar transport and regulation, while Ser46 phosphorylated HPr by HPrK/P is involved in CCR (Galinier et al., 1998; Reizer et al., 1998). HPrSer46P is the main effector for the control protein A (CcpA) which is the master regulator in CCR in Gram-positive bacteria with low GC-content (Görke & Stülke, 2008; Henkin et al., 1991; Warner & Lolkema, 2003; Weickert & Adhya, 1992). CcpA and HPrSer46P form a ternary complex which induces the binding of this complex to specific palindromic operator sites, the catabolite responsive elements (cre) and thus leading to transcriptional regulation (Deutscher et al., 1995; Jones et al., 1997). During glycolytic degradation of PTS sugars like glucose the concentration of glycolytic intermediates as FBP or Glc-6-P increase and FBP stimulates the ATP-dependent kinase activity of HPrK/P to phosphorylate HPr at the serine 46 residue (Galinier et al., 1998; Jault et al., 2000; Poncet et al., 2004; Reizer et al., 1998). Consequently, in the presence of glucose HPrSer46P increases and serves as coeffector for CcpA. The binding of HPrSer46P to CcpA causes a rotation of the CcpA subdomains and the formation of the hinge helix which allows DNA binding (Schumacher et al., 2004; Stülke & Hillen, 2000). In addition, the low-molecular-weight effectors FBP and Glc-6-P enhance the interaction between CcpA and HPrSer46P (Deutscher et al., 1995; Seidel et al., 2005). Under conditions of nutrient limitation the levels of FBP and Glc-6-P decrease while the level of inorganic phosphate in the cell increases, HPrK/P dephosphorylates HPrSer46P and CCR is abolished (Mijakovic et al., 2002) (Fig. 3.3). DNA binding activity of CcpA is not only enhanced by HPrSer46P but also by the HPr-like protein Crh, a second coeffector for CcpA in B. subtilis (Galinier et al., 1997). Both proteins HPr and Crh exhibit 45 % sequence similarity and they are also structurally similar (Favier et al., 2002), however, Crh cannot participate in glucose transport due to the lack of the His15 residue. Crh has, therefore, an exclusively regulatory function that depends on the HPrK/P mediated phosphorylation of Ser46 (Galinier et al., 1997). Although, CrhSer46P might interact with CcpA it substitutes only to some extent for an HPrSer46Ala mutant (Galinier et al., 1999; Galinier et al., 1997; Zeng et al., 2000). This might be explained by the following observations: (1) CcpA has a much lower affinity for CrhSerP than for HPrSer46P (Schumacher et al., 2006; Seidel et al., 8 INTRODUCTION 2005). (2) The expression of Crh is much weaker than that of HPr (Görke et al., 2004). (3) FBP does not increase the affinity of CrhP to CcpA (Seidel et al., 2005). The function of Crh in glucose-dependent CCR remains unclear, however, recently an additional function of Crh was identified in the initiation of a glycolytic bypass as a specific but CcpA-independent function of Crh seryl phosphorylation by HPrK/P (Landmann et al., 2011; Landmann et al., 2012). In this process seryl phosphorylation of Crh abolishes the inhibitory interaction of Crh with the methylglyoxal synthase MgsA and active MgsA prevents then the accumulation of phosphorylated glycolytic intermediates in the cell. In contrast, HPr does not bind or inhibit MgsA and, therefore, this inhibition is specific and obviously the main function of Crh under carbon overflow conditions. However, since CrhSer46P binds CcpA in vivo and CrhP substitutes HPrSer46P in vivo its function remains partly unclear because a deletion of crh does not influence CCR. glucose P ~ EI PEP His15 Glc EIIC C HPr HPr EIIAGlc EIIBGlc ~ pyruvate EI HPr HPr P ~ Crh P PPi Glc-6~ P ATP + HPrK/P Pi CcpA FBP ADP glycolysis HPr HPr Ser46-P CM P P Crh cre Ser46-P activation or repression of catabolic genes Figure 3.3: Carbon catabolite repression (CCR) in B. subtilis In B. subtilis HPr or Crh can be phosphorylated at Ser46 by the HPr kinase / phosphorylase (HPrK/P). This phosphorylation occurs when the intracellular concentrations of fructose-1,6-bisphosphate (FBP) and ATP are high. Both HPrSer46P and CrhP bind to CcpA, respectively. The CcpA-HPrSer46P or CcpA-CrhP complex bind to cre sites on the DNA, and thereby regulate the transcription of catabolic genes dependent on the location of the cre with reference to the promoter region. HPrK/P dephosphorylates HPrSerP under conditions of high inorganic phosphate (Pi) and low ATP. CM: cytoplasmic membrane (adapted from Görke & Stülke, 2008). INTRODUCTION 9 In B. subtilis CcpA regulates hundreds of genes involved in carbon metabolism, amino acid anabolism, overflow metabolism, nitrogen and phosphate metabolism and has substantial effects on growth, sporulation and competence (Fujita, 2009; Miwa et al., 2000; Moreno et al., 2001; Tobisch et al., 1999b; Yoshida et al., 2001). In transcriptome studies the vast majority of genes and operons is repressed by CcpA while only about 50 genes are activated by CcpA (Moreno et al., 2001). Among the repressed genes are those encoding enzymes required for the utilization of secondary carbon sources and other metabolic pathways. Genes coding for enzymes of the tricarboxylic acid (TCA) cycle and the oxidative respiration are also strongly repressed by CcpA due to the high rate of ATP synthesis at high glucose concentrations (Blencke et al., 2003). In contrast, the expression of glycolytic genes which catalyze the conversion of triose phosphate to phosphoenolpyruvate (gapA and the pgk operon) are induced by glucose (Blencke et al., 2003; Lorca et al., 2005; Lulko et al., 2007; Moreno et al., 2001; Tobisch et al., 1999b). Furthermore, CcpA also directly or indirectly activates genes which are involved in overflow metabolism such as ackA, pta and alsS for excretion of acetate or acetoin to prevent accumulation of pyruvate or acetyl-CoA in the cell (Grundy et al., 1993b; Presecan-Siedel et al., 1999; Renna et al., 1993; Shivers et al., 2006; Turinsky et al., 1998). Thus, CcpA plays a crucial role in the coordinated regulation of catabolism and anabolism to ensure optimal cell growth under varying environmental conditions. CcpA-dependent CCR is rather complex as CcpA does not only interact with various different coeffectors and mediators but also binds a number of diverse cre sites in target promoters and genes (Fujita, 2009; Miwa et al., 2000; Schumacher et al., 2011; Weickert & Chambliss, 1990). Genes which are activated by CcpA e. g. ackA, pta and the ilv-leu operon, contain single or multiple copies of cre sites upstream of the promoter (Grundy et al., 1993a; Moreno et al., 2001; Presecan-Siedel et al., 1999; Shin et al., 1999; Shivers et al., 2006; Tojo et al., 2005; Turinsky et al., 1998). The mechanism of CcpA-dependent activation is unknown, however, it is assumed that CcpA might recruit the RNA polymerase by interaction with the α subunit of RNA polymerase or facilitates open complex formation, which is required for transcription initiation similar to transcriptional activation in E. coli (Browning & Busby, 2004). In contrast, in repressed genes the cre sites are located in different regions of the gene. Transcription initiation is prevented when cre sites overlap with the promoter region such as in amyE and bgl (Kim et al., 2005; Krüger & Hecker, 1995; Nicholson et al., 1987). By binding to cre sites further downstream of the promoter such as in the sigL gene and gnt, xyn and xyl operon, RNA polymerase activity is inhibited by roadblock (Choi & Saier, 2005; Galinier et al., 1999; Kraus et al., 1994; Miwa et al., 1997). 10 INTRODUCTION 3.2 Differential regulation by CcpA in B. subtilis Analyses of CCR of different promoter-lacZ fusions by point mutations in CcpA in B. subtilis and B. megaterium revealed that there are not only ccpA mutants which are defective in CCR but there are also several ccpA mutants which exhibit special regulatory behavior: one set of CcpA variants exhibit glucose-independent regulation. Mutations of different regions of the CcpA core protein lead to repression or activation of transcription in the absence of glucose. These residues are involved in the allosteric switch mechanism or are located in the effector binding cleft and therefore a site directed mutation probably simulate a low molecular weight effector and keep CcpA in its DNA binding conformation (Diel, 2005; Küster-Schöck et al., 1999; Seidel, 2005; Sprehe, 2007; Sprehe et al., 2007). Another set of CcpA mutants display the severe growth defect on minimal media similar to a ∆ccpA mutant whereas they are able to repress xynP or xylA expression as by wild type or vice versa (Fuchsbauer, 2003; Seidel, 2005). Moreover, there are also CcpA variants exerting differential regulation, as some distinct CcpA point mutants regulate certain promoters similar to the wild type, but fail to regulate other promoters (Sprehe et al., 2007; Turinsky et al., 2000). In summary, all these data strongly suggest that different residues are involved in several different mechanisms of transcriptional regulation exerted by CcpA. Among the CcpA activated genes ackA is of special interest, because several CcpA variants with point mutations in the hinge helix, the coeffector binding region and the C-terminal subdomain were active in CCR of ackA, but deficient in regulation of other genes in in vivo and in vitro studies (Diel, 2005; Horstmann, 2006; Horstmann et al., 2007; Seidel, 2005; Sprehe, 2007; Sprehe et al., 2007; Turinsky et al., 2000). Furthermore, ackA is activated to different levels depending on the growth phase (Grundy et al., 1993a). From these results and the versatility of known interaction partners of CcpA it is assumed that there are very likely further unknown proteinprotein interactions affecting regulation of ackA by CcpA. Interestingly, the the pleiotropic, global regulator, CodY additionally activates the transcription of ackA (Shivers et al., 2006). This coregulation of ackA by CcpA and CodY is of special interest because CCR by CcpA is stimulated by the presence of high FBP concentrations (Schumacher et al., 2007; Seidel et al., 2005) and CodY binding to the ackA promoter is mainly stimulated by branched chain amino acids (BCAAs) (Sonenshein, 2005; Sonenshein, 2007). CodY is a transcriptional regulator in B. subtilis that activates or represses many metabolic genes which involved in nitrogen or carbon metabolism and in the adaptation to nutritional conditions which limit growth (Fisher et al., 1996; Molle et al., 2003; Slack et al., 1995; Sonenshein, 2005; Sonenshein, 2007). INTRODUCTION 11 3.3 Scope of the thesis The versatility of known CcpA interaction partners, the differential regulation mediated by CcpA and, in addition, the regulation of some genes to different levels depending on the growth phase, suggest further unknown protein-protein interactions. Therefore, the overall aim of this thesis was to identify yet unknown interaction partners of CcpA in B. subtilis by in vivo crosslinking and to characterize these interactions with appropriate methods. 12 MATERIALS AND METHODS 4 Materials and methods 4.1 Materials The chemicals used in this work were purchased from Merck (Darmstadt), Roth (Karlsruhe), and Sigma (Munich) in p. a. quality. All chemicals are summarized in Table 4.1. The following tables list auxiliary material (Table 4.2), instruments (Table 4.3), commercially available kits (Table 4.4) and proteins and enzymes (Table 4.5). 4.1.1 Chemicals Table 4.1: Chemials Chemical Source Acetic acid Acrylamide Adenosintriphosphat (ATP) Agar Agarose Ammoniumperoxodisulfate (APS) Ammoniumsulfate Ampicillin Bicine Boric acid β-Mercaptoethanol 5-Bromo-4-chlor-3-indolyl-β-D-galactopyranosid (X-Gal) Bromophenolblue Casamino acids Calciumchloride Chloramphenicol Coomassie Brilliant Blue D-desthiobiotin D(+)-glucose D(+)-glucose-6-phosphate Dimethylformamide (DMF) Dimethylsulfoxid (DMSO) Dithiotreitol (DTT) Dipotassiumhydrogenphosphate Disodiumhydrogenphosphate dNTPs D(+)-xylose EDTA, disodium salt Erythromycine Ethanol Ferric Ammonium Citrate Formamide Formic acid D-fructose D-fructose-1,6-bisphosphate Merck, Darmstadt Roth, Karlsruhe Roche, Mannheim Oxoid, Heidelberg Peqlab, Erlangen Sigma, Munich Merck, Darmstadt Sigma, Munich Sigma, Munich Merck, Darmstadt Merck, Darmstadt Roth, Karlsruhe Roth, Karlsruhe Sigma, Munich Roth, Karlsruhe Roche, Mannheim Gibco / BRL, Karlsruhe IBA, Göttingen Merck, Darmstadt Sigma, München Sigma, München Sigma, München Roth, Karlsruhe Merck, Darmstadt Merck, Darmstadt Roche, Mannheim Merck, Darmstadt Merck, Darmstadt Sigma, München Roth, Karlsruhe Sigma, München Fluka AG, Switzerland Roth, Karlsruhe Sigma, München Fluka AG, Switzerland MATERIALS AND METHODS 13 Chemical Source Glutamic acid Glycerol HABA (Hydroxy-azophenyl-benzoic-acid) Hydrochloric acid 37 % 4-(2-Hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) Imidazol Isoleucine Isopropyl thio-β-D-galactoside (IPTG) Kanamycine Leucine Maleic acid disodium salt Magnesiumchloride Magnesiumsulfate Manganesesulfate Methanol Methionine Nickelsulfate o-Nitrophenyl-β-D-galactopyranosid (ONPG) Paraformaldehyde Polyethylenglycol 6000 Potassiumdihydrogenphosphate Potassiumhydroxide Phenylmethylsulfonylfluorid Sodiumacetate Sodiumchloride Sodiumdihydrogenphosphat Sodium dodecyl sulfate (SDS) Sodiumformiate Sodiumhydroxide Sodiumsuccinate Sodiumthiosulfate SoftLink™ Soft Release Avidin Resin Spectinomycin Strep-Tactin Sepharose Sucrose Tetracycline N,N,N’,N’-Tetramethylethylendiamin (TEMED) Tris-(hydroxymethyl)-aminomethan (Tris-Base) TritonX-100 Tryptone Tryptophan Tween20 Valine Xylencyanol X-Gal Yeast extract Roth, Karlsruhe Roth, Karlsruhe Sigma, München Roth, Karlsruhe Roth, Karlsruhe Merck, Darmstadt Sigma, München PEQ Lab, Erlangen Sigma, München Sigma, München Fluka AG, Switzerland Roth, Karlsruhe Fluka AG, Switzerland Merck, Darmstadt Roth, Karlsruhe Sigma, München Roth, Karlsruhe Sigma, München Roth, Karlsruhe Roth, Karlsruhe Merck, Darmstadt Merck, Darmstadt Sigma, München Merck, Darmstadt Merck, Darmstadt Merck, Darmstadt Roth, Karlsruhe Merck, Darmstadt Roth, Karlsruhe Serva, Heidelberg Merck, Darmstadt Promega, Mannheim Sigma, München IBA, Göttingen Merck, Darmstadt Sigma, München Merck, Darmstadt Roth, Karlsruhe Serva, Heidelberg Oxoid, Heidelberg Merck, Darmstadt Sigma, München Merck, Darmstadt Roth, Karlsruhe Peqlab, Erlangen Oxoid, Heidelberg 14 4.1.2 MATERIALS AND METHODS Auxiliary Material Table 4.2: Auxiliary Material Auxiliary material Source BIAmaintenance Kit for BiacoreX Centriprep Centrifugal Filter (3 kDa, 10 kDa, 30 kDa) Chromatograpy material DEAE-Sephacel Electric dispenser Eppendorf reaction tubes (1,5 ml; 2 ml) Gene Amp reaction tubes Glass bottles Glass pipettes Greiner tubes (15 ml; 50 ml) Half micro vessels HBS-EP buffer Hiprep SepharoseQ column HisTrap columns 1 ml and 5 ml Microliterpipets PCR reaction tubes Petri dishes Pipettes tips Poly-Prep Chromatography Columns Polyvinylidenedifluoride (PVDF) membrane (0.45 µm pore size) Sensorchip CM5 Sensorchip SA Size exclusion chromatography column Superdex G75 Size exclusion chromatography column Superdex G200 Sterile filter Minisart (0.2 and 0.45 µm pore size) StrepTrap column 1 ml Whatman paper 96 well cell culture plate (sterile, F-bottom, with lid) GE Healthcare, Munich Millipore, Eschborn GE Healthcare, Munich Eppendorf, Hamburg Greiner, Nürtingen Perkin Elmer, Weiterstadt Schott, Mainz Brand, Wertheim Greiner, Nürtingen Greiner, Nürtringen GE Healthcare, Munich GE Healthcare, Munich GE Healthcare, Munich Gilson, Düsseldorf Peqlab, Erlangen Greiner, Nürtingen Greiner, Nürtingen Bio-Rad, Munich Roth, Karlsruhe GE Healthcare, Munich GE Healthcare, Munich GE Healthcare, Munich GE Healthcare, Munich Schleicher & Schüll, Dassel GE Healthcare, Munich Millipore, Eschborn Greiner Bio-One, Kremsmünster 4.1.3 Instruments Table 4.3: Instruments Instrument Source ABI PRISM 310 Genetic Analyzer ÄKTA FPLC ÄKTA Prime ÄKTA Prime Plus Analytic Balance Satorius Autoclave Deutsch and Neumann Autoclave Systec 5075 EL Biocad Vision Workstation BIAcore X Biofuge centrifuge fresco, pico and primo R Bio-Print Video-Geldocu-system Mod.215 ChemiDoc XRS+ System Centrifuge J21B Applied Biosystems, Weiterstadt GE Healthcare, Munich GE Healthcare, Munich GE Healthcare, Munich Satorius, Göttingen Deutsch and Neumann Systec GmbH, Wettenberg Applied Biosystems, Weiterstadt GE Healthcare, Munich Heraeus Christ, Osterode Peqlab, Erlangen Bio-Rad, Munich Beckmann, Munich MATERIALS AND METHODS 15 Instrument Source Centrifuge Avanti J25 Electrical Dispenser French Pressure cell press Heatblock Dri Block DB3 Horizontal shaker Macro-pipette Magnetic Heat stirrer Microliterpipetes Pipetman P20, P200, P1000 Microprocessor pH-meter 766 Calimatic Milli-Q© PF Plus Mini-PROTEAN® Tetra Cell Mini Trans-Blot Electrophoretic Transfer Cell Mini-V 8·10 Blot Module Mini Western Blotting System EBX-700 NanoDrop ND1000 Spektrophotometer Power supply TN 300-120 Power supply Rotary shaker Rotary shaker Mod G25 Rotary shaker TM4430 Spectralphotometer Ultrospec 3000 Sonic Sonifier Branson B12 Speed Vac centrifuge TECAN SpectraFluor Plus TECAN Infinite F200 Pro Thermo Cycler primo 96 advanced Ultra centrifuge Ultrasonic Sonoplus HD2070 + UW2070 UV Transilluminator 366 nm Vortex VF2 Water bath TW 12 Water deionization system Water rotary shaker Innova 3100 Beckmann, Munich Eppendorf, Hamburg Thermo Fisher, Schwäbisch-Gmünd Techne, England New Brunswick, Neu Isenburg RCT, Heidelberg JKA Werk, Staufen Gilson, Düsseldorf; Knick, Berlin Millipore, Eschborn Bio-Rad, Munich Bio-Rad, Munich Life Techn., Gibco / BRL, Karlsruhe C.B.S. Scientific Company, San Diego Peqlab, Erlangen Heinzinger, Rosenheim Bio-Rad, Munich GFL, Burgwedel New Brunswick, Neu Isenburg New Brunswick, Neu Isenburg Amersham Biosciences, Freiburg Braun, Melsungen Bachofer, Reutlingen TECAN, Crailsheim TECAN, Crailsheim Peqlab, Erlangen Beckman, Munich GE Healthcare, Munich Vetter, Wiesloch IKA Labortechnik, Staufen Julabo, Seelbach Millipore, Schwalbach New Brunswick, Neu Isenburg 4.1.4 Commercially available systems („kits“) Table 4.4: Commercially available systems („kits“) System Source Bio-Rad Protein Assay DNA Leiter-Mix ECL+ Plus Nucleobond AX 100 Nucleospin Plasmid Nucleospin Extract 2 in 1 Pierce ECL Western Blotting Substrate peqGOLD Protein Standard II QIAamp® DNA Mini Kit Ready-To-Go™ PCR beads Termination-mix Bio-Rad, Munich PeqLab, Erlangen GE Healthcare, Munich Macherey-Nagel, Düren Macherey-Nagel, Düren Macherey-Nagel, Düren Thermo Scientific, Schwerte PeqLab, Erlangen Qiagen, Hilden GE Healthcare, Munich Perkin Elmer, Weiterstadt 16 4.1.5 MATERIALS AND METHODS Proteins and Enzymes Table 4.5: Proteins and Enzymes Proteins and Enzymes Source Bovine serum albumin (BSA) DNaseI Lysozyme Proteinase K Phusion DNA Polymerase Restrictionendonucleases Sigma, Munich Sigma, Munich Merck, Darmstadt Stratagene, Heidelberg Finnzymes, Finland Biolabs, Schwalbach Roche, Mannheim Gibco / BRL, Karlsruhe GE Healthcare, Munich Sigma, Munich Roche, Mannheim Sigma, Munich Biolabs, Schwalbach Roche, Mannheim (Küster et al., 1996) (Landmann et al., 2011) Jörg Stülke, department of microbiology, Göttingen Sigma, Munich Neoclone, USA IBA, Göttingen Ribonuclease (RNase A) Shrimp Alkaline Phosphatase Streptavidine Taq-DNA-polymerase T4-DNA-ligase Anti-CcpA antibody Anti-Crh antibody Anti-HPr antibody Anti-Flag antibody, monoclonal Anti-RpoA antibody, monoclonal StrepMAB-Immo anitbody 4.1.6 Oligonucleotides, plasmids and bacterial strains The following tables summarize oligonucleotides (Table 3.6), plasmids (Table 3.7), and bacterial strains (Table 3.8) used in this work. All oligonucleotides were purchased from MWG Biotech. Table 4.6: Oligonucleotides Oligonucleotide Sequence (5′′ – 3′′) CcpA_B2H_BamHI-fwd ATAGGCGGATCCCATGAGCAATATTAC Cloning of pWH2127, pWH2128 GATCTACGATGTAGCG pWH2129 and pWH2130 CcpA_B2H_KpnI-rev ATAAGAGGTACCAATGACTTGGTTGAC Cloning of pWH2127, pWH2128 TTTCTAAGCTCTATACG pWH2129 and pWH2130 RpoA_B2H-BamHI-fwd ATACGAGGATCCAATGATCGAGATTGA Cloning of pWH2139, pWH2140 AAAACCAAAAATCGAAAC pWH2141 and pWH2142 RpoA_B2H_KpnI-rev ATATGAGGTACCTGATCGTCTTTGCGA Cloning of pWH2139, pWH2140 AGTCCGAGTC pWH2141 and pWH2142 RpoB_B2H_BamHI-fwd ATAGGCGGATCCCTTGACAGGTCAACT Cloning of pWH2143, pWH2144 AGTTCAGTATGGAC pWH2145 and pWH2146 RpoB_B2H_KpnI-rev ATAAGAGGTACCTATTCTTTTGTTACTA Cloning of pWH2143, pWH2144 CATCGCGTTCAACGTC pWH2145 and pWH2146 B2H_RpoAdCTD_Accrev ATAAGTGGTACCTTTTGATCTTCTTCTT Cloning of pWH2155, pWH2156 TTTCAACCAGATTTCAG pWH2157 and pWH2158 Application B2H_RpoAdNTD_Bam-f AGAATAGGATCCGGTTGGTTTAACTGA Cloning of pWH2159, pWH2160 CGAAGCTCAACATG pWH2161 and pWH2162 MATERIALS AND METHODS 17 Oligonucleotide Sequence (5′′ – 3′′) RpoC_B2H_SalI-fwd AGAATAGTCGACCTTGCTAGATGTGAA Cloning of pWH2147, pWH2148 CAATTTTGAGTATATG RpoC_B2H_KpnI-rev AGAATAGGTACCAATTCAACCGGGACC Cloning of pWH2147, pWH2148 ATATCG RpoC1_B2H_PstI-f AGAATACTGCAGCCTTGCTAGATGTGA Cloning of pWH2149, pWH2150 ACAATTTTGAGTATATG RpoC2_B2H_PstI-f AGAATACTGCAGCTTGCTAGATGTGAA Cloning of pWH2149, pWH2150 CAATTTTGAGTATATG CodY_B2H_BamHI-fwd ATAGGCGGATCCAATGGCTTTATTACA Cloning of pWH2135, pWH2136, AAAAACAAG pWH2137, pWH2138 CodY_B2H_KpnI-rev ATAAGAGGTACCGTATGAGATTTTAGA Cloning of pWH2135, pWH2136, TTTTCTAATTCAATTAG pWH2137, pWH2138 HPr_B2H_BamHI-fwd ATAGGCGGATCCAATGGCACAAAAAA Cloning of pWH2131, pWH2132, CATTTAAAGTAACTG pWH2133, pWH2134 HPr_B2H_KpnI-rev ATAAGAGGTACCGACTCGCCGAGTCCT Cloning of pWH2131, pWH2132, TCGC pWH2133, pWH2134 HPr-S46D-fwd CAGTTAACCTTAAAGACATTATGGGTG HPr mutagenisis TTATGTC citB-B2H-Bam-f ATAAGAGGATCCAATGGCAAACGAGC Cloning of pWH2376, pWH2377, AAAAAACTG pWH2378, pWH2379 citB-B2H-Acc-r ATAAGAGGTACCTCGGACTGCTTCATT Cloning of pWH2376, pWH2377, TTTTCACGAAGC pWH2378, pWH2379 citB-Seq-fwd CGCAACAATTGCGAATATG citG-B2H-Bam-f ATAAGAGGATCCGATGGAATACAGAA Cloning of pWH2380, pWH2381, TTGAACGAGACACC pWH2382, pWH2383 citG-B2H-Acc-r ATAAGAGGTACCGCCGCCTTTGGTTTT Cloning of pWH2380, pWH2381, ACCATGTCTTC pWH2382, pWH2383 citZ-B2H-Bam-f ATAAGAGGATCCGATGACAGCGACAC GCGGTCTTG citZ-B2H-Acc-r ATAAGAGGTACCGCGGCTCTTTCTTCA Cloning of pWH2384, pWH2385, ATCGGAACGAATTTTTG pWH2386, pWH2387 icd-B2H-Bam-f GTGAGAGGATCCGGTGGCACAAGGTG AAAAAATTACAG icd-B2H-Acc-r GTGAGAGGTACCGCGTCCATGTTTTTG Cloning of pWH2388, pWH2389, ATCAGTTCTTCTC pWH2390, pWH2391 mdh-B2H-Bam-f GTGAGAGGATCCGATGGGAAATACTC GTAAAAAAGTTTCTG mdh-B2H-Acc-r GTGAGAGGTACCGCGGATAATACTTTC Cloning of pWH2392, pWH2393, ATGACATTTTTGACAGATTC pWH2394, pWH2395 pUT18-Seq-fwd GCGGATAACAATTTCACACAG Sequencing of pUT18 vectors pUT18-Seq-rev GCGATTTTCCACAACAAGTC Sequencing of pUT18 vectors pUT18C-Seq-fwd GCCGGATGTACTGGAAAC Sequencing of pUT18C vectors pUT18C-Seq-rev TACTGAGAGTGCACCATATTAC Sequencing of pUT18C vectors pKNT25-Seq-fwd TGAGCGGATAACAATTTCACAC Sequencing of pKNT25 vectors pKNT25-Seq-rev TGCGTAACCAGCCTGATG Sequencing of pKNT25 vectors pKT25-Seq-fwd CGATTCGGTGACCGATTAC Sequencing of pKT25 vectors Application Sequencing of citB gene Cloning of pWH2384, pWH2385, pWH2386, pWH2387 Cloning of pWH2388, pWH2389, pWH2390, pWH2391 Cloning of pWH2392, pWH2393, pWH2394, pWH2395 18 MATERIALS AND METHODS Oligonucleotide Sequence (5′′ – 3′′) Application pKT25-Seq-rev GGTAACGCCAGGGTTTTC Sequencing of pKT25 vectors Linker 2rep3aa fwd-Bam AGAATAGGATCCTTCAGGAGGCGGTG GTTCCGGTG Cloning of pWH2128-2rep3aa, pWH2130-2rep3aa, pWH2132HPrS46D-2rep3aa, pWH2134HPrS46D-2rep3aa Linker 2rep3aa rev-Bam AGAATTGGATCCAGTCTAGAACCGCCA Cloning of pWH2128-2rep3aa, GAACCGCC pWH2130-2rep3aa, pWH2132HPrS46D-2rep3aa, pWH2134HPrS46D-2rep3aa Linker 2rep3aa fwd-Kpn AGAATTGGTACCTTCAGGAGGCGGTGG Cloning of pWH2127-2rep3aa, TTCCGGTG pWH2129-2rep3aa, pWH2131HPrS46D-2rep3aa, pWH2133HPrS46D-2rep3aa Linker 2rep3aa rev-Kpn AGAATTGGTACCAGTCTAGAACCGCCA Cloning of pWH2127-2rep3aa, GAACCGCC pWH2129-2rep3aa, pWH2131HPrS46D-2rep3aa, pWH2133HPrS46D-2rep3aa Linker 6rep3aa revAcc65I AGAATAGGTACCATTCTAGAACCACCA Cloning of pWH2127-6rep3aa, CTTCCGC pWH2129-6rep3aa, pWH2131HPrS46D-6rep3aa, pWH2133HPrS46D-6rep3aa Linker 6rep3aa revBamHI AGAATAGGATCCATTCTAGAACCACCA Cloning of pWH2128-6rep3aa, CTTCCGC pWH2130-6rep3aa, pWH2132HPrS46D-6rep3aa, pWH2134HPrS46D-6rep3aa CodY-Flag-Eco-fwd AGAATAGAATTCCGTCAATTCCCTGAA Cloning of pWH2371 GAATATAC CodY-Flag-Bam-rev AGAATAGGATCCATGAGATTTTAGATT Cloning of pWH2371 TTCTAATTCAATTAGG RpoA-NTD-NheI-fwd AGAATACTCGAGTTAAGTTAAACCAAC Cloning of pWH2176 GAATATATTAAGGTGTTC RpoA-XhoI-rev AGAATACTCGAGTCAATCGTCTTTGCG Cloning of pWH2176 AAGTCC CodY-NdeI-fwd AGAATACATATGATGGCTTTATTACAA Cloning of pWH2177 AAAACAAGAATTATTAAC CodY-XhoI-rev AGAATACTCGAGTTAATGAGATTTTAG Cloning of pWH2177 ATTTTCTAATTCAATTAGG pASK-IBA17+_fwd AGTTATTTTACCACTCCCTATCAG Sequencing of pASK-IBA17(+) vectors pASK-IBA17+_rev GACGCAGTAGCGGTAAAC Sequencing of pASK-IBA17(+) vectors Strep-CcpA-EcoRI-fwd ATAAGAGAATTCGAGCAATATTACGAT Cloning of pWH2375 CTACGATGTAGCGAGAG Strep-CcpA-BamHI-rev ATAAGAGGATCCTTATGACTTGGTTGA Cloning of pWH2375 CTTTCTAAGCTCTATACG pAN4-Seq-fwd GAGCTGTTGACAATTAATCATC Sequencing of pAN4 or pAC4 vectors pAN4-Seq-rev TTATCAGACCGCTTCTGC Sequencing of pAN4 or pAC4 vectors AviCcpA-Xho-fwd AGAATACTCGAGGATGAGCAATATTAC Cloning of pWH2369 GATCTACGATGTAGC MATERIALS AND METHODS 19 Oligonucleotide Sequence (5′′ – 3′′) AviCcpA-Acc-rev AGAATTAGGTACCTTATGACTTGGTTG Cloning of pWH2369 ACTTTCTAAGCTCTATAC CcpA-Avi-NcoI-fwd AGAATACCATGGCGAGCAATATTACGA Cloning of pWH2370 TCTACGATGTAGCGAGAG CcpA-Avi-XmaI-rev AGAATTCCCGGGTTGACTTGGTTGACT Cloning of pWH2370 TTCTAAGCTCTATACG Application Table 4.7: Plasmids Plasmid Characteristics Reference pHT304 AmpR, ErmR, ori ColE1, ori1030 (Arantes & Lereclus, 1991) R pET3c Amp , oriBR Novagen pWH653 pET3c, ccpAhis6 (B. subtilis) (Seidel, 2005) pWH466 pET3c, ptsH (B. subtilis) (Seidel et al., 2005) R R pWH1520 Amp , Tc , XylR, xylA’, ori pBR, ori BC16 (Rygus & Hillen, 1991) pWH933 pWH1520 derivative, ackA promoter region (Bartholomae, 2008) R R pGB382 Amp , Erm , ori ColE1, ori 1030, pdegQ36, (Herzberg et al., 2007) C-terminal Strep-tag pWH940 pGP382, ccpA p4813 pUT18 pUT18C pKNT25 pKT25 pUT18C-zip (Bartholomae, 2008) R (Reizer et al., 1998) R (Karimova et al., 1998) R (Karimova et al., 1998) Amp , hprK Amp , ori ColE1 Amp , ori ColE1 R Km , ori p15A R Km , ori p15A R Amp , ori ColE1 R (Karimova et al., 1998) (Karimova et al., 1998) (Karimova et al., 1998) pKT25-zip Km , ori p15A (Karimova et al., 1998) pWH2127 pUT18, ccpA This work pWH2128 pUT18C, ccpA This work pWH2129 pKNT25, ccpA This work pWH2130 pKT25, ccpA This work pWH2139 pUT18, rpoA This work pWH2140 pUT18C, rpoA This work pWH2141 pKNT25, rpoA This work pWH2142 pKT25, rpoA This work pWH2143 pUT18, rpoB This work pWH2144 pUT18C, rpoB This work pWH2145 pKNT25, rpoB This work pWH2146 pKT25, rpoB This work pWH2147 pUT18, rpoC This work pWH2148 pUT18C, rpoC This work pWH2149 pKNT25, rpoC This work pWH2150 pKT25, rpoC This work 20 MATERIALS AND METHODS Plasmid Characteristics Reference pWH2155 pUT18, rpoA mutant (αNTD (aa 1-244) This work pWH2156 pUT18C, rpoA mutant (αNTD (aa 1-244) This work pWH2157 pKNT25, rpoA mutant (αNTD (aa 1-244) This work pWH2158 pKT25, rpoA mutant (αNTD (aa 1-244) This work pWH2159 pUT18, rpoA mutant (αCTD (aa 224-314) This work pWH2160 pUT18C, rpoA mutant (αCTD (aa 224-314) This work pWH2161 pKNT25, rpoA mutant (αCTD (aa 224-314) This work pWH2162 pKT25, rpoA mutant (αCTD (aa 224-314) This work pWH2131 pUT18, ptsH This work pWH2132 pUT18C, ptsH This work pWH2133 pKNT25, ptsH This work pWH2134 pKT25, ptsH This work pWH2131-HPrS46D pUT18, ptsH mutant (S46D) This work pWH2132-HPrS46D pUT18C, ptsH mutant (S46D) This work pWH2133-HPrS46D pKNT25, ptsH mutant (S46D) This work pWH2134-HPrS46D pKT25, ptsH mutant (S46D) This work pWH2135 pUT18, codY This work pWH2136 pUT18C, codY This work pWH2137 pKNT25, codY This work pWH2138 pKT25, codY This work pWH2163 pUT18, ptsI This work pWH2164 pUT18C, ptsI This work pWH2165 pKNT25, ptsI This work pWH2166 pKT25, ptsI This work pWH2376 pUT18, citB This work pWH2377 pUT18C, citB This work pWH2378 pKNT25, citB This work pWH2379 pKT25, citB This work pWH2380 pUT18, citG This work pWH2381 pUT18C, citG This work pWH2382 pKNT25, citG This work pWH2383 pKT25, citG This work pWH2384 pUT18, citZ This work pWH2385 pUT18C, citZ This work pWH2386 pKNT25, citZ This work pWH2387 pKT25, citZ This work pWH2388 pUT18, icd This work pWH2389 pUT18C, icd This work pWH2390 pKNT25, icd This work pWH2391 pKT25, icd This work pWH2392 pUT18, mdh This work pWH2393 pUT18C, mdh This work MATERIALS AND METHODS 21 Plasmid Characteristics Reference pWH2394 pKNT25, mdh This work pWH2395 pKT25, mdh This work R R pWH1520 Amp , Tc , xylR, xylA’, ori pBR, ori BC16 (Rygus & Hillen, 1991) pWH933 pWH1520, ackA promoter Bartholomae 2008 R pGP382 AmpR, Erm , C-Strep-tag, ori pBR, ori BC16 (Herzberg et al., 2007) pWH940 pGP382, ccpA Bartholomae 2008 R pWH338 ccpA-deletion plasmid, Km (Sprehe et al., 2007) pET28b Overexpression vector for fusion of proteins with N-terminal His-tag, KmR, Novagen pWH2175 pET28, rpoA This work pWH2176 pET28b, rpoA mutant (αNTD (aa 1-226)) This work pWH2177 pET28b, codY This work pGP1331 Integrative vector for C-terminal fusion of 3 × Flag-tag, AmpR, SpecR (Lehnik-Habrink et al., 2010) pWH3171 pGP1331, codY’ This work pAN4 Overexpression vector for fusion of proteins with N-terminal Avi-tagTM, AmpR GeneCopoeiaTM, Avidity, LLC, Denver, Colorado pWH2369 pAN4, ccpA This work pAC4 Overexpression vector for fusion of proteins with C-terminal Avi-tagTM, AmpR GeneCopoeiaTM, Avidity, LLC, Denver, Colorado pWH2370 pAC, ccpA This work pASK-IBA17(+) Overexpression vector for fusion of proteins with N-terminal Strep-tag, AmpR IBA, Göttingen pWH2375 pASK-IBA17(+),ccpA This work pET28a-αCTD Overexpression vector for αCTD with N-terminal His-tag, KmR (Nakano et al., 2010) Table 4.8: Bacterial strains Strain Genotype Reference DH5α supE44, ∆lacU109 (φ80lacZ∆M15M), hsdR17, recA1, endA1, gqrA96, thi-1, relA1 (Ausubel et al., 1994) XL1blue endA1, gyrA96(NalR), thi-1, recA1, relA1, lac, Stratagene glnV44, F'[::Tn10, proAB+, lacIq ∆(lacZ)M15] hsdR17(rK-mK+) BTH101 F–, cya-99, araD139, galE15, galK16, rpsL1 (StrR), hsdR2, mcrA1, mcrB1 (Karimova et al., 1998) BL21(DE3) F–, dcm, ompT, hsdS (rB-mB-), gal λ(DE3), pLysS, CmR Novagen FT1 / pLysS BL21(DE3), ∆(ptsHIcrr), KmR, [pLysS, CmR] F–, ompT, hsdSB(rB- mB-), pRARE2, CmR (Parche et al., 1999) E. coli Rosetta2 Novagen 22 MATERIALS AND METHODS Strain Genotype Reference 168 trpC2 Bacillus Genetic Stock Centre WH482 trpC2, amyE::(ackA`-lacZ cat) (Sprehe et al., 2007) WH483 trpC2, amyE::(ackA`-lacZ cat), ∆ccpA, aphA3 (Sprehe et al., 2007) WH649 trpC2, ∆ccpA, aphA3, KmR (Sprehe et al., 2007) WH1012 WH649, pWH933, pWH940 Bartholomae 2008 QB5223 trpC2, ptsH1 (Martin-Verstraete et al., 1995) WH1124 WH649, pWH933, pGP382 This work WH1125 QB5223, ∆ccpA, aphA3, pWH933, pWH940, KmR, ErmR, TcR This work WH1129 WH1012, codY’-3 × Flag, SpecR This work B. subtilis 4.2 Media, buffers and solution Media, buffers, and solutions were prepared with Millipore water or deionized water and autoclaved for 20 min at 121°C and 2bar. Heat labile substances were dissolved and filtered through a sterile filter (0.2 µM). 4.2.1 Media LB 1 % (w/v) tryptone, 0.5 % (w/v) yeast extract, 1 % (w/v) NaCl TYH medium 2 % (w/v) tryptone, 1 % (w/v) yeast extract, 0.5 % (w/v) NaCl, 4.2 mM HEPES, 8.3 mM MgSO4, adjust with KOH pH 7.2-7.4 CSK 1 × C-salts, 0.6 % (w/v) sodiumsuccinate, 0.8 % (w/v) potassiumglutamate, 250 µM L-tryptophan, 1 × CAF, 1 × III’ salts CSK with glucose 1 × C-salts, 0.6 % (w/v) sodiumsuccinate, 0.8 % (w/v) potassiumglutamate, 250 µM L-tryptophan,1 × CAF, 1 × III’ salts, 0.5 % (w/v) glucose MNGE 1 × MN-medium, 1 % (w/v) glucose, 0.2 % (w/v) potassiumglutamate, 50 µg/ml L-tryptophan, 0.5 × CAF, 3 µM Mg2SO4 Expression mix 2.5 % (w/v) yeast extract, 2.5 % (w/v) CAA, 0.25 mg/ml L-tryptophan SOB 2 % (w/v) tryptone, 0.5 % (w/v) yeast extract, 8.5 mM NaCl, 2 mM KCl 4.2.1.1 Stock solutions for minimal media 10 × C salts 250 mM (NH4)2SO4, 700 mM K2HPO4, 260 mM KH2PO4 100 × III’ salts 50 mM MgSO4, 1 mM MnSO4 100 × CAF 2.2 mg/ml ferric ammonium citrate 10 × MN medium 440 mM KH2PO4, 600 mM K2HPO4, 30 mM Na3citrate, 150 mM (NH4)2SO4 MATERIALS AND METHODS 23 4.2.1.2 Additives Agar For preparation of LB plates, media was supplemented with 1.5 % (w/v) agar and all components were autoclaved together. Antibiotics Antibiotics were prepared as 1,000 fold stock solutions and stored at -20°C. After cooling the media to about 50°C, the antibiotics were added to the concentration indicated below. Antibiotic Application Solvent Final concentration Ampicillin Chloramphenicol Chloramphenicol Erythromycin Kanamycin Kanamycin Spectinomycin Streptomycin Tetracycline E. coli E. coli B. subtilis B. subtilis E. coli B. subtilis B. subtilis E. coli B. subtilis ddH2O 70 % EtOH 70 % EtOH 70 % (v/v) EtOH ddH2O ddH2O ddH2O ddH2O 70 % (v/v) EtOH 100 µg/ml 25 µg/ml 5 µg/ml 2.5 µg/ml 50 µg/ml and 100 µg/ml 15 µg/ml 100 µg/ml 100 µg/ml 12.5 µg/ml IPTG IPTG was dissolved in water as 1 M stock solution, sterile filtered and stored at -20°C. The final concentration was 1 mM. Sugars Sugars were prepared as 20 % (w/v) stock solutions in H2O, sterile filtered and added to the medium as indicated. Branched chain amino acids To ensure comparable growth of different B. subtilis deletion strains, CSK minimal medium was supplemented with 0.25 ‰ (w/v) L-isoleucine, 0.5 ‰ (w/v) L-leucine, 0.4 ‰ (w/v) L-valine, and 0.2 ‰ (w/v) L-methionine. 24 4.2.2 MATERIALS AND METHODS Buffers 4.2.2.1 General buffers TE buffer 10 mM Tris/HCl pH 8,0, 0.1 mM EDTA TB buffer 10 mM Pipes, 15 mM CaCl2, 250 mM KCl, after adjustment of pH 6.7 with KOH addition of 55 mM MnCl2; sterilization by filtration SET buffer 75 mM NaCl, 20 mM Tris/HCl pH 7.5, 25 mM EDTA pH 8.0 5 × Z-buffer 300 mM NaHPO4, 200 mM NaH2PO4, 50 mM KCl, 5 mM MgCl2, 250 mM β-mercaptoethanol 10 × cell disruption buffer 500 mM Tris/HCl pH 7.5; 2 M NaCl SBT buffer 50 mM Tris/HCl pH 7.5, 200 mM NaCl, 2 mM DTT 10 × R-buffer 200 mM Tris/HCl pH 7.5, 50 mM MgCl2, 10 mM DTT Crosslinking-solution 4 % (w/v) paraformaldehyde in 1 × PBS, only dissolves at 60°C Lysozyme mix 2 × TE, 20 mg/ml lysozyme 4.2.2.2 Buffers and solutions for agarose gel electrophoresis Agarose gel 0.8 – 2.5 % (w/v) agarose in 1 × TAE 50 × TAE buffer 2 M Tris, 50 mM EDTA, 1 M acidic acid; pH 8.3 DNA loading buffer 0.1 % (w/v) bromphenolblue, 0.1 % (w/v) xylencyanol, 50 % (v/v) glycerol in 1 × TAE 4.2.2.3 Buffers and solutions for Laemmli polyacrylamide gel electrophoresis Native PAA gel 7.5 % (v/v) Rotiphorese Gel 40 % (acrylamide / bisacrylamide: 37.5:1), 85 mM Tris/HCl pH 8.8, 100 mM Tris/boric acid pH 8.8, 400 µl 10 % (w/v) APS, 5 µl TEMED 10 × native running buffer 192 mM glycine, 50 mM Tris, pH 8.5 – 8.8 5 × native loading buffer 50 % (v/v), glycerol, 1.5 % (w/v) bromphenolblue SDS stacking gel 4 % (v/v) acrylamide (39:1), 85 mM Tris/HCl pH 6.8, 0.1 % (w/v) SDS, 400 µl 10 % (w/v) APS, 5µl TEMED SDS separation gel 7.5 – 12.5 % (v/v) Rotiphorese Gel 40 % (acrylamide / bisacrylamide: 37.5:1), 85 mM Tris/HCl pH 8.8, 100 mM Tris/boric acid pH 8.8, 0.1 % (w/v) SDS, 400 µl 10 % (w/v) APS, 5 µl TEMED 5 × SDS loading buffer 15 % (v/v) β-mercaptoethanol, 5 % (v/v) SDS, 50 % (v/v) glycerol, 1.5 % (w/v) bromphenolblue 10 × SDS running buffer 192 mM glycine, 50 mM Tris, pH 8.5, 1 % (w/v) SDS MATERIALS AND METHODS 25 4.2.2.4 Buffers and solutions for Schaegger polyacrylamide gel electrophoresis SDS separating gel (15 %) 5.6 ml Rotiphorese Gel 40 % (acrylamide / bisacrylamide: 37.5:1), 7.5 ml gel buffer, 8.1 g urea, 1.9 ml water, 80 µl 10 % (w/v) APS, 10 µl TEMED SDS stacking gel (4.5 %) 0.8 ml Rotiphorese Gel 40 % (acrylamide / bisacrylamide: 37.5:1), 1.9 ml gel buffer, 4.75 ml water, 80 µl 10 % (w/v) APS, 8 µl TEMED Gel buffer 3 M Tris, 1 M HCl, 0.3 % (w/v) SDS 5 × loading buffer 20 % (w/v) SDS, 60 % (w/v) glycerol, 250 mM Tris/HCl pH 6.8, 10 % (v/v) mercaptoethanol, 0.01 % (w/v) serva blue G 10 × cathode buffer 1 M Tris, 1 M tricine, 1 % (w/v) SDS 10 × anode buffer 2 M Tris/HCl pH 8.9 4.2.2.5 Buffers for staining of PAA gels with coomassie brilliant blue Wash solution 45 % (v/v) methanol, 10 % (v/v) acidic acid in H2O Staining solution 0.5 % (v/v) Coomassie brilliant blue R250, 10 % (v/v) acidic acid, 45 % (v/v) methanol, in H2O De-staining solution 10 % (v/v) acidic acid 4.2.2.6 Buffers for protein purification of SPINE samples Wash buffer 100 mM Tris-HCl pH 8, 150 mM NaCl, 1 mM EDTA Elution buffer 100 mM Tris-HCl pH 8, 150 mM NaCl, 1 mM EDTA, 2.5 mM Desthiobiotin Regeneration-buffer 100 mM Tris-HCl pH 8, 150 mM NaCl, 1 mM EDTA, 1 mM HABA 4.2.2.7 Buffers for protein purification Nickel affinity chromatography His A 50 mM NaH2PO4, 500 mM NaCl, 100 mM imidazole His B 50 mM NaH2PO4, 500 mM NaCl, 500 mM imidazole Regeneration-buffer 100 mM EDTA, 100 mM NiS04, 300 mM NaCl Strep affinity chromatography Strep A 100 mM Tris, pH 8.0, 150 mM NaCl, 1 mM EDTA Strep B 100 mM Tris-HCl pH 8, 150 mM NaCl, 1 mM EDTA, 2.5 mM Desthiobiotin Regeneration-buffer 100 mM Tris-HCl pH 8, 150 mM NaCl, 1 mM EDTA, 1 mM HABA 26 MATERIALS AND METHODS Avidin affinity chromatography Avi A 50 mM Tris/HCl pH 8.0, 150 mM NaCl Avi B 50 mM Tris/HCl pH 8.0, 150 mM NaCl, 5 mM D-biotin Regeneration-buffer 10 % (v/v) acetic acid, 100 mM NaPO4 Size Exclusion chromatography HBSE buffer 10 mM HEPES, pH 7.4, 150 mM NaCl, 3 mM EDTA Regereration-buffer 0.5 mM NaOH 4.2.2.8 Buffers for silver staining Fixing solution 50 % (v/v) Ethanol, 12 % (v/v) acetic acid, 0.1 % (v/v) formaldehyde 37 %, ad Millipore Sensitizer 0.02 % (w/v) Na2S2O3, ad Millipore Silver nitrate solution 0.2 % (w/v) AgNO3, 0.1 % (v/v) formaldehyde 37 %, ad Millipore Developer 6 % (w/v) Na2CO3, 2 % (v/v) sensitivizing solution, 0.05 % (v/v) formaldehyde 37 %, ad Millipore 4.2.2.9 Buffers for immunoblotting Transfer buffer 192 mM glycine, 50 mM Tris, 3 % (v/v) isopropanol, pH 8.5 – 9.0 10 × PBS pH 7.4 580 mM Na2HPO4, 170 mM NaH2PO4, 680 mM NaCl Blocking solution 5 % (w/v) skim milk powder, 0.1 % (v/v) Tween 20 in 1 × PBS Wash buffer 1 × PBS, 0.1 % (v/v) Tween 20 Wash solution Blocking solution/wash buffer: 1:1 4.3 Methods 4.3.1 General methods Table 4.9: General methods Methods Reference Agarose gel electrophoresis (Sambrook et al., 1989) Determination of DNA concentrations (Sambrook et al., 1989) Determination of protein concentrations (Bradford, 1976) DNA sequencing (Sanger et al., 1977) Coomassie staining of protein gels Ethidiumbromide staining of DNA gels (Sambrook et al., 1989) Polyacrylamide gel electrophoresis (Laemmli, 1970; Schägger & von Jagow, 1987) Commercially available systems were used as described by the manufactures. MATERIALS AND METHODS 4.3.2 27 Growth of bacteria Cells of E. coli and B. subtilis were grown in tubes or baffled flasks for 7 – 12 h at 28°C or 37°C by vigorous shaking using LB as complex medium or CSK or CSK with glucose medium as minimal media. Inoculation was performed either by supplying freshly spread colonies or 1 / 100 volume of an over night culture. Growth was monitored by measuring the OD600. 4.3.2.1 Preparation and transformation of chemically competent E. coli Chemically competent E. coli cells were prepared as described by Inoue et al. (Inoue et al., 1990). For this, 4 ml LB medium was inoculated with E. coli cells and grown for 8 h at 37°C. 1 ml of this culture was used to inoculate 250 ml SOB medium for overnight growth at 20°C in a 1 l flask. On the next day, when the culture was grown to OD600 ~ 0.4 the cells were chilled on ice for 10 min. Then, the cells were harvested by centrifugation (4,000 × g, 10 min, 4°C). The cell pellet was resuspended in 80 ml ice-cold TB buffer and centrifuged again (4,000 × g, 10 min, 4°C). After resuspending in 6.4 ml TB buffer, 400 µl DMSO was carefully added and the cells were incubated for 10 min on ice. Aliquots of 100 µl were transferred to pre-cooled reaction tubes and subsequently frozen in liquid nitrogen and stored at -80°C. For transformation, a 100 µl aliquot of chemically competent E. coli cells was thawed on ice and plasmid DNA was added. Cells were incubated for 30 min on ice. After heat shock of the cells at 42°C for 60 sec 400 µl LB medium was added and the cells were grown for 1 h at 37°C. After that, 200 µl of the cell suspension were spread on selective media and the plates were incubated at 37°C. 4.3.2.2 Preparation and transformation of naturally competent B. subtilis Naturally competent B. subtilis cells were prepared as described by Kunst et al. (Kunst & Rapoport, 1995). For this, an over night culture of the respective B. subtilis strain was inoculated in 10 ml MNGE + 1 ml CAA to an OD600 = 0.1 and grown at 37°C. At an OD600 of 1.3 – 1.8 about 11 ml MNGE medium was added and the cells were grown for another hour at 37°C. Then the competent cells were harvested by centrifugation at 5,000 rpm for 5 min at RT and the supernatant was decanted into a sterile greiner tube. The cells were resuspended in 2.6 ml of the supernatant and were adjusted to 10 % (v/v) glycerol. Aliquots of 300 µl were transferred to reaction tubes and subsequently frozen in liquid nitrogen and stored at -80°C. For transformation, a 300 µl aliquot of naturally competent B. subtilis cells were thawed in a waterbath at 37°C and a solution of 1.7 ml 1 × MN, 43 µl 20 % (v/v) glucose, 34 µl 1 M MgSO4 was added. 400 µl of this cellsupension was mixed with 1 – 5 µg DNA and grown under vigorous shaking at 37°C. A sample of cells transformed without any DNA served as a negative control. After 30 min, 100 µl expression mix was added and the cells were shaken another 60 min at 37°C, before they were spread on suitable selection plates and incubated at 37°C. 28 4.3.3 MATERIALS AND METHODS Nucleic acid purification and modification 4.3.3.1 Preparation of chromosomal DNA from B. subtilis Preparation of chromosomal DNA was performed using phenol chloroform extraction. B. subtilis strains were grown in 20 ml LB medium overnight. On the next day, cultures were centrifuged (4,000 × g, 10 min, 4°C) and the pellet was resuspended in 5 ml SET buffer with 100 µl (50 µg/ml) lyzozyme. After incubation for at least 1 h 600 µl 10 % (w/v) SDS and 150 µl proteinase K (20 mg/ml) were added and this mixture was incubated at 55°C for 2 h and inverted occasionally. Then, 2 ml 5 M NaCl was added and mixed by carefully inverting until a white precipitate occurred. Prior to the addition of 5 ml chloroform, the mixture was put on ice to cool down. After shaking for 30 min at RT the solution was centrifuged at 4,000 × g and 4°C for 15 min. The supernatant containing the DNA was separated from the organic phase by transferring into a fresh reaction tube and 0.6 fold volume of isopropanol was added. After carefully inverting, the precipitated DNA was transferred into a sterile tube, washed twice with 70 % (v/v) ethanol, dried in a Speed Vac and resolved in 500 µl TE buffer. 4.3.3.2 Polymerase chain reaction (PCR) The selective amplification of specific DNA fragments was performed by polymerase chain reaction (PCR) (Mullis et al., 1986). Either genomic DNA, plasmid DNA or a cell suspension, which had previously been incubated at 95°C for 5 min, were used as template. Primers were supplied by MWG (Ebersberg) and diluted in H2O to a final concentration of 100 pmol/µl. Depending on the primer sequence the annealing temperature was calculated. For breaking of hydrogen bonds between guanine and cytosine 4°C were estimated and for adenine and thymine 2°C. For amplification Phusion DNA polymerase (Finnzymes, Finland) was used as recommended by the suppliers. The PCR reaction mix contained: 50 – 100 ng DNA, 10 pmol/µl 3′-Primer, 10 pmol 5′-Primer, 0.5 mM dNTP mixture*, 1 × HF buffer and 2 U Phusion polymerase. The PCR was performed with a Thermocycler. First of all, template DNA was denatured by an initial incubation at 95°C for 5 min. After that, the following steps were repeated 30 times: double-stranded DNA was denatured for 30 sec at 95°C. Depending on the sequence of the primers used, annealing was performed for 30 sec at 56°C to 68°C. At a temperature of 72°C double-stranded DNA was synthesized by the polymerase. This step was carried out for 30 sec per kbp. By final incubation at 72°C for 5 min, it was ensured that the synthesis of fragments was completed. *dNTP mixture: 10 mM dATP, 10 mM dTTP, 10 mM dCTP, 10 mM dGTP 4.3.3.3 Colony PCR Colony PCR was applied for the screening of transformants. Colonies were directly picked from the selection plates and employed in the PCR reaction with Ready-To-Go-Taq beads (GE Healthcare, Munich) for B. subtilis and Taq Polymerase (NEB, Frankfurt / Main) for E. coli with suitable primers according to the manufacturer instructions. MATERIALS AND METHODS 29 4.3.3.4 Restriction DNA restriction was carried out in 1 × restriction buffer as recommended by the manufacturer. The amount of enzyme and the incubation time varied with the amount of DNA and with the reaction volume. 4.3.3.5 Dephosphorylation To dephosporylate Vector DNA the restriction enzymes were inactivated by 15 min incubation at 65°C. The DNA was incubated with 1 U shrimp alkaline phosphatase per 50 ng DNA in the presence of 1 × dephosphorylation buffer. After 15 min incubation at 37°C the enzyme was inactivated for 20 min at 65°C. 4.3.3.6 Ligation Ligation of DNA fragments was performed using T4-DNA Ligase in the presence of 1 × ligation buffer and 1 mM ATP. Normally, 20 – 50 ng of restricted Vector DNA and 20 – 100 ng of DNA fragment were ligated for 20 min at RT. 4.3.3.7 DNA gel electrophoresis DNA gel electrophoresis was carried out for analytical- and preparative separation of DNA fragments using 1 % (w/v) agarose gels. DNA probes were mixed with DNA loading buffer and loaded onto the gel. Fragments were separated at 80 – 120 V and subsequently stained for 15 min in ethidium bromide solution. After short washing in water the gel was scanned for further documentation using the BioPrint Video-Geldocu-system (Peqlab, Erlangen). PEQ Gold “Leitermix” (Peqlab, Erlangen), DNA fragments in kbp: 10 / 8 / 6 / 5 / 4 / 3.5 / 3 / 2.5 / 2 / 1.5 / 1.2 / 1.031 / 0.9 / 0.8 / 0.7 / 0.6 / 0.5 / 0.4 / 0.3 / 0.2 / 0.1. 4.3.3.8 DNA Sequencing Sequencing of DNA was performed by using the chain termination method described by Sanger et al. (Sanger et al., 1977). As chain terminators di-desoxynucleotides labeled with fluorescent dye were used (Big Dye Terminator Mix, Perkin Elmer, Weiterstadt). A sequencing sample was composed of 300 – 500 ng DNA, 5 pmol of an oligonucleotide primer and 3 µl Terminator Ready Reaction Mix. Each sample was filled with H2O to a final volume of 10 µl. Sequencing reactions were carried out as recommended by the supplier using the following PCR program: 25 × 96°C 10 sec 56°C 5 sec 60°C 4 min The resulting DNA fragments were precipitated as following. Firstly, to the 10 µl reaction mix 90 µl H2Obidest. and 10 µl 3 M Na-acetate (pH 5.0) were added and mixed by vortexing. Secondly, the 30 MATERIALS AND METHODS solution was mixed with 250 µl 96 % (v/v) ethanol and centrifuged for 15 min at 13,000 rpm. Then the pellet was washed with freshly prepared 70 % (v/v) ethanol prior to centrifugation for 5 min at 13,000 rpm. Finally, the pellet was dried in a Speed-Vac, solved in 12 µl formamide, investigated with the ABI PRISM Genetic Analyser 310 (Applied Biosystems, Freiburg) and sequence data were evaluated with the Seqman software (DNAstar, Madison, USA). For further sequence analyses, samples containing 30 µl of plasmid DNA (30 – 100 ng/µl) and 10 µl of an appropriate sequencing primer (10 pmol/µl) were sent to GATC Biotech (Konstanz). Sequence data were also analyzed using the Seqman software (DNAstar, Madison, USA). 4.3.4 Protein purification and characterization 4.3.4.1 SDS polyacrylamide gel electrophoresis (PAGE) Gels (5 – 15 % PAA) with a width of 1 mm were prepared as described by (Laemmli, 1970) (for protein purification) and by (Schägger & von Jagow, 1987) (for silver staining and immunoblotting). All samples were mixed with the appropriate SDS-loading buffer and electrophoresis was carried out at 100 – 150 V. After electrophoresis the gels were fixed for 20 min in wash solution, stained for 30 min in staining solution and destained for several hours in destaining solution. PEQ Gold protein marker II, Peqlab, Erlangen, molecular weight in kDa: 200 / 150 / 120 / 100 / 90 / 70 / 60 / 50 / 40 / 30 / 25 / 20 / 15 / 10. 4.3.4.2 Silver staining of PAA gels PAA gels were silver stainded with the following procedure which is compatible for mass spectrometric analysis. After electrophoresis all following steps were performed on a horizontal shaker with gentle shaking. At least one hour or over night Fixing solution 3 × 20 min 50 % (v/v) ethanol 1 min Sensitizer 3 × 20 sec Millipore water 15-25 min Silver nitrate solution 3 × 20 sec Millipore water 1-30 min (until staining is sufficient) Developer 2 × 20 sec Millipore water 10 min Stop solution 2 × 20 sec Millipore water The stained gels were shrink-wrapped and stored at 4 – 8°C. MATERIALS AND METHODS 31 4.3.4.3 Immunoblot analysis For immunoblot analyses of CcpA, HPr, RpoA and CodY-Flag, B. subtilis crude extracts and elution fractions from SPINE were separated by SDS-PAGE. The gel was washed for 30 min in transfer buffer; the PVDF membrane was activated for 15 min in methanol and subsequently washed another 15 min in transfer buffer. The proteins were transferred to the membrane by electroblotting at 15 V for 45 min. Afterwards the membrane was treated as followed: 2 × 10 min wash buffer 3 h or over night blocking solution 1h incubation with primary antibody (the primary antibodies were diluted 1 : 1 in wash buffer : wash solution as followed: anti-CcpA 1 : 5,000, antiHPr 1 : 5,000, anti Crh 1 : 10,000, anti-RpoA 1 : 1,000 and anti-Flag 1 : 2,000) 3 × 10 min wash solution 1h incubation with secondary antibody (anti-rabbit IgG or anti-mouse IgG 1 : 10,000 in wash buffer : wash solution = 1 : 1) 3 × 10 min wash solution 5 – 10 min luminescence reaction with ECL substrate (solution A : B = 1 : 1) (Thermo Scientific, Schwerte) CcpA and HPr were detected with rabbit polyclonal antisera raised against B. subtilis CcpA and HPr, respectively. DnaK, RpoA, CodY-Flag were dected with mouse monoclonal antibodies. The antibodies were visualized with the corresponding secondary antibodies anti-rabbit IgG-HRP and antimouse IgG-HRP, respectively, with the ECL detection system (GE Healthcare, Munich). 4.3.4.4 Growth of bacteria for protein overexpression For overexpression 2 × 1 l LB broth were inoculated with an over night culture from cells of the corresponding E. coli overexpression strain to a start OD600 of ~ 0.05 and the cultures were grown at 37°C under agitation. Growth was monitored by measuring the optical density at 600 nm. For overproduction of recombinant proteins, the bacteria were grown to OD600 = 0.4 – 0.6 and expression was induced addition of IPTG to a final concentration of 1 mM. After further incubation for 3 – 4 h the cells were harvested by centrifugation (5,000 × g, 10 min, 4°C). 4.3.4.5 Sonication Crude protein extracts were obtained by sonification of cells with a Labsonic sonifier. Usually, cells were resuspended in a suitable volume of cell disruption buffer (for immunoblotting), 10 mM Tris/HCl pH 7.5 or His A (for protein preparation). Each buffer contained 1 × complete (Roche, Mannheim). Lysates were obtained by sonication with a tip size-dependent of the applied volume (small tip for volumes < 5 ml, large tip for volumes > 5 ml). Three to five 30 sec pulses of 45 W were performed. During and between each pulse the cell containing tube was cooled on ice. Soluble proteins were obtained after centrifugation at 4°C for 30 min at 20,000 rpm. 32 MATERIALS AND METHODS 4.3.4.6 Purification of CcpA(His)6 from B. subtilis C-terminally His6-tagged CcpA, from B. subtilis was expressed in E. coli FT1 pWH653 (Seidel et al., 2005). A pellet resulting from two liters of overexpression culture was resuspended in 40 ml His A buffer (80 mM Imidazol with 1 × complete). After cell disruption by sonication 10 mg/ml DNaseI and 5 mg/ml RNase A were added, and the lysate was incubated for 20 min on ice, before insoluble cell components were separated by centrifugation (20,000 rpm, 40 min, 4°C). Purification was achieved by Ni-affinity chromatography on a 1 ml Ni2+-NTA column (His trap 1 ml, GE Healthcare). After a washing step with 20 ml His A buffer, bound CcpA(His)6 was eluted by a linear gradient (25 ml, 0 – 100 % His B), followed by a batch elution (10 ml, 100 % His B). CcpA(His)6 eluted at about 30 – 40 % His B buffer. CcpA(His)6 containing fractions were concentrated to a maximum volume of 5 ml and further purified by size exclusion chromatography on Superdex G200 column, using an ÄKTA prime chromatograph (GE Healthcare, Munich). 4.3.4.7 Purification of CodY(His)6 from B. subtilis His-tagged CodY from B. subtilis was overexpressed in E. coli BL21(DE3) pLysS / pWH2177. The pellets of 2 l culture were resuspended in 50 ml His A buffer (120 mM Imidazol) and 1 × complete (Roche, Mannheim), disrupted by ultrasonication and incubated with 5 µg/ml RNaseA and 10 µg/ml DNaseI for 20 min on ice before centrifugation for 30 min at 48,000 × g at 4°C. His-tagged CodY, was purified by Ni-affinity chromatography on a 5 ml Ni2+-NTA column (His trap 5 ml, GE Healthcare). After a washing step with at least 50 ml His A, bound His-tagged CodY was eluted by a linear gradient (50 ml, 0 – 100 % His B), followed by a batch elution (30 ml, 100 % His B). CodY eluted at about 25 – 35 % His B buffer. CodY containing fractions were concentrated to a maximum volume of 5 ml and further purified by size exclusion chromatography on a Superdex G75 column, using an ÄKTA prime chromatograph (GE Healthcare, Munich). 4.3.4.8 Purification of RpoA(His)6 from B. subtilis His-tagged RpoA from B. subtilis was overexpressed in E. coli BL21(DE3) pLysS / pWH2175. The pellets of 2 l culture were resuspended in 50 ml His A buffer (80 mM Imidazol) and 1 × complete (Roche, Mannheim), disrupted by ultrasonication and incubated with 5 µg/ml RNaseA and 10 µg/ml DNaseI for 20 min on ice before centrifugation for 30 min at 48,000 × g at 4°C. His-tagged RpoA, was purified by Ni-affinity chromatography on a 1 ml NTA column (His trap 5 ml, GE Healthcare). After a washing step with at least 25 ml His A, bound His-tagged RpoA was eluted by a linear gradient (30 ml, 0 – 100 % His B), followed by a batch elution (10 ml, 100 % His B). RpoA eluted at about 25 – 65 % His B buffer. RpoA containing fractions were concentrated to a maximum volume of 5 ml and further purified by size exclusion chromatography on a Superdex G200 column, using an ÄKTA prime chromatograph (GE Healthcare, Munich). 4.3.4.9 Purification of αNTD(His)6 from B. subtilis His-tagged αNTD from B. subtilis was overexpressed in E. coli BL21(DE3) pLysS / pWH2176. The pellets of 2 l culture were resuspended in 50 ml His A buffer (120 mM Imidazol) and 1 × complete, disrupted by ultrasonication and incubated with 5 µg/ml RNaseA and 10 µg/ml DNaseI for 20 min on MATERIALS AND METHODS 33 ice before centrifugation for 30 min at 48,000 × g at 4°C. His-tagged αNTD, was purified by Ni-affinity chromatography on a 5 ml Ni2+-NTA column (His trap 5 ml, GE Healthcare). After a washing step with at least 50 ml His A, bound His-tagged αNTD was eluted by a linear gradient (50 ml, 0 – 100 % His B), followed by a batch elution (30 ml, 100 % His B). CodY eluted at about 20 – 35 % His B buffer. αNTD containing fractions were concentrated to a maximum volume of 5 ml and further purified by size exclusion chromatography on a Superdex G75 column, using an ÄKTA prime chromatograph (GE Healthcare, Munich). 4.3.4.10 Purification of αCTD(His)6 from B. subtilis N-terminally (His)6-tagged αCTD was overproduced in E. coli Rosetta2 pET28a- αCTD (Nakano et al., 2010). The pellet of 1 l culture was resuspended in 25 ml His A buffer (120 mM Imidazol) and 1 × complete, disrupted by ultrasonication and incubated with 5 µg/ml RNaseA and 10 µg/ml DNaseI for 20 min on ice before centrifugation for 60 min at 48,000 × g at 4°C. αCTD(His)6, was purified by Ni-affinity chromatography on a 1 ml NTA column (His trap 1 ml, GE Healthcare). After a washing step with at least 50 ml His A, bound His-tagged αNTD was eluted by a linear gradient (30 ml, 0 – 100 % His B), followed by a batch elution (10 ml, 100 % His B). Due to the lack of any tryptophan and other aromatic residues, hardly any peak in the elution profile for αCTD was observed. Nevertheless, αCTD actually eluted at about 60-75 % His B buffer and was clearly detected in SDSPAGE analysis. αCTD containing fractions were concentrated to a maximum volume of 5 ml and further purified by size exclusion chromatography on a Superdex G75 column, using an ÄKTA prime chromatograph (GE Healthcare, Munich). 4.3.4.11 Purification of HPr seryl phosphorylated form from B. subtilis C-terminally His6-tagged CcpA, from B. subtilis was expressed in E. coli FT1 pWH466 as described (Seidel et al., 2005). Cells of 1 l culture were harvested by centrifugation, resuspended in buffer A and disrupted by sonication. The crude lysate was incubated with 5 µg/ml RNaseA and 10 µg/ml DNaseI on ice for 20 min and after centrifugation for 30 min at 48,000 × g at 4°C the soluble proteins were obtained. Subsequently the proteins were prepurified by heat denaturation for 20 min at 70°C as HPr is heat stable. The precipitate was then separated from the soluble protein by centrifugation for 30 min at 48,000 × g at 4°C. For in vitro serine phosphorylation a kinase extract from E. coli DH5α p4813 was added to the heat denatured crude lysates. The reaction mixtures were incubated for 20 min at 37°C and then immediately loaded on a Sepharose Q FF column (HiPrep Q FF, 20 ml, GE Healthcare, Munich) for anion exchange chromatography on an ÄKTA prime chromatograph. After washing with buffer A, proteins were eluted using a linear gradient (50 ml, 0 – 50 % buffer B), followed by a batch elution (30 ml, 100 % buffer B). Suitable protein fractions were then concentrated in a pressure dialysis device using YM3 membranes and then purified by size exclusion chromatography on a Superdex G75 column on an ÄKTA prime chromatograph (GE Healthcare, Munich). Pure protein fractions were concentrated in Centriprep concentrators and stored at 4°C in HBS-EP buffer. 34 MATERIALS AND METHODS 4.3.4.12 Purification of Strep-tagged CcpA N-terminally Strep-tagged CcpA, from B. subtilis was expressed in E. coli BL21(DE3) pWH2375. For overexpression 1 l LB medium was inoculated with 5 ml of an overnight culture. The cells were grown at 37°C to an OD600 of 0.4 – 0.6 and then gene expression was induced by addition of 200 µg ATC (Anhydrotetracycline) and further incubation 3 – 4 h. Cells of 1 l culture were harvested by centrifugation at 5,000 × g for 10 min. For purification the pellet was resuspended in 25 ml Strep A buffer and 1 × complete (Roche, Mannheim), disrupted by ultrasonication and incubated with 5 µg/ml RNaseA and 10 µg/ml DNaseI for 20 min on ice before centrifugation for 30 min at 48,000 × g at 4°C. Strep-tagged CcpA was purified by affinity chromatography on a Streptactin column (1 ml, GE Healthcare, Munich). After a washing step with 30 ml Strep A, bound Strep-tagged CcpA was eluted by a batch elution (20 ml, 100 % Strep B). Protein containing fractions were concentrated to a maximum volume of 5 ml and further purified by size exclusion chromatography on a Superdex G200 column using an ÄKTA prime chromatograph (GE Healthcare, Munich). Pure protein fractions were concentrated and stored at -20°C in HBSE buffer and 50 % glycerol. 4.3.4.13 Purification of Avi-tagged CcpA N or C-terminally Avi-tagged CcpA, from B. subtilis was expressed in E. coli AVB101 / pBirAcm pWH2369 or AVB101/pBirAcm pWH2370, respectively. For overexpression 1 l TYH medium supplemented with 20 ml 20 % (w/v) glucose was inoculated with 5 ml of an overnight culture. The cells were grown at 37°C to an OD600 of 0.7 and then gene expression was induced by addition of 10 ml of 5 mM biotin solution* (50 µm final) and IPTG to a final concentration of 1.5 mM and further incubation 3 – 4 h. Cells of 1 l culture were harvested by centrifugation at 5,000 × g for 10 min. For purification the pellet was resuspended in 25 ml Avi A buffer and 1 × complete (Roche, Mannheim), disrupted by ultrasonication and incubated with 5 µg/ml RNaseA and 10 µg/ml DNaseI for 20 min on ice before centrifugation for 30 min at 48,000 × g at 4°C. AviCcpA was purified by affinity chromatography on a monomeric Avidin column (Soft link release Avidin resin; Promega, Mannheim). The use of a monomeric avidin allows biotinylated molecules to be eluted using mild, non-denaturing conditions. Dissociation of the avidin tetramer into its monomeric subunits leads to a conformational change within each subunit. This is accompanied by an increase in the KD for biotin to about 10-7 M, however, the high specificity of binding for biotinylated molecules is retained. This equilibrium constant readily permits elution under mild conditions, typically using competitive elution with free biotin. Free monomeric avidin subunits readily reassociate to form tetramers. To preserve these lower affinity binding sites, avidin monomers must be immobilized on a matrix such that the subunits are spatially separated. After a washing step with 30 ml Avi A, bound AviCcpA was eluted by a linear gradient (50 ml, 0 – 100 % Avi B), followed by a batch elution (30 ml, 100 % Avi B). Protein containing fractions were concentrated to a volume of 5 ml and further purified by size exclusion chromatography on a Superdex G200 column using an ÄKTA prime chromatograph (GE Healthcare, Munich). Pure protein fractions were concentrated and stored at -20°C in HBSE buffer and 50 % glycerol. *Biotin solution: 12 mg D-biotin in 10 ml of warm 10 mM bicine buffer (pH 8.3); filtersterilizing with a 0.2 µm filter. MATERIALS AND METHODS 35 4.3.4.14 Determination of protein concentration Protein concentrations were determined spectrophotometrically using Bio-Rad protein assay. For a standard a solution of BSA was used, which had been adjusted to a concentration of 200 µg/ml. 4.3.4.15 Storage and dialysis of proteins CcpA(His)6, RpoA(His)6, αNTD(His)6, αCTD(His)6 and CodY(His)6 preparations were adjusted to 50 % (w/v) glycerol, 1 × HBSE and stored at -20°C. For SPR analyses all proteins were freshly purified except αCTD(His)6 which was dialyzed 3 – 4 times against the 1,000 fold volume of HBSEbuffer under slow stirring at 4°C. Slide-A-Lyzer Dialysis units were used for dialysis of small volumes (up to 100 µl). 4.3.4.16 Surface plasmon resonance measurements (SPR) SPR measurements with CcpA, CodY, αCTD or αNTD each from B. subtilis, were performed on a BIAcoreX instrument at 25°C (BIAcoreX, Uppsala, Sweden). For the analysis of protein–protein interactions αNTD, αCTD or CodY, respectively, were immobilized by amine coupling on the carboxylated dextran matrix of a CM5 sensorchip (Biacore AB) in flowcell 2. After activation of the carboxylated dextran matrix of a CM5 chip by injecting 35 µl of a mixture containing 50 mM NHS (N-hydroxysuccinimide) and 200 mM EDC (1-ethyl-3-(3-dimethylaminoproply)carbodiimide) the proteins were injected at about 0.5 µM to 1 µM concentrations in 10 mM sodiumacetate, pH 4.5 and about 3,000 – 4,500 RU of the protein of interest were coupled. After coupling residual activated carboxyl groups were deactivated by injection of 1 M ethanolamine hydrochloride⁄NaOH, pH 8.5. Flowcell 1 served as a reference and was only activated and deactivated with ethanolamine without coupling of a ligand. HBS-EP buffer (Biacore, GE Healthcare) was used as a running buffer during immobilization and at 25 µl/min during interaction analyses. The analyzed proteins were titrated in 50 µl to 100 µl volumes. The titrations for the kinetic measurements have been carried out at least twice for each protein complex, CcpA–αNTD, CcpA–αCTD, CodY–αNTD and CodY–αCTD. The equilibrium constant of CcpA–CodY was determined by Langmuir fits of plots from the steady state response vs. the analyte concentrations from at least two different titrations. For analyzing the protein-protein interaction the protein solutions were freshly prepared as stock solutions in HBS-EP and adjusted to pH 7.4. To avoid bulk shift effects the proteins were supplied in increasing concentrations both in the analyte mixture and in the running buffer. 36 4.3.5 MATERIALS AND METHODS Proteomic analysis 4.3.5.1 Growth conditions and preparation of protein extracts The B. subtilis strains were grown in 10 ml LB medium supplemented either with or without 1 % (w/v) glucose in 100 ml Erlenmeyer flasks at 180 rpm and 37°C. Growth was monitored by measurement of the OD600. Cells were harvested during exponential growth phase at an OD600 of about 0.4 – 0.5 by centrifugation (10,000 rpm, 4°C, 10 min) and washed twice with ice-cold cell disruption buffer. Bacteria were resuspended in cell disruption buffer with 1 × complete (Roche, Mannheim) and disrupted by ultrasonication. After cell disruption, the cell lysate was cleared by centrifugation at 20,000 rpm and 4°C for 30 min. The protein concentration of the supernatant was determined by Bio-Rad assay and the remaining soluble protein was stored at -20°C. 4.3.5.2 Strep protein interaction experiment (SPINE) B. subtilis WH1012, WH1124, WH1125 and WH1129, encoding StrepCcpA was used for in vivo crosslinking experiments (SPINE). After growing on selective LB plates (Km, Erm, Tc, (Spec)) 4 ml of LB with appropriate selective markers were inoculated with one single colony of each strain over day at 37°C until the OD600 reached ~ 0.5. Afterwards an over night culture with the appropriate minimal medium (CSK with or without 0.5 % (w/v) glucose) was inoculated to an OD600 ~ 0.05 and grown at 37°C. The next day 2 l flasks containing each 1 l of CSK medium with or without 0.5 % glucose were inoculated with the corresponding over night culture to a start OD600 ~ 0.02 and grown at 37°C. When the cells entered the log phase at OD600 ~ 0.35 each culture was divided into two parts. The first part was immediately harvested (5,000 × g, 10 min, 4°C) and served as non-crosslinking control. For in vivo crosslinking the second part of the cells were treated with 90 ml 4 % (w/v) formaldehyde-solution for 20 min and then harvested (5,000 × g, 10 min, 4°C). Next, the cells of both pellets were each resuspended in 10 ml washing buffer. The cells were disrupted at least 5 times by French Press using the 35 ml piston (1,000 psi). After removing the cell debris by ultracentrifugation (45,000 rpm, 1 h, 4°C) the soluble proteins were isolated by Strep affinity chromatography via gravimetric 500 µl Strep-Tactin® columns (IBA, Göttingen, Germany). The bound protein complexes were washed 4 times with 1.5 ml of disruption buffer before the Strep-tagged protein complexes were eluted with 250 µl and 3 times 500 µl elution buffer containing 2.5 mM D-desthiobiotin. After elution, the crosslinked complexes were resolved by heating the samples for 30 min at 100°C prior to electrophoresis. The released interaction partners were visible as additional bands next to the Strep-tagged protein. 4.3.5.3 MS analysis of SPINE eluates To discriminate between signals of specifically crosslinked interaction partners of CcpA and coeluted impurities, for the preparation of SPINE eluates subjected to MS analysis, cultures were grown in CSK medium either in the presence of 14N or 15N (medium supplemented with 15N Ammonium sulphate, L-leucine, L-isoleucine, L-methionine and L-valine, but normal 14N tryptophan) (Dreisbach et al., 2008). SPINE was carried out with 1:1 mixtures of crosslinked 14N- and non-crosslinked 15Nlabeled cultures and vice versa. Following reduction by 2.5 mM DTT (1 h at 60°C) two technical replicates (each 2 µg) per eluate were subjected to proteolytic digest with trypsin in a ratio of 1:25. MATERIALS AND METHODS 37 Desalting of peptide extracts and subsequent LC-ESI-MS / MS analysis on a LTQ-FTICR mass spectrometer (Thermo Scientific, Bremen, Germany) equipped with a nano-UPLC (Waters, Manchester, U.K.) was performed as previously described (Hammer et al., 2011). Data sets were searched using the Sequest algorithm rel. 2.7 (Sorcerer built 4.04, Sage-N Research Inc., Milpitas, CA, U.S.A.) against a forward-reverse Swiss-Prot database limited to Bacillus subtilis, 4244 entries, (Barbe et al., 2009). Tandem MS data sets were searched twice to match spectra to peptides generated from 14 N as well as 15N labeled peptides. Parent mass tolerance (MS) was set to 10 ppm and fragment mass tolerance 1 Da. Methionine oxidation was considered as optional modification as well as 14N tryptophane in the 15N search. Protein identification was based on at least two significant peptides annotated in Scaffold rel. 3.3 (Proteome Software, Portland, OR) at a Peptide Prophet probability of 95 % corresponding to false positive rate <0.5 %. Quantification was planned on base of peptide signal intensities. However, most of the proteins were only identified after crosslinking but were not observed at all in non-crosslinked samples although the bait CcpA was obtained in comparable amounts. Data following this pattern cannot be handled well by software packages (Census, TPP) commonly used for quantification of labeled samples. Therefore, quantification was performed based on the number of spectral counts obtained per protein (Old et al., 2005). Proteins were considered as putative interaction partners of CcpA if enrichment of more 1.5 fold was observed in both crosslinked samples analyzed in duplicate (total four data sets) and quantitative value (spectral count) was 6 in at least one sample. 4.3.6 Enzyme assays 4.3.6.1 Bacterial two hybrid assay The bacterial Two-Hybrid-System (BACTH) (Karimova et al., 1998) in E. coli is a genetic test system which allows the identifcation of directly interacting proteins by the functional reconstitution of the adenylate cyclase activity of the Bordetella pertussis adenylate cyclase, Cya. This enzyme is composed of two complementary fragments, T25 and T18, that are both necessary to form an active enzyme. In this assay these two cya fragments, T18 and T25, are physically separated by expression of each fragment on vectors in an E. coli ∆cya strain, and therefore they cannot reconstitute a functional enzyme. However, when T25 and T18 domains are fused to peptides or proteins that are able to interact, the complex formation of these fusion proteins results in a functional complementation between the adenylate cyclase fragments and consequently to the synthesis of cAMP. The signal molecule cAMP binds to CAP, the catabolite activating protein, and the CAP-cAMP complex triggers the transcriptional activation of catalytic operons such as lac. Then, bacteria are able to utilize lactose or maltose as carbon source and can bei distinguished on indicator or selective media. Here, the expression of the reporter gene lacZ can be analyzed in a β-galactosidase activity assay (Figure 4.1). 38 MATERIALS AND METHODS A B T25 T18 C X T18 Y T25 T25 ATP T18 cAMP cAMP ATP cAMP D cAMP CAP CAP + CAP CAP on cAMP-CAP promoter reporter gene (lac, mal) Figure 4.1: Principle of the E. coli two-hybrid system (BACTH) which is based on functional reconstiution of CyaA fragments. (A) Schematic of the basic principle of functional in vivo complementation between the two fragments of the catalytic domain of Bordetella pertussis adenylate cyclase. The two boxes represent the T25 and T18 fragments of the Cya protein. (B) The two fragments T25 and T18, physically separated when coexpressed as independent polypeptides, are unable to interact and AMP synthesis does not occur. (C) If two interacting proteins, X (blue) and Y (red), are fused to the T18 and the T25 fragments, the interaction causes a close proximity of both Cya domains and results in functional complementation. This leads to the conversion of ATP to cAMP. (D) Schematic of the readout of the complementation. The complementation of T18 and T25 leads to cAMP synthesis. cAMP binds to CAP and the cAMP-CAP complex can recognize specific promoters and activate the transcription of reporter genes, such as the lacZ gene. The vectors, which either contain the T18 or the T25 domain of the adenylate cyclase, can be used to fuse the interesting proteins to the N- or the C-terminus of the T18 or the T25 domain (e. g. T25-proteinX or proteinX-T25). The name of the vectors, the name of the resulting fusion protein and a schematic of the fusion protein is listed in Table 4.10. Proteins fused to these domains are hereinafter named as described in Table 4.10. Table 4.10: Vectors, their function and the designation of the protein fusions Vector Name of the fusion protein pUT18C T18-protein X pUT18 protein X-T18 pKNT25 T25-protein X pKT25 protein X-T25 Fusion protein X T18 T18 X T25 X X T25 If the tested proteins interact in the reporter strain, the T18 and the T25 fragments can recognize each other and then they can catalyze the conversion of ATP to cAMP. As positive control for proteinprotein interactions the fusions of the adenylate cyclase fragments to the yeast GCN4 leucine zipper (Karimova et al., 1998), are used. MATERIALS AND METHODS 39 4.3.6.2 Liquid β-galactosidase assay in E. coli After cotransformation of strain BTH101 with the two complementary Cya fragments T18 and T25 constructs (plasmids expressubg T18 and T25 fusion protein, respectively) and growth of the transformants on the seletive Media plates (LB, Amp, Km, X-Gal and ITPG) three test tubes with 4 ml LB-media (Amp, Km, ITPG) were each inoculated with a single colony per construct combination. The over night cultures were grown at 30°C. For each of the three cultures per construct combination, a fresh test tube was inoculated in fresh media (4 ml LB-medium with Amp, Km, ITPG) to an OD600 of ~ 0.1. The interaction of pUT18C-zip (Cya fragment T18 fused to GCN4-leucine-zipper) and pKT25-zip (Cya fragment T25 fused to GCN4-leucine-zipper) was set to 100 % as reference control, which typically varied from 950 to 1700 Miller units in the individual experiments. As negative control for interaction the strain was cotransformed with unfused Cya domains expressing plasmids pUT18C and pKT25. The cells were incubated at 30°C under vigorous agitation to an OD600 reached 0.4 – 0.6 and subsequently 1 ml of the cell culture was frozen in liquid nitrogen, to stop growth. The aliquots were stored at -80°C. For determination of β-galactosidase activities 100 µl of the cell suspension was filled in glass tubes containing 725 µl LB 200 µl 5 × Z-buffer. 800 µl LB with 200 µl 5 × Z-buffer served as reference. After the addition of 25 µl 0.1 % SDS and 50 µl chloroform to each reaction sample, the glass tubes were vortexed and incubated at 28°C for 20 min for cell lysis. To start the reaction 200 µl ONPG solution (4 mg/ml in 1 × Z buffer) were added, subsequently the glass tubes were thoroughly vortexed. The enzyme β-galactosidase catalyzes the hydrolysis of ONPG to galactose and o-nitrophenol which can be detected photometrically at a wavelength of 420 nm. As soon as reaction mixtures turned to a clear yellow color in comparison to the control sample with no cell suspension, the reaction was stopped by the addition of 500 µl 1 M Na2CO3 and vortexing. The reaction time was recorded and then 300 µl of each sample were pipetted into a 96-well-plate. The absorption of these solution was measured at 420 nm and 550 nm, respectively, using the TECAN SpectraFluor Plus. The β-galactosidase activities [Miller-Units] were calculated as follows: 1.75 A420: Absorption of o-nitrophenol 5 mM MgSO4 A550: light scattering of cell debris 250 mM β-mercaptoethanol A600: cell density at 600 nm t: time interval between start and end of the reaction in minutes V: volume of cell suspension used 1.75: correction factor for B. subtilis cells scattering light at 420 nm 4.3.6.3 Liquid β-galactosidase assay in B. subtilis An over night culture grown without glucose was inoculated in fresh media without and with 1 % (w/v) glucose to an OD600 = 0.1. The cells were incubated at 37°C under vigorous agitation until the desired OD600 was reached subsequently 1 ml of cell culture was frozen in liquid nitrogen and stored at -80°C. For determination of β-galactosidase activities 100 µl of the cell suspension was filled in glass tubes containing 900 µl Z-buffer. 1 × Z-buffer served as reference. After the addition of 10 µl 40 MATERIALS AND METHODS lysozyme solution (10 mg/ml in Z-buffer), glass tubes were vortexed and incubated at 28°C for 20 min. After addition of 20 µl Triton X-100 and 10 min incubation at 28°C the reaction was started by addition of 200 µl ONPG (4 mg/ml in 1 × Z-buffer) followed by and thoroughly vortexing. As soon as reaction mixtures turned yellow, the reaction was stopped by the addition of 500 µl 1 M Na2CO3. The reaction time was recorded and then 300 µl of each sample were pipetted into a 96-well-plate. The absorption of these solution was measured at 420 nm and 550 nm, respectively, using the TECAN SpectraFluor Plus. The β-galactosidase activities [Miller-Units] were calculated as described in 4.3.6.2. 4.3.7 Software and computer analyses Table 4.11: Software used in this work Program Applicance Adobe® Photoshop® CS4 Digital image processing Vector NTI Suite 8.0 Informax, Inc. Bethesda, USA Processing of DNA sequence data and administration of vector database Clone Manager 5 Construction of plasmids, Processing of DNA sequence data and administration of vector database DNASTAR SeqManTM II Sequence alignment editor (abi-files) Microsoft® Office Standard Edition 2003 Generation of text documents, diagrams and tables SigmaPlot 9.0 Calculation of binding constants Pymol 0.99rc1 Model building tools for molecular graphics EndNote 10.0 Generating reference index Table 4.12: Internet services used in this work URL Provider Appliance http://genolist.pasteur.fr/Colibri Institute Pasteur, Paris, France Genome database of E. coli http://genolist.pasteur.fr/SubtiList Institute Pasteur, Paris, France Genome database of B. subtilis http://www.subtiwiki.unigoettingen.de/wiki/index.php University of Göttingen, Germany Genome database of B. subtilis http://www.ch.embnet.org/software/ ClustalW.html EMBnet; Swiss Institute of Bioinformatics, Switzerland DNA and protein database http://www.expasy.ch/tools/pi_tool.html Swiss Institute of Bioinformatics, Switzerland Proteomic database, calculation of isoelectric points and molecular weights http://www.ncbi.nlm.nih.gov National Center for Biotechnology Information at the National Institutes of Health, Bethesda, USA DNA and protein database searches, BLAST server; literature research RESULTS 41 5 Results 5.1 Strategy for the isolation and the identification of CcpA interacting proteins involved in transcriptional activation of ackA by in vivo crosslinking CcpA plays an important role as a transcriptional repressor, however, it also activates the transcription of genes. One of these, ackA, is involved in overflow metabolism. In the presence of glucose ackA is activated to different levels depending on the growth phase (Grundy et al., 1993a) and it is cooperatively coactivated by the pleiotropic global regulator CodY (Shivers et al., 2006). Interestingly, distinct CcpA variants with point mutations in the hinge helix, the coeffector binding region and the C-terminal subdomain abolish the regulation of some but not all target genes of CcpA in vivo and in vitro studies (Diel, 2005; Horstmann et al., 2007; Seidel et al., 2005; Sprehe et al., 2007; Turinsky et al., 2000). From these results and the versatility of known interaction partners of CcpA it is assumed that there are very likely further unknown interaction partners of CcpA. For identification of these unknown interaction partners in vivo crosslinking experiments were performed. Here, the Strep Protein Interaction Experiment (SPINE) was applied using Strep-tagged CcpA. SPINE allows the isolation of complexes formed in vivo between a target protein and its interaction partners. It is based on reversible crosslinking of proteins with a Strep-tagged target protein which is mediated by addition of formaldehyde. Because formaldehyde easily passes membranes and since it connects only biomolecules in close proximity to each other (~ 0.2 nm), this small molecule is commonly used for crosslinking protein complexes in vivo (Das et al., 2004; Dedon et al., 1991). The crosslinked protein-complexes are subsequently purified with the Strep-tagged target protein by affinity purification via specific binding to streptactin. To resolve the crosslinks the Strep-tagged protein complexes eluted are boiled and separated via SDS-PAGE. The gel is then analyzed for additional bands either visually by silver staining, or experimentally by immunoblot analysis and mass spectrometry. A scheme of the SPINE protocol is depicted in Figure 5.1. 42 RESULTS 20 min of incubation H H + formaldehyde H H C=O C=O + distance 2Å growth of the strain with Strep-tagged protein cell harvesting cell disruption ultracentrifugation resolving of complex by heating affinity purification tagged protein interaction protein SDS-PAGE crosslinked complex Figure 5.1: Procedure of protein crosslinking, complex isolation and detection by SPINE Growing cells of B. subtilis are treated with formaldehyde for 20 min and then harvested. Next the cells are disrupted and crosslinked Strep-tagged protein complexes are isolated from the soluble fraction of the crude lysate by Strep affinity chromatography. After elution, the crosslinked complexes are resolved by heating the samples prior to electrophoresis. The released interaction partners are visible as additional bands next to the Strep-tagged protein. The coeluted proteins are identified by immunoblotting or mass spectrometry. RESULTS 43 5.2 Isolation of CcpA complexes involved in transcriptional activation of ackA by SPINE 5.2.1 Construction of WH1012 and optimization of in vivo crosslinking The SPINE approach is based on the isolation of crosslinked complexes of Strep tagged target proteins and was applied to identify CcpA complexes which were active in repression and acitivation. Since the majority of the genes are only repressed by CcpA, this experiment was accomplished with multiple copies of the ackA promoter which is activated by CcpA. For this purpose, an ackA promoter fragment was cloned in the high copy vector pWH1520 and the resulting plasmid was named pWH933. In addition, ccpA was fused to Strep-tag coding DNA in the vector pWH940 to express StrepCcpA for affinity purification. The CCR activity of this StrepCcpA was similar to wildtype CcpA (Bartholomae, 2008). To express only Strep-tagged CcpA in the cells, a ccpA deletion mutant, B. subtilis WH649, was transformed with pWH933 and pWH940 and the resulting in strain WH1012 (Bartholomae, 2008), which was used in the following experiments. First, the expression of episomally encoded StrepCcpA was analyzed by immunoblotting and compared to chromosomally encoded CcpA. Therefore, cells of the following strains were investigated: B. subtilis 168 trp-, WH1012 and the control strain WH1124. This strain is a ∆ccpA mutant derived from WH1012 and carries the empty strep vector pGP382 instead of pWH940 (StrepCcpA). The crude protein lysates obtained in the mid exponential phase were analyzed with an anti-CcpA antibody and an anti-DnaK antibody (Fig. 5.2). 1 2 3 4 5 DnaK CcpA Figure 5.2: Steady state level of CcpA in B. subtilis 168, WH1012 and WH1124 CcpA amounts (lower row) in crude protein lysates of cells isolated in the mid exponential growth phase from the strains B. subtilis 168 trp- (lane 3), WH1012 (lane 4) and WH1124 (∆ccpA) (lane 5). Purified Histagged CcpA served as control (lane 1); lane 2 was empty. As loading control, DnaK was detected with a monoclonal anti-DnaK antibody (upper row). With respect to the loading control DnaK, Strep-tagged CcpA is expressed at a higher level than chromosomally encoded CcpA. No signal was detected in the control strain WH1124 (∆ccpA), as expected. 44 RESULTS Next, an ackA’::’lacZ fusion was analyzed to determine the optimal time point and glucose concentration for isolating the maximum amount of StrepCcpA complexes. Therefore, the strain WH482 was grown in the presence of BCAAs with glucose concentrations increasing from 0 % to 2 %. The growth curves and the corresponding determined β-galactosidase activities were measured in triplicates and the results are shown in Figure 5.3. -35 -10 ackA-cre1 ackA-cre2 ackA‘::‘lacZ 10,00 10.0 3000 2800 2600 2200 2000 1,00 1.00 OD600 1800 0 % glucose 0.1 % glucose 0.5 % glucose 0,10 0.10 1600 1400 1 % glucose 1200 2 % glucose 1000 800 β-galactosidase activity [MU] 2400 600 400 200 0 0,01 0.01 0 1 2 3 4 5 6 7 8 9 10 11 12 Time [h] Figure 5.3: Growth curves and β-galactosidase activity measurement of WH482 (ackA’::’lacZ) grown with different glucose concentrations The diagram shows a scatter plot (rhombi) of the OD600 values of the cultures and a bar chart of Miller Units against time. OD600 and β-galactosidase activity were determined every hour from cells grown in CSK medium with the following glucose concentrations: 0 % glucose (black), 0.1 % glucose (red), 0.5 % glucose (green), 1 % glucose (yellow) and 2 % glucose (blue). A scheme of the genetic elements of the ackA promoter is shown in the insert. All experiments were carried out in triplicates and the results are given as averages of these three replicates. The β-galactosidase activities increased for all glucose concentrations during the exponential phase. In the stationary phase the β-galactosidase activities decreased to a minimum of 50 MU. The highest β-galactosidase activity of about 1400 MU was measured in the mid exponential growth phase in medium supplemented with 0.5 % glucose. This corresponds to a seven-fold activation compared to the strain grown in medium lacking glucose. Therefore, in this work in vivo crosslinking experiments were performed with cultures grown in CSK and BCAAs with 0.5 % glucose in the mid-exponential growth phase. RESULTS 5.2.2 45 Isolation of StrepCcpA-complexes by SPINE Putative CcpA interaction partners were detected in silver-stained gels after SDS-PAGE. Elution fractions from Strep affinity chromatography of the strains WH1012 (StrepCcpA) and WH1124 (∆ccpA) grown with and without glucose were analyzed. Typical protein patterns are shown in Figure 5.4. WH1012 (StrepCcpA) kDa M + + + - + WH1124 (∆ccpA) - + + + - + glucose - formaldehyde 200 100 70 50 40 30 CcpA-Strep 20 1 2 3 4 5 6 7 8 9 10 Figure 5.4: SDS-PAGE from eluates of SPINE with Strep-tagged CcpA A silver-stained gel with SPINE eluates from the B. subtilis strains WH1012 and WH1124 is shown in this figure. This gel contains a molecular weight standard (M) in lane 1, samples from the StrepCcpA containing strain WH1012 in lanes 2-5, samples from the ∆ccpA mutant WH1124 in lanes 6-9 and purified StrepCcpA in lane 10. The presence or absence of glucose in the cultures is indicated by glucose + or glucose − above the respective lanes. Samples harvested before addition of formaldehyde are labeled with formaldehyde − and samples harvested after formaldehyde treatment with formaldehyde +. As shown in Figure 5.4, several proteins coeluted with StrepCcpA without crosslinking, indicating strong complex formation of these proteins with StrepCcpA. The addition of formaldehyde increased the number of copurified proteins since weak binding of interacting molecules or interactions with a high on-off rate were fixed to each other. Interestingly, the protein patterns, the number and the individual amount of the proteins crosslinked to StrepCcpA were similar in cells grown in the presence or in the absence of glucose. These coeluted proteins after SPINE visible in silver stained SDS-PAGEs were putative complex partners of CcpA and were therefore identified by mass spectrometry as described in chapter 1.3. Furthermore, this experiment shows that the Streptactin matrix does not bind and elute crude lysate proteins which would falsify SPINE with StrepCcpA. 46 RESULTS 5.3 Identification of StrepCcpA interaction partners from SPINE by mass spectrometry The proteins coeluted with StrepCcpA in SPINE (chapter 5.2.2) were identified by mass spectrometry in collaboration with Dr. Elke Hammer and Prof. Dr. Uwe Völker, Ernst-MoritzArndt University of Greifswald. This analysis revealed more than 600 proteins (MS, data not shown). However, formaldehyde primarily targets lysine amino groups and side chains of adenine, guanine and cytosine which are in close vicinity to each other (~ 0.2 nm) (Das et al., 2004). Therefore, it was assumed that several DNA or RNA binding proteins identified by mass spectrometry were crosslinked indirectly by DNA or RNA bridges. In order to discriminate between signals of specifically crosslinked interaction partners of CcpA and coeluted impurities, the SPINE procedure was modified. For this purpose, proteins were labeled in vivo either with 14 N or 15N, as described by Dreisbach et al. (Dreisbach et al., 2008). The basis of this metabolic labeling is the incorporation of different N-isotopes into all amino acids and then into all proteins. Identical but 14 N or 15 N labeled peptides form diffently treated cultures can be discriminated by MS due to their different masses. The ratios between the signal intensities of the 14N or 15N labeled proteins provide the relative abundance of the peptides in the different original cell cultures. Consequently, the ratio of the signal intensity of a crosslinked 14N labeled peptide compared to the non-crosslinked 15N labeled peptide is high when a protein forms a complex with StrepCcpA only after crosslinking. Very stable complexes might result in a 1:1 ratio at high signal intensities. Therefore, in this work two cultures of the strain WH1012 were grown in glucose containing minimal medium with either (14NH4)2SO4 and 14 N BCAAs or (15NH4)2SO4 and 15 labeled medium. In the mid-exponential growth phase only the cells grown in the 14 N BCAAs N medium were treated with formaldehyde before the cells of both cultures were harvested. Prior to cell disruption and StrepCcpA affinitiy chromatography the cells of the crosslinked 14N- and the noncrosslinked 15 N-labeled culture were mixed 1:1. Finally, this eluate was analyzed by mass spectrometry (Figure 5.5). RESULTS 14N 47 medium + Formaldehyde cell harvesting cell disruption + purification 15N medium cell harvesting + mass spectrometry Figure 5.5: Modification of SPINE by 14N or 15N in vivo labeling prior to mass spectrometric analysis Cells of WH1012 were grown to the mid exponential growth phase and then only the 14N labeled culture was treated with formaldehyde. After sedimentation and resuspension in cell disruption buffer the cells of both cultures were mixed 1:1. This mixture was lysed and the StrepCcpA complexes were purified. Finally, the eluate was analyzed by mass spectrometry. The formaldehyde-dependent crosslinking was also performed vice versa with the 15N in vivo labeled cells. This experiment was also performed with formaldehyde treated 14 15 N labeled cells and untreated N labeled cells. A protein identified in MS was only considered to be an interaction partner of CcpA if it was identified in both experiments with at least two different peptides and at least 6 spectra in one MS sample. Furthermore, enrichment by crosslinking should be higher than 1.5 fold by comparing the number of spectral counts in crosslinked samples with that in samples without crosslinking (Appendix Table A1, MS analysis of the samples was performed in collaboration with Dr. Elke Hammer and Prof. Uwe Völker (Ernst-Moritz-Arndt-Universität Greifswald)). Proteins with an enrichment ratio lower than 1.5 were considered to be non-specifically coeluating from the streptactin matrix regardless of their count of identified peptides or recorded spectra. The application of these selection criteria reduced the number of potential interaction partners to 222 proteins (see Appendix Table 1) pointing to a broad interactome of CcpA. A subpopulation of 143 proteins was only detected after crosslinking, whereas 79 proteins were additionally detected in lower abundance in non-crosslinked samples. A selection of 44 identified proteins with known function is listed in Table 5.1. These proteins can be classified roughly into 4 different groups. The first group is obviously functionally related to CcpA because it contains proteins involved in transcription and regulation. The proteins involved in sugar transport, glycolysis and the TCA cycle build the second group. These proteins are either related to coeffectors of CcpA or their expression is regulated by CcpA. Less obvious are interactions with the metabolic enzymes found in the third group or the proteins involved in sporulation, competence and cell division in the fourth group. Among the putative interaction partners in the first group HPr, the RNA polymerase subunits and CodY are of particular interest, because they are involved in the activation of ackA transcription. 48 RESULTS Table 5.1: Overview of CcpA interaction partners identified in mass spectrometry Functional category / Cellular process Identified proteins Transcription RpoA, RpoB, RpoC, GreA, NusA Regulators CodY, CheV, TenA Sugar transport HPr, PtsI Glycolysis FbaA, Eno, PfkA, Pgi, Pyk TCA Mdh, CitB, CitG, CitZ, Icd, SucD Biotin and fatty acid biosynthesis FabD, FabG, FabI Amino acid metabolism GlnA, GltA, GltB, AroF, ArgG Purine and pyrimidine synthesis GuaA, GuaB, PurA, PurB, PurH Sporulation SpoVG, Spo0M Competence SrfAA, SrfAB, SrfAC Cell division FtsZ, FtsH, DivIVA, MinD, GidA 5.4 Interaction partners of StrepCcpA in vivo Some of the putative interaction partners detected by MS actually might form complexes with CcpA since formaldehyde crosslinks molecules in close vicinity. However, the spectral counts of some proteins, like HPr and CodY, were lower than expected (Appendix Table A1). Consequently, in order to examine whether the selection criteria applied to the MS analysis were appropriate the elution fractions from SPINE subjected to MS were also applied to SPINEimmunoblot analyses to identify already established and as well as novel interaction partners of CcpA. 5.4.1 Analysis of the interaction of StrepCcpA with HPr in vivo The role of HPrSer46P as main coeffector for CcpA was intensely studied and is well characterized (Deutscher et al., 1994; Fujita, 2009). Although there is a large body of evidence for complex formation of CcpA with HPrSer46P in vitro (Deutscher et al., 1995; Horstmann et al., 2007; Schumacher et al., 2004; Seidel et al., 2005), the physical interaction between both proteins has not been demonstrated in vivo, yet. HPr fulfilled the criteria applied to the MS analysis and was identified as an interaction partner of CcpA. However, the spectral count of 6 spectra was lower than expected (Appendix Table 1), which is likely a reflection of the small size of the protein (88 amino acids), which yields a few tryptic peptides that are theoretically accessible by MS. Therefore, and in order to test whether the experimental SPINE setup used in this work is RESULTS 49 suitable to detect known interaction partners of CcpA, the presence of the HPr was analyzed. For this purpose, as an additional control approach elution fractions from SPINE applied to MS were also analyzed for HPr by immunoblotting with an anti-HPr antibody (Fig. 5.6). WH1012 (CcpA-Strep) WH1124 (∆ccpA) HPr + - 1 2 + + 3 + - + - - glucose + - + formaldehyde 4 5 6 7 Figure 5.6: In vivo evidence for CcpA-HPr by immunoblotting An immunoblot analysis for HPr in SPINE eluates from the B. subtilis strains WH1012 (StrepCcpA) and WH1124 (∆ccpA) is depicted in this figure. The presence or the absence of glucose in the cultures is indicated above the respective lanes by “glucose +” or “glucose −”. Samples harvested before addition of formaldehyde are labeled with “formaldehyde −” and after formaldehyde treatment with “formaldehyde +”. This blot contained purified HPr as positive control in lane 1, eluates from the ∆ccpA mutant WH124 in lanes 2-3 and samples from the StrepCcpA containing strain WH1012 in lanes 4-7. Analysis of SPINE eluates from cultures with glucose show that HPr was only detected in the presence of StrepCcpA and after formaldehyde crosslinking. Without formaldehyde HPr was not detected. The analogous experiment from cultures without glucose also did not show a HPr signal. This is in good agreement with studies that show that PTS sugars like glucose trigger CCR by CcpA via complex formation with HPrSer46P (Görke & Stülke, 2008). Although HPr was only coeluted in crosslinked SPINE eluates of WH1012 when glucose was available, the influence of the Ser46 phosphorylation status of HPr remained unclear in this experimental approach. In order to address this question, the strain WH1125 was constructed which basically has the same genotype as WH1012, but a substitution of ptsH for the ptsH1 allele which encodes for a HPrSer46Ala mutant. The results from SPINE with the strains WH1012 (StrepCcpA, HPr(WT)), WH1124 (∆ccpA, HPr(WT)) and WH1125 (StrepCcpA, HPrSer46Ala) are shown in Figure 5.7. 50 RESULTS StrepCcpA HPr 1 HPr(WT) 2 ∆ccpA HPrS46A 3 crude lysate HPr(WT) 4 ∆ccpA StrepCcpA HPr(WT) 5 HPrS46A 6 HPr(WT) 7 eluted fractions Figure 5.7: In vivo evidence for CcpA-HPrSer46P interaction by immunoblotting In this figure an immunoblot analysis is shown for HPr in SPINE eluates from the B. subtilis strains WH1012 (StrepCcpA), WH1124 (∆ccpA) and WH1125 (StrepCcpA, HPrSer46Ala). The blot contains crude lysates and crosslinked elution fractions of StrepCcpA-protein complexes of the strains WH1012 (StrepCcpA, HPr (WT)) in lane 2 and 5, WH1125 (StrepCcpA, HPrSer46Ala) in lane 3 and 6 and WH1124 (∆ccpA) in lane 4 and 7. Purified HPr in lane 1 serves as a control. All samples were derived from cultures grown in CSK supplemented with 0.5 % glucose. Figure 5.7 illustrates the expected presence of HPr in all crude lysates before complex purification. In the fractions containing purified StrepCcpA complexes a signal for HPr was only detected in the strain WH1012, carrying the wildtype HPr, but not in the HPrSer46Ala strain WH1125. This result confirmed the important role of residue serine 46 of HPr for the interaction with CcpA. 5.4.2 Analysis of the interaction of StrepCcpA with Crh in vivo Besides HPrSer46P as main coeffector, CrhSer46P also leads to the stimulation of CcpA binding to cre (Galinier et al., 1997). However, like HPr the physical interaction between CcpA and Crh in vivo remained to be elucidated. In order to test, if Crh interacts with CcpA or Crh is able to substitute for the HPrSer46Ala mutant SPINE eluates of WH1012 (StrepCcpA, HPr(WT)) and WH1125 (StrepCcpA, HPrSer46Ala) were investigated for the presence of Crh (Fig. 5.8). RESULTS 51 1 2 3 crude lysate 4 5 flowthrough 6 7 8 9 CrhP eluted fractions Figure 5.8: Analysis of the CcpA-Crh interaction in vivo by immunoblotting In this figure an immunoblot analysis is shown for Crh in SPINE eluates from the B. subtilis strains WH1012 (StrepCcpA), WH1124 (∆ccpA) and WH1125 (StrepCcpA, HPrSer46Ala). The blot contains crude lysates, flowthrough and crosslinked elution fractions of StrepCcpA-protein complexes of the strains WH1124 (∆ccpA) (lanes 1, 4 and 7), WH1012 (StrepCcpA, HPr (WT)) (lanes 2, 5 and 8) and WH1125 (StrepCcpA, HPrSer46Ala) (lanes 3, 6 and 9). Purified Crh in lane 10 served as a control. All samples were derived from cultures grown in CSK supplemented with 0.5 % glucose. Crh was detected in all crude lysates before complex purification and in the flowthrough of all strains. Interestingly, Crh was not detected in the fractions containing purified StrepCcpA complexes of all investigated strains. 5.4.3 Interaction of StrepCcpA with the α subunit of the RNA polymerase (RpoA) in vivo Although most genes and operons are repressed by CcpA, in transcriptomic studies about 50 genes were activated by CcpA (Moreno et al., 2001) Interestingly, CcpA variants with point mutations in the coeffector binding region were only active in CCR of ackA (Diel, 2005; Horstmann et al., 2007; Seidel et al., 2005; Sprehe et al., 2007; Turinsky et al., 2000). In addition to the previous studies, in this work the RNA polymerase subunits α, β and β′ were identified mass spectrometry (chapter 1.3). Based on these data an interaction between CcpA and the RNA polymerase was assumed. In order to verify the results of MS analysis, a SPINE-immunoblot analysis was also performed for the α subunit of RNA polymerase. For this purpose, SPINE eluates of the strains WH1012 (StrepCcpA) and WH1124 (∆ccpA) were analyzed for the presence of RpoA by immunoblotting with a monoclonal anti-RpoA antibody (Fig. 5.9). 52 RESULTS WH1124 (∆ccpA) WH1012 (StrepCcpA) + - - - + + - - 2 3 4 5 + - + 1 eluted fractions crude lysate + glucose + + - + formaldehyde 6 7 8 eluted fractions Figure 5.9: In vivo evidence for CcpA-RpoA interaction by immunoblotting In this figure an immunoblot analysis is shown for RpoA in SPINE eluates from the B. subtilis strains WH1012 (StrepCcpA) and WH1124 (∆ccpA). The blot contains crude lysates and crosslinked elution fractions of StrepCcpA-protein crude lysates (lanes 3) and in the crosslinked elution fractions of StrepCcpA-complexes of the strains WH1124 (∆ccpA) (lanes 1 and 2) and of the strain WH1012 (StrepCcpA) in (lanes 4, and 5 to 8). The presence or absence of glucose in the cultures is indicated by “glucose +” or “glucose −” above the respective lanes. Samples harvested before addition of formaldehyde are labeled with “formaldehyde −” and samples harvested after formaldehyde treatment with “formaldehyde +”. In both strains, WH1012 (StrepCcpA) and WH1124 (∆ccpA), RpoA was detected in the crude lysates before SPINE. After treatment with formaldehyde, RpoA was detected in the SPINE eluates from the StrepCcpA expressing strain cultured in the presence and in the absence of glucose, indicating that the presence of glucose is not a prerequisite for the interaction of CcpA with the α subunit of the RNA polymerase. 5.4.4 Interaction of StrepCcpA with CodY in vivo Interestingly, full transcriptional activation of ackA requires another global regulator CodY (Shivers et al., 2006; Turinsky et al., 1998; Turinsky et al., 2000). CodY binds upstream of CcpA at the ackA promoter and is able to activate ackA transcription alone, similar to CcpA, but cooperative activation by both regulators is much stronger (Shivers et al., 2006). Although, these studies focused on the physiological activation of different mutations either CcpA and the promoter region of ackA and the identification of binding sites of both CcpA and CodY, the evidence for a physical interaction between both regulators remained to be experimentally verified. The complex formation of CcpA and CodY was investigated by SPINE-immunoblot analysis. Because an antibody raised against CodY was not available, CodY was indirectly detected via Flag-tag by construction of a CodY-3 × Flag-tag fusion protein. For this purpose, the integrative plasmid pGP1331 (Stülke, Göttingen) was used, because it allows the fusion of a 3 × Flag-tag to RESULTS 53 the C-terminus of a protein, which is expressed from its natural locus on the chromosome. For this approach, first × 600 bp from the 3′ end of codY were amplified by PCR and cloned into pGP1331, resulting in pWH2371 (Fig. 5.10). Then, WH1012 was transformed with pWH2371 resulting in strain WH1129, which expressed CodY with a C-terminal 3 × Flag-tag from its native promoter. Finally, WH1129 was analyzed for integration of the Flag-tag by sequencing. SpecR Figure 5.10: Plasmid pWH2371 used for construction of a 'codY CodY-3 × Flag-tag fusion protein The plasmid pWH2371 is a vector, which carries sequences coding for BamHI the C-terminal sequence of CodY 3 × Flag-tag with a C-terminal 3 × Flag-tag. This DYKDHDGDYKDHDIDYKDDDDK vector is a derivative of pGP1331, which allows the fusion of a 3 × Flag-tag to the C-terminus of a protein of interest at its natural locus. EcoRI pWH2371 ~6000 kb AmpR rep(pMB1) The complex formation of CcpA and CodY in vivo was investigated by SPINE-immunoblot analysis. For this purpose, cells of the stains WH1124 (∆ccpA), WH1012 (StrepCcpA) and WH1129 (WH1012, CodY-Flag) were cultured with and without 0.5 % glucose and SPINE was performed. The 3 × Flag-tag was detected with a monoclonal anti-Flag antibody (Fig. 5.11). WH1124 (∆ccpA) WH1129 (StrepCcpA, CodY-3 × Flag) WH1012 (StrepCcpA) CL + - + + + - + + + - + + 1 2 3 4 5 6 7 - 8 + glucose formaldehyde 9 Figure 5.11: In vivo evidence forCcpA-CodY interaction by immunoblotting In this figure an immunoblot analysis is shown for CodY-3 × Flag in SPINE eluates from the B. subtilis strains WH1012 (StrepCcpA), WH1124 (∆ccpA) and WH1129 (StrepCcpA, CodY-3 × Flag). The blot contains elution fractions of StrepCcpA of WH1124 (∆ccpA) in lanes 2-3, WH1012 (StrepCcpA) in lanes 4-5, and WH1129 in lanes 6-9. As control crude lysate (CL) of WH1129 in lane 1 was used. The presence or absence of glucose in the cultures is indicated above the figure by “glucose +” or “glucose −”. Samples which were harvested before addition of formaldehyde are labeled with “formaldehyde −” and after formaldehyde treatment with “formaldehyde +”. 54 RESULTS CodY-3 × Flag was present in the crude lysate of WH1129 (StrepCcpA, CodY-3 × Flag) before SPINE, as expected. The Flag-tagged CodY was only detected in the SPINE eluates from formaldehyde treated cultures expressing StrepCcpA and CodY-3 × Flag. A very strong CodY-3 × Flag signal was detected in eluates from cultures grown with glucose. In contrast, cultures without glucose yielded only a faint band for CodY-3 × Flag in the immunoblot. Elution fractions of the control strains WH1124 (∆ccpA) and WH1012 (StrepCcpA, CodY) showed expectedly no signal for the Flag-tag. 5.5 BACTH analysis of direct interactions between CcpA and putative interaction partners In SPINE, the subunits α (RpoA), β (RpoB) and β′ (RpoC) of the RNA polymerase core enzyme were coeluted in a complex with CcpA. However, the SPINE analysis does not contain any information if CcpA interacts with all or only with two or just one of the RNAP subunits because formaldehyde also crosslinks the subunits in the RNA polymerase heterooligomer. Therefore, an alternative screen was performed to analyze binary protein interactions with CcpA. For this purpose, a bacterial two-hybrid assay (BACTH) in E. coli (Karimova et al., 1998) was performed to analyze the binary interactions of the RNA polymerase subunits with CcpA in vivo and to specify which RNA polymerase component interacts with CcpA. The BACTH assay is based on reconstitution of adenylate cyclase activity when the T18 and T25 domains of Bordetella pertussis Cya are connected via interactions between proteins fused to them (chapter 4.3.6.1 and 4.3.6.2). Moreover, several further proteins, which were identified in StrepCcpA complexes (Table 5.1), were also analyzed for the existance of interactions with CcpA. 5.5.1 Interaction analysis of CcpA with RNA polymerase subunits α, β and β′′ For the interaction analysis between CcpA and the RNA polymerase in this approach both Cya domains, T18 and T25, were separately fused to full-length copies of CcpA and the target proteins RpoA, RpoB and RpoC, respectively. In order to increase the chance of proper binding of T18 to T25 in a protein complex, the number of possible orientations of T18 and T25 is increased by fusing each domain either to the N-terminus or the C-terminus of each interaction partner. Then every possible combination of an N- or C-terminal T18 fusion protein with an N- or C-terminal T25 fusion protein was analyzed for restored Cya activity. Fusions of the GCN4 domain of the leucine zipper to each Cya domain served as positive control. Since none of the combinations of unfused Cya domains with any of the analyzed proteins fused to the complementary Cya domain RESULTS 55 resulted in Cya activity, it was concluded that the assay only detects highly specific interactions. Pairs of T18- and T25-protein fusions were coexpressed in the indicator strain BTH101 (∆cya), and screened for possible interactions by a qualitative plate assay for β-galactosidase activity. The T25-zip T25 RpoC-T25 T25-RpoC RpoB-T25 T25-RpoB RpoA-T25 T25-RpoA CcpA-T25 T25-CcpA results of the BACTH assay are depicted in Figure 5.12. CcpA-T18 T18-CcpA RpoA-T18 T18-RpoA RpoB-T18 T18-RpoB RpoC-T18 T18-RpoC T18 T18C-zip Figure 5.12: BACTH analysis of the direct interactions between CcpA and the RNA polymerase subunits α (RpoA), β (RpoB) and β′ (RpoC) The figure shows a BACTH assay of E. coli BTH101 strains expressing different combinations of N- or Cterminal fusions of the T18 or the T25 domains of the B. pertussis adenylate cyclase with the interactants CcpA, RpoA, RpoB and RpoC. Each protein was fused to either domain of Cya. Fusions to T25 are listed above and T18 fusions are listed on the left side in the figure. N-terminal fusions to the T18 Cya domain are indicated as “proteinX-T18” and C-terminal fusions “T18-proteinX” and an equally denomination for fusion to the T25 Cya domain. T18 and T25 indicate the combination of the unfused Cya domains and are the negative control. T18C-zip and T25-zip indicate the fusions of Cya domains with the leucine zipper serving as a positive control. Blue-colored colonies indicate interaction of the proteins fused to the adenylate cyclase domains. Self-pairing of CcpA or the α subunit of the RNA polymerase, respectively, resulted in strong signals confirming dimerization of both proteins but not for the self pairing of RpoB and RpoC. The combination of CcpA and the α subunit of the RNA polymerase also showed detectable Cya activity and thus complex formation. The absence of enzymatic activity in BACTH analyses of Cya-CcpA fusions with different combinations of the Cya fusions to the β (RpoB) or the β′ subunit (RpoC) did not restore Cya activity and, consequently, did not show a direct interaction of CcpA with RpoB or RpoC. 56 5.5.2 RESULTS Interaction analysis of CcpA with mutants of the α subunit of RNA polymerase The α subunit of the RNA polymerase of B. subtilis is a 314 amino acids protein, containing an Nterminal subdomain (αNTD) (amino acids 1-231) and a C-terminal domain (αCTD) (amino acids 245-314) which are separated by a 13 aa linker (232-244) (Fig. 5.13). α NTD 1 – 231 αNTD NTD 1 – 231 αCTD linker CTD 232 – 244 245 – 314 linker 232 – 244 linker CTD 232 – 244 245 – 314 Figure 5.13: RpoA subdomains used in this work The entire α subunit of the RNA polymerase contains the N-terminal domain (aa 1 – 231), the linker (aa 232 – 244) and the C-terminal domain (aa 245 – 314). Below the two deletion mutants used in this approach are illustrated. The αNTD lacks the C-terminal domain. In contrast in the αCTD the N-terminal domain is deleted. In order to discriminate whether the N- or the C-terminal domain of RpoA is interacting with CcpA, the αNTD and the αCTD were either fused to the N- or the C-terminal Cya domain and combined with the complementary CcpA Cya fusions. The results of the BACTH assay are depicted in Fig. 5.14A. Interestingly, pairing of CcpA with disrupted α subunit fusions showed different signals. CcpA pairing with fusions of the αNTD resulted in significant signals. In contrast, the combination of CcpA with the αCTD did not restore Cya activity. The self-pairing of the αNTD or of the αCTD revealed detectable signals. The pairing of the GCN4 domains of the leucine zipper as a positive control in BACTH showed a strong self-interaction, as anticipated. Unfused Cya domains showed no activity in combination with any of the analyzed proteins (Fig. 5.14A). . T25-zip T25 αCTD-T25 T25-αNTD T25-αNTD T25-αCTD RpoA-T25 RpoA-T25 αNTD-T25 T25-RpoA T25-RpoA A CcpA-T25 57 T25-CcpA RESULTS CcpA-T18 T18-CcpA RpoA-T18 T18-RpoA αNTD-T18 T18-αNTD αCTD-T18 T18-αCTD T18 T18C-zip αCTD-T25 T25 T25-zip 4.7* n.a. T18-CcpA 120.9‡ 94.3* 40.7* 67.8* 57.0* 55.4* 13.5* 3.6* 4.0* n.a. αNTD-T25 4.5* CcpA-T25 CcpA-T18 90.4# 104.0# 12.1* 38.4* 37.2* 77.0* 7.2* T25-CcpA T25-αCTD B RpoA-T18 7.2* 8.8* 53.7* 52.7* 66.4* 110.4# 20.1* 6.9* 4.7* n.a. T18-RpoA 5.0* 5.4* 52.7* 39.8# 42.4* 78.7* 4.5* 93.3* 4.0* n.a. αNTD-T18 24.4 14.8* 83.2‡ 58.0* 64.7* 48.5* 9.9* 5.0* 3.7* n.a. T18-αNTD 3.3* 22.7* 50.9* 52.9* 59.2* 34.6* 19.2* 6.5* 2.7* n.a. αCTD-T18 2.6* 2.7* 103.4‡ 1.9* 2.4* 2.5* n.a. T18-αCTD 2.1* 1.8* 3.4* 37.3* 49.1* 2.6* 2.7* 73.7# 3.0* n.a. T18 2.5* 2.4* 2.4* 2.5* 6.7* 3.1* 2.9* 2.6* 3.4* n.a. T18C-zip n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. n.a. 100.0# 35.2# 11.5* 36.8# Figure 5.14: BACTH analysis of the direct interaction of CcpA and RpoA and the different domains of the α subunit of RNA polymerase The figure shows a BACTH assay of E. coli BTH101 strains expressing different combinations of N- or Cterminal fusions of the T18 or the T25 domains of the B. pertussis adenylate cyclase with the interactants CcpA, RpoA and the N- and the C-terminal domain of RpoA (indicated as αNTD and αCTD). T18 and T25 indicate the combination of the unfused Cya domains and are the negative control. The combination of T18C-zip and T25-zip served as a positive control (A) Blue-colored colonies indicate interaction of the proteins fused to the adenylate cyclase domains. (B) Quantitative β-galactosidase activities of the corresponding strains. Bold numbers depict β-galactosidase activities ≥ 50 % of the positive control. All experiments were carried out in triplicates and the results are given as averages of these three replicates.Standard deviations based on T18-zip and T25-zip self interaction on 100 %: *: ≤ 5 %, #: ≤ 10 %, ‡ : ≤ 20 %; n.a.: not analyzed. 58 RESULTS The efficiency of the complementation between the hybrid proteins of all transformants was quantified by determining the β-galactosidase activities, which are correlated with the cellular cAMP level (Karimova et al., 1998). The transformants that coexpressed fusion proteins of CcpA and full-length RpoA or CcpA and αNTD produced β-galactosidase activities between 5 % and 77 % of the positive control. Combinations of the unfused Cya domains with any of the analyzed proteins showed β-galactosidase activities < 7 %. In conclusion the quantitative β-galactosidase activities correspond to the qualitative plate assay and verfied the interaction between CcpA and the α subunit of the RNA polymerase (Fig. 5.14B). 5.5.3 Interaction analysis of CcpA with CodY by BACTH As the analysis of SPINE eluates by MS and immunoblotting identified CodY in CcpAStrep complexes, the direct interaction of both regulators CcpA and CodY investigated by BACTH. For this purpose, analogous to the experiments of CcpA and the RpoA, CodY was fused to the N- and C-terminus of each Cya domain, respectively. All possible combinations of N- and C-terminal fusion proteins of CcpA and CodY were analyzed for restored Cya activity. The results of the CcpA-T18 T18-CcpA T18-CodY CodY-T18 T18 T18-zip T25-zip T25 T25-CodY CodY-T25 T25-CcpA CcpA-T25 BACTH assay are depicted in Figure 5.15. Figure 5.15: BACTH analysis of the direct interaction of CcpA and CodY The figure shows a BACTH assay of E. coli BTH101 strains expressing different combinations of N- or C-terminal fusions of the T18 or the T25 domains with the interactants CcpA and CodY. T18 and T25 are the negative control and the combination of T18C-zip and T25-zip served as a positive control. Blue-colored colonies indicate interaction of the proteins fused to the adenylate cyclase domains. Besides the leucine-zipper self-pairing, only the combinations for self-pairing of CcpA and CodY restored Cya activity in the BACTH assay. The combination of CcpA and CodY did not show detectable adenlyate cyclase activities. Interestingly, the strain BTH101 (∆cya) was not able to grow after cotransformation of T18-CodY and CodY-T25, a combination for CodY self-pairing. Unfused Cya domains showed as expected no Cya activity in combination with CcpA or CodY. RESULTS 5.5.4 59 Interaction analysis of CodY with α subunit of RNA polymerase by BACTH CodY, represses transcription of genes but can also activates some genes (Molle et al., 2003; Sonenshein, 2007). As described before (chapter introduction and results) the full transcriptional activation of ackA (Shivers et al., 2006), requires CodY. Thus, a direct interaction of CodY with the α subunit of the RNA polymerase seemed possible. Therefore, this putative direct interaction CodY-T18 T18-CodY RpoA-T18 T18-RpoA T18 T18C-zip T25-zip T25 RpoA-T25 T25-RpoA T25-CodY CodY-T25 of CodY and RpoA was investigated by BACTH (Fig. 5.16). Figure 5.16: BACTH analysis of the direct interaction of CodY and RpoA The figure shows a BACTH assay of E. coli BTH101 strains expressing different combinations of N- or C-terminal fusions of the T18 or the T25 domains with the interactants CodY and RpoA. T18 and T25 are the negative control and the combination of T18C-zip and T25-zip served as a positive control. Blue-colored colonies indicate interaction of the proteins fused to the adenylate cyclase domains. In the BACTH analysis only the self-pairing of CodY, RpoA and the leucine zipper showed Cya activity. The combinations of CodY and RpoA were not able to restore Cya activity. CodY or RpoA showed no activity in combinations with unfused Cya domains, as expected. 5.5.5 Interaction analysis of CcpA with tricarboxylic acid (TCA) cycle enzymes In B. subtilis, the activities of the TCA cycle enzymes major citrate synthase (CitZ), aconitase (CitB) and isocitrate dehydrogenase (Icd) are reduced when the cells were grown in the presence of glucose and glutamate (Blencke et al., 2003; Hanson & Cox, 1967; Jourlin-Castelli et al., 2000; Kim et al., 2002; Sonenshein, 2007). CcpA is involved in glucose-dependent repression of almost all TCA cycle genes (Tobisch et al., 1999a). While CcpA represses transcription of citZ directly, citB expression is obviously released from repression in a ∆ccpA mutant by indirect effects (Blencke et al., 2003; Kim et al., 2002). Recently, interactions among TCA enzymes were detected which suggest a TCA cycle metabolon (Meyer et al., 2011). Interestingly, in SPINE eluates of CcpAStrep several TCA cylce enzymes were identified as abundant proteins. These proteins were CitB (Aconitase), CitG (Fumarat hydratase), CitZ (major citrate synthase) Icd (Isocitrate dehydrogenase) and Mdh (Malate dehydrogenase). Therefore, CcpA and CitB, CitG, CitZ, Icd and Mdh were combined in BACTH analyses (Fig. 5.17). CitG-T25 T25-CitG CitZ-T25 T25-CitZ T25-Icd Mdh-T25 T25-Mdh T25 T25-zip T25-CitB Icd-T25 T25 CitB-T25 T25-CcpA CcpA-T25 A T25-CcpA RESULTS CcpA-T25 60 CcpA-T18 T18-CcpA CitB-T18 T18-CitB CitG-T18 T18-CitG CitZ-T18 T18-CitZ T18 B T25-zip T18-zip CcpA-T18 T18-CcpA Icd-T18 T18-Icd Mdh-T18 T18-Mdh T18 T18-zip Figure 5.17: BACTH analysis of the direct interactions between CcpA and and the TCA enzymes CitB, CitG, CitZ, Icd and Mdh The figure shows BACTH analyses of E. coli BTH101 strains expressing different combinations of N- or C-terminal fusions of the T18 or the T25 domains with the interactants CcpA, CitB, CitG and CitZ (A) and CcpA, Icd and Mdh (B). Blue-colored colonies indicate interaction of the proteins fused to the adenylate cyclase domains. RESULTS 61 The BACTH assays show that all combinations for self-pairing of CcpA and CitZ, respectively, resulted in strong signals confirming multimerization of these proteins (Fig. 5.17A). The Cya acitiviy for self-pairing of CitB, CitG, Icd and Mdh was detectable only in some combinations (Fig. 5.17A and 5.17B). Several combinations of CcpA with CitG, CitZ, Icd and Mdh showed detectable Cya activities and therefore complex formation (Fig. 5.18A and 5.18B). Combinations of CcpA with CitB showed no Cya activity and suggest that there is no direct interaction between these proteins (Fig. 5.17B). In conclusion, qualitative plate assays revealed positive interactions between CcpA and CitG, CitZ, Icd and Mdh, but not between CcpA and CitB by BACTH. 5.6 Characterization of the complex formation of CcpA, CodY and the α subunit of the RNA polymerase by in vitro measurements The motivation for the projects described in the following chapters was to validate and characterize interactions which are involved in complex formation of CcpA, CodY and the α subunit of the RNA polymerase by suitable in vitro measurements with purified proteins. The data revealed from these analyses in combination with the results obtained from SPINE and BACTH was used to explain the interactions of CcpA which are required for transcriptional activation. 5.6.1 Construction of overexpression vectors for purification of the α subunit of the RNA polymerase and CodY The α subunit of the RNA polymerase of B. subtilis is a protein which contains 314 amino acids and which is subdivided into the the N-terminal domain (αNTD) which contains the amino acids 1 – 231 and the C-terminal domain (αCTD) which contains the amino acids 245 – 314. Both domains are connected by a linker with a length of 14 amino acids (232 – 245) (Fig. 5.18). 62 RESULTS αNTD MIEIEKPKIE TVEISDDAKF GKFVVEPLER GYGTTLGNSL RRILLSSLPG 50 αNTD AAVTSIQIDG VLHEFSTIEG VVEDVTTIIL HIKKLALKIY SDEEKTLEID 100 αNTD VQGEGTVTAA DITHDSDVEI LNPDLHIATL GENASFRVRL TAQRGRGYTP 150 αNTD ADANKRDDQP IGVIPIDSIY TPVSRVSYQV ENTRVGQVAN YDKLTLDVWT αNTD 200 linker DGSTGPKEAI ALGSKILTEH LNIFVGLTDE AQHAEIMVEK EEDQKEKVLE 250 αCTD MTIEELDLSV RSYNCLKRAG INTVQELANK TEEDMMKVRN LGRKSLEEVK 300 αCTD AKLEELGLGL RKDD 314 Figure 5.18: Protein sequence of RpoA of B. subtilis The figure shows the protein sequence of the α subunit of the RNA polymerase of B. subtilis, which contains 314 amino acids. This protein is subdivided into the the N-terminal domain (αNTD) which contains the amino acids 1 – 231 (dark grey box) and the C-terminal domain (αCTD) which contains the amino acids 245 – 314 (light grey box). Both domains are connected by a linker with a length of 14 amino acids (232 – 245) (black line). For interaction analyses His-tagged CcpA, RpoA, αNTD, αCTD and CodY from B. subtilis should be overexpressed and purified. For this purpose, the promoterless rpoA and codY genes were amplified from chromosomal DNA from B. subtilis 168. The overexpression of αNTD was generated by amplification of a DNA fragment encoding for the αNTD (amino acids 1 – 244) of rpoA by PCR. All PCR products were digested with XhoI and NheI and XhoI and NdeI, respectively, and cloned into the overexpression vector pET28b, linearized with the same enzymes. The resulting plasmids pWH2175, pWH2176 and pWH2177, allow IPTG induced overexpression of N-terminally His-tagged RpoA, αNTD and CodY, respectively, from B. subtilis in E. coli BL21(DE3), which expresses T7 polymerase. For overexpression of CcpA from B. subtilis, the strain FT1 / pWH653 was used which expresses an IPTG inducible C-terminally His-tagged CcpA protein (Seidel, 2005). N-terminally His6–tagged αCTD, which expresses the C-terminal domain of the RNA polymerase (245 – 314) was purified from the strain Rosetta 2 / pET28a-αCTD (Nakano et al., 2010). The overexpression of either protein is described in the Chapters 4.3.4.5 to 4.3.4.10. RESULTS 5.6.2 63 Purification of CcpA, RpoA, αNTD, αCTD, HPrSer46P and CodY N-terminally His-tagged RpoA, αNTD, αCTD and CodY, were purified by Ni2+-affinity chromatography and the pure protein fractions were then subsequently applied to a size exclusion chromatography to remove the retaining imidazole and to equilibrate the protein in HBSE buffer as described in the chapters 4.3.4.6 to 4.3.4.11. His-tagged CcpA was purified as described in (Seidel, 2005). Figure 5.19A and B show representative Coomassie-stained 12.5 % SDS-PAGEs with elution fractions of His-tagged αNTD after Ni2+-affinity chromatography (Fig. 5.19A) and elution fractions after size exclusion chromatography (Fig. 5.19B). Figure 5.19C shows Coomassie stained SDS-PAGEs with the purified proteins RpoA, CcpA, CodY, αNTD, αCTD and HPrSer46P used in the following chapters. A M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 B M 15 16 17 18 19 20 21 22 23 24 25 26 27 28 αNTD C 1 2 3 M 4 M 5 6 200 200 120 70 85 70 50 40 50 RpoA CcpA 30 25 40 30 αNTD CodY 25 HPrSer46P 15 10 αCTD Figure 5.19: Protein purification of αNTD-his6 from B. subtilis from E. coli BL21(DE3) by affinity purification and size exclusion chromatography (A) Analytical gel electrophoresis (SDS-PAGE, 12.5 %) of samples of His6-tagged αNTD after Ni-affinity chromatography. 10 µl of each fraction was analyzed. The soluble fractions of the pre-induction sample (lanes 1), the sample before purification (lanes 2) and washing (lanes 3 – 4) and elution fractions (lanes 5 – 14) were analyzed. M: molecular weight standard. Fractions 6 – 14 were unified and the imidazole was removed by size exclusion chromatography (B) with superdex G75. 10 µl of each elution fractions were tested (lanes 15 – 28). M: molecular weight standard. (C) These gels illustrate the purity of the protein preparations used for in vitro interaction analyses. The figure shows coomassie stained 12.5 % and 15 % SDS PAA gels, respectively, loaded with 5 µg of RpoA (lane 1), 10 µg of CcpA (lane 2), 8 µg of CodY (lane 3), 8 µg of αNTD (lane 4) and 2 µg of αCTD (lane 5) and 7 µg HPrSer46P (lane 6), respectively. M: molecular weight standard. Only the pure protein species were detectable in each lane. 64 RESULTS 5.7 SPR analyses of interactions of CcpA, RpoA and CodY Complex formation of CcpA with RpoA and CodYwere analyzed by surface plasmon resonance (SPR) analyses. SPR is a sensitive method to observe biomolecular interactions in vitro. This surface analysis method is based on the detection of changes in the refractive index of the adjacent medium next to a metal such as silver and gold (Liedberg et al., 1995). A slight change at the interface leads to a change in the SPR signal and allows precise measurements of surface molecular interactions in real-time. SPR was demonstrated to be suitable for analyses of B. subtilis CcpA-HPrSer46P complex formation and for studies of the effect of the low molecular weight effectors FBP and Glc-6-P on these interactions and binding to cre-sequences (Horstmann et al., 2007; Seidel et al., 2005). Therefore, this sensitive method seemed to be suitable for interaction analyses of CcpA, RpoA and CodY and is described in the following sections. 5.7.1 SPR analyses of interactions between CcpA and RpoA The interaction between CcpA and αNTD from B. subtilis was analyzed by SPR measurements to validate and quantify the interaction of CcpA with RpoA in vitro. First, the binding of CcpA to αNTD was investigated. Therefore, about 4500 RU αNTD was covalently coupled to a CM5 chip and titrated with CcpA concentrations increasing from 0.5 µM to 30 µM. The shape and the increase in signal height of the sensorgrams shown in Fig. 5.20A indicate highly specific binding of CcpA to the immobilized αNTD of RpoA. The SPR analysis of CcpA and the αCTD of RpoA was carried out analogously and showed similar sensorgrams (Fig. 5.20B). The titration could not be performed with higher concentrations than 30 µM due to insufficient solubility of CcpA at concentrations above 40 µM. The kinetic constants of complex association and dissociation and the equilibrium constants were determined for both interactions: ka = 9.4 ± 5.6 × 102 Ms-1, kd = 2.8 ± 0.8 × 10-3 s-1 and KD = 5.0 ± 3.5 × 10-6 M for the binding of CcpA to the αNTD and ka = 2.2 ± 0.8 × 102 Ms-1, kd = 1.5 ± 0.2 × 10-3 s-1 and KD = 7.9 ± 3.6 × 10-6 M for the binding of CcpA to the αCTD. The fits correspond to a Langmuir model for a 1:1 interaction (Fig. 5.20A and B). RESULTS 65 A 350 30 µM CcpA 20 µM CcpA 15 µM CcpA 10 µM CcpA 5 µM CcpA 2 µM CcpA 1 µM CcpA 0.5 µM CcpA Resp. Diff. [RU] 300 250 200 150 100 50 0 0 50 100 Time [s] 150 200 250 B 120 Resp. Diff. [RU] 100 30 µM CcpA 20 µM CcpA 10 µM CcpA 5 µM CcpA 2 µM CcpA 1 µM CcpA 80 60 40 20 0 0 50 100 150 200 Time [s] 250 300 350 400 Figure 5.20: Quantitative analyses of CcpA and RpoA interactions by SPR The sensorgrams show titrations of (A) immobilized αNTD with CcpA, (B) immobilized αCTD with CcpA. (C) immobilized CodY with CcpA, (D) immobilized αNTD with CodY and (E) immobilized αCTD with CcpA. Concentrations of the analyte are depicted on the right side next to each sensorgram. 5.7.2 SPR analyses of interactions between CcpA and CodY CodY was detected as an interaction partner of CcpA in SPINE-MS and it is required together with CcpA for full activation of ackA (Shivers et al., 2006). For this purpose, CodY was purified to homogeneity (Fig. 5.19C) and used in SPR analyses to study the interaction of CcpA with CodY. CcpA binding to CodY was studied by titration of CodY immobilized on a CM5 chip with CcpA concentrations increasing from 1 µM to 30 µM. The titration showed specific binding with rapid association and dissociation phases and increasing signal intensity. An equilibrium analysis for a 1:1 Langmuir model yielded a KD of 5.9 ± 0.1 × 10-5 M (Fig. 5.21A). 66 RESULTS A 120 Resp. Diff. [RU] 100 30 µM CcpA 20 µM CcpA 10 µM CcpA 5 µM CcpA 2 µM CcpA 1 µM CcpA 80 60 40 20 0 0 150 200 Time [s] 250 300 350 30 µM αCTD 20 µM αCTD 10 µM αCTD 5 µM αCTD 2 µM αCTD 1 µM αCTD 0.5 µM αCTD 0 µM αCTD 0 µM CcpA C 60 100 20 µM αNTD 10 µM αNTD 5 µM αNTD 2 µM αNTD 1 µM αNTD 0.5 µM αNTD 0 µM αNTD 0 µM CcpA 50 Resp. Diff. [RU] 100 40 30 20 10 0 80 Resp. Diff. [RU] B 50 60 40 20 0 -20 -10 -40 -20 -60 0 50 100 150 200 Time [s] 250 300 350 0 50 100 150 200 Time [s] 250 300 350 Figure 5.21: Analyses of CcpA and CodY interactions by SPR The sensorgrams show titrations of immobilized immobilized CodY with CcpA (A) and titrations of immobilized CodY with 10 µM CcpA with increasing concentrations of either αNTD (B) or αCTD (C). Concentrations of each analyte are depicted on the right side next to the corresponding sensorgram. Furthermore, the influence of RpoA for the interaction between CcpA and CodY was investigated by cotitrations of immobilized CodY with CcpA and αNTD and CcpA and αCTD, respectively. The binding CcpA to immobilized CodY was hardly altered by addition increasing concentrations of αNTD as well as αCTD (Fig. 5.21B and C). RESULTS 5.7.3 67 SPR analyses of interactions between CodY and RpoA CodY was detected as an interaction partner of CcpA in SPINE-MS and it is required together with CcpA for full activation of ackA (Shivers et al., 2006). For this purpose, CodY was used in SPR analysis to test whether CodY may form complexes with RpoA. Then, either αCTD or αNTD of RpoA were coupled to a CM5 chip and 1 µM to 40 µM solutions of CodY were injected. The sensorgrams in Fig. 5.22D and 5.22E show specific binding of CodY to both, αCTD and αNTD as well. Both interactions were quantified by a 1:1 Langmuir analysis of association and dissociation kinetics and revealed the following rate and equilibrium constants: ka = 5.2 ± 0.4 × 102 Ms-1, kd = 1.7 ± 0.1 × 10-3 s-1 and KD = 5.9 ± 4.5 × 10-6 M for the CodY-αCTD complex and of ka = 1.1 ± 0.8 × 103 Ms-1, kd = 3.9 ± 0.8 × 10-3 s-1 and KD = 8.1 ± 7.5 × 10-6 M for the CodY-αNTD complex (Fig. 5.22D and E). A 70 Resp. Diff. [RU] 60 50 20 µM CodY 15 µM CodY 5 µM CodY 3 µM CodY 1 µM CodY 0.5 µM CodY 40 30 20 10 0 0 50 100 150 200 Time [s] 250 300 350 400 B 120 Resp. Diff. [RU] 100 40 µM CodY 20 µM CodY 15 µM CodY 10 µM CodY 5 µM CodY 2 µM CodY 1 µM CodY 80 60 40 20 0 0 50 100 150 200 250 300 350 400 Time [s] Figure 5.22: Quantitative analysis of CodY and RNAP interactions by SPR The sensorgrams show titrations of (A) immobilized αNTD with CodY and (B) immobilized αCTD with CcpA. Concentrations of the analyte are depicted on the right side next to each sensorgram. 68 RESULTS 5.8 SPR analyses of immobilized CcpA with HPrSer46P and αNTD The interactions of CcpA with αNTD, αCTD and CodY, respectively, were observed in SPR measurements only when CcpA was added with increasing concentrations. When CcpA was coupled to the chip via amine coupling no response was obtained upon addition of αNTD, αCTD and CodY suggesting that CcpA the respective interaction surface of CcpA was not accessible. However, the titrations described in chapter 5.7 were not performed with higher concentrations of CcpA due to insufficient solubility of CcpA at concentrations above 40 µM. Therefore, immobilization of CcpA via tag on an SPR chip could be an alternative strategy. 5.8.1 SPR analysis of Strep-tagged CcpA In a first approach Strep-tagged CcpA was coupled on a StrepMAB-Immo antibody coated CM5 chip according to the method described by Schmidt et al. (Schmidt & Skerra, 2007) (Fig. 5.23A). First, the ccpA gene was cloned into the pASK-IBA vector, which expresses CcpA with an Nterminal Strep-tag and was named pWH2375. Then, StrepCcpA was purified from E. coli BL21(DE3) / pWH2375 to homogeneity. After coating of a CM5 chip with a StrepMAB-Immo antibody (Fig. 5.23B) purified StrepCcpA was captured. However, StrepCcpA dissociated rapidly from the surface (Fig. 5.23C) and, therefore, this method was not suitable for analysis of interactions between CcpA and interaction partners. RESULTS 69 B 30000 A CM5 chip Coupling of StrepMAB-Immo Ab Y Y Y Y Resp. Diff. [RU] 25000 Y Y Saturation with ethanolamine Injection of StrepMABImmo Ab 5000 Time [s] 4000 3500 Addition of analyte (interaction partner) 3000 Resp. Diff. [RU] Y Y Activation with NHS + EDC 10000 0 200 400 600 800 100012001400 1600 1800 2000 C Y 15000 0 Immobilization of ligand (Streptagged protein) Y 20000 500 nM StrepCcpA 2500 2000 1500 1000 500 0nM StrepCcpA 0 0 100 200 300 400 500 600 700 800 900 1000 Time [s] Figure 5.23: Strategy for immobilization of Strep-tagged CcpA on an SPR chip and coupling of StrepCcpA on an StrepMAB-Immo coated SPR chip This figures shows the strategy for immobilization of a Strep-tagged protein on an SPR chip (A). A CM5 chip is coated with a StrepMAB-Immo antibody via amine coupling, before the Strep-tagged protein (ligand) is immobilized on the chip. Then binding of the analyte to the ligand is analyzed. (B) The sensorgram shows the sensorgram of the amide coupled StrepMAB-Immo Ab in FC2 of a CM5 chip. (C) This sensorgram shows the immobilization of 500 nM StrepCcpA on the StrepMAB-Immo coated CM5 chip. 70 5.8.2 RESULTS Immobilization of CcpA via Avi-tag on an SPR chip 5.8.2.1 Enzymatic biotinylation of proteins in vivo based on BirA Biotin is able to bind with a high affinity and specificity to avidin or streptavidin (KD = 10-15 M), which is the strongest non-covalent binding known (Green, 1990). Due to this high affinity and specificity of the biotin-avidin interaction, biotinylation of biomolecules has been exploited for a large number of biotechnological applications, like immobilization, purification and detection of proteins (Cognet et al., 2005; Parrott & Barry, 2000). Chemical biotinylation of proteins is not site specific and might lead to inactivation of some biological molecules (Bayer & Wilchek, 1990; Jokiranta & Meri, 1993). In contrast, enzymatic biotinylation of the Avi-tag mimics the physiological biotinylation of proteins using a biotin accepting peptide (Cull & Schatz, 2000). The Avi-tag is a 15 amino acid biotin accepting peptide (Schatz, 1993), which contains an artificial biotinylation site for the biotin protein ligase BirA of E. coli (Beckett et al., 1999) (Fig. 5.24A). BirA catalyzes the covalent attachment of biotin to the ε amino group of the lysine residue (Eisenberg et al., 1982) within the Avi-tag (Schatz, 1993) in an ATP-dependent reaction (Barker & Campbell, 1981; Chapman-Smith & Cronan, 1999a; Chapman-Smith & Cronan, 1999b) (Fig. 5.24B). When the Avi-tag is fused to a protein, it is possible to biotinylate the fusion protein in vivo (Cronan, 1990; Cronan & Reed, 2000). A B Avitag Sequence: GLNDIFEAQKIEWHE Biotin + ATP biotinyl-5′-AMP + apo-protein biotinyl-5′-AMP + PPi (1) biotinylated holo-protein + AMP (2) Figure 5.24: Avi-tag sequence and the BirA-dependent biotinylation reaction This figure shows the Avi-tag sequence which can be site specifically biotinylated at the lysine residue (highlighted in red) (A) and the BirA-dependent covalent attachment of the biotin prosthetic group to a specific lysine of the biotin carboxyl carrier domain of biotin-dependent carboxylases in a two-step reaction (B). RESULTS 71 5.8.2.2 Construction and purification of in vivo biotinylated Avi-tagged CcpA For expression of Avi-tagged CcpA, the ccpA gene was cloned into pAC4 and E. coli AVB101 was transformed with the resulting plasmid pWH2370. The protein expression E. coli strain AVB101 simultaneously expresses the Avi-tagged fusion protein and BirA (Fig. 5.25). BirA recognizes the Avi-tag sequence and monobiotinylates specifically the central lysine of the Avitag in vivo in the presence of biotin (Beckett et al., 1999; Schatz, 1993). Ptrc CcpA lacIQ Ptac BirA Avitag pBirAcm pWH2370 ~ 7.9kb 5.2kb pMB1 CmR AmpR p15A Figure 5.25: Scheme of the in vivo biotinylation strain AVB101 The E. coli overexpression strain AVB101 is shown schematically, which expresses the IPTG inducible plasmids pWH2370, which expresses C-terminally Avi-tagged (blue arrow) CcpA (red box) and pBirAcm encoding the biotin protein ligase BirA (green arrow). Expression of BirA and Avi-tagged CcpA was simultaneuously induced by addition of IPTG and D-biotin was added as a substrate for BirA at the same time. Biotinylated Avi-tagged CcpA was then purified by affinity chromatography using a monomeric avidin-matrix which allows the elution of biotinylated molecules by competitive elution with free biotin. The pure protein fractions were then subsequently applied to a size exclusion chromatography to remove the retaining biotin and to equilibrate the protein in HBSE buffer as described in chapter 4.3.4.13. 5.8.2.3 SPR measurements of Avi-tagged CcpA with HPrSer46P and αNTD For qualitative SPR analysis, about 3,000 RU neutravidine were bound to a CM5 chip via amine coupling. Neutravidine is a streptavidin analog, which avoids non-specific accumulated of charged proteins like HPrSer46P in the chip matrix. After that, about 1,000 RU biotinylated C-terminally Avi-tagged CcpA was captured stepwise (Fig. 5.26A). Injections with increasing concentrations (from 1 to 50 µM) of HPrSer46P led to increasing responses (Fig. 5.26B) and confirmed the results of previous analyses using amide coupling (Horstmann et al., 2007; Seidel et al., 2005). Furthermore, the shape and the increase in signal height of the sensorgrams of injections with increasing concentrations of αNTD (from 1 µM to 20 µM) indicate highly specific binding of αNTD to immobilized CcpA (Fig. 5.26C). These titrations confirmed the results obtained by titrations of amine coupled αNTD with CcpA (chapter 5.7.1). 72 RESULTS A B 1200 120 Resp. Diff. [RU] Resp. Diff. [RU] 1000 800 600 400 200 100 200 300 400 Time [s] Titration of immobilized 100 biotinylated C-terminally Avi-tagged CcpA 500 600 80 60 40 20 0 700 50 µM αNTD 20 µM αNTD 10 µM αNTD 5 µM αNTD 1 µM αNTD 0 µM αNTD 50 0 D Resp. Diff. [RU] 0 Resp. Diff. [RU] 100 0 0 C 50 µM HPrS46P 20 µM HPrS46P 10 µM HPrS46P 5 µM HPrS46P 1 µM HPrS46P 0 µM HPrS46P 140 50 100 Time [s] Titration of immobilized 150 biotinylated N-terminally Avi-tagged CcpA 100 150 200 100 µM αNTD 10 µM αNTD 0 µM αNTD 50 0 -50 -100 0 50 100 150 200 Time [s] 250 300 350 0 50 100 Time [s] 150 200 Figure 5.26: SPR analysis of AviTagged-CcpA with HPrSer46P and αNTD The sensorgrams shows the immobilization of 250 nM C-terminally Avi-tagged CcpA to a neutravidine coated CM5 chip (A). The sensorgram (B) shows titrations of immobilized C-terminally Avi-tagged CcpA with HPrSer46P. The sensorgrams (C) and (D) show titrations of immobilized C-terminally Avi-tagged CcpA with αNTD (C) and of immobilized N-terminally Avi-tagged CcpA with αNTD (D). Concentrations of the analytes are depicted on the right side next to each sensorgram. While titrations of N-terminally Avi-tagged CcpA with HPrSer46P yielded almost equal results for CcpA interaction (data not shown), injections with increasing concentrations of αNTD (from 1 µM to 100 µM) did not yield any response (Fig. 5.26D). DISCUSSION 73 6 Discussion 6.1 SPINE analysis of StrepCcpA The global transcription regulator CcpA is a multifaceted protein. It represses or activates a large number of genes and is controlled by a diverse set of phosphoproteins and small molecules (Deutscher, 2008; Deutscher et al., 2006; Fujita, 2009; Moreno et al., 2001; Sonenshein, 2007). This versatility generates different regulatory outputs and quite a few of those are not understood completely at the molecular level. In particular, differential regulation of genes and the molecular mechanism for activation of genes by CcpA have not been studied in detail yet and both aspects suggest the presence of further unknown interaction partners for CcpA. The first approach by which this was addressed in this work was a SPINE analysis in order to identify interaction partners of CcpA in vivo. The addition of formaldehyde to growing cultures caused efficient crosslinking of biomolecules and the approach was specific for Strep-tagged complexes since in the ∆ccpA mutant strain WH1124, lacking a Strep-tag, hardly any protein was copurified. Strepaffinity purified CcpA complexes from crosslinked lysates contained a high number of different proteins whereas only a few proteins were copurified in the same experiment with non-crosslinked cultures. Interestingly, in the SDS-PAGE analysis of these SPINE eluates the protein patterns and the band intensities were similar for samples from cultures grown with or without glucose. These crosslinked elution fractions were analyzed by MS in collaboration with Dr. Elke Hammer and Prof. Dr. Uwe Völker (Ernst-Moritz-Arndt-Universität Greifswald). As formaldehyde connects biomolecules unspecifically, SPINE was performed with mixtures of formaldehyde treated 15 N and untreated 14 N labeled cells according to Dreisbach et al. as described in chapter 5.2 to distinguish specifically crosslinked proteins from non-specifically crosslinked ones (Dreisbach et al., 2008). The MS analysis of the crosslinked elution fractions from cells grown with glucose revealed 619 proteins. The application of the selection criteria described in chapter 5.3 reduced the number of potential interaction partners to 222 proteins identified by MS. From these potential interactions partners 143 were only detected in crosslinked elution fractions, such as HPr and CodY, indicating either a weak binding to CcpA or interaction dynamics with fast off rates of the interactants. 38 proteins were not only detected in all crosslinked elution fractions but also in all non-crosslinked ones pointing to a stronger binding or a binding with a slow off rate. The remaining 41 proteins were detected in all crosslinked elution fractions and in some but not all non-crosslinked elution fractions as well. 74 DISCUSSION The identified interaction partners can be subdivided into four functional categories: (1) Functionally related interaction partners were the subunits of the RNAP (RpoA, RpoB, RpoC), transcriptional regulators like CodY, TenA or CheV. (2) Enzymes involved in sugar transport (including HPr), glycolysis and tricarboxylic acid cycle. (3) Proteins involved in biotin and fatty acid biosynthesis, amino acid metabolism, purine and pyrimidine synthesis. (4) Proteins involved in sporulation, competence development and, unexpectedly, proteins involved in cell division and were also detected. Since formaldehyde crosslinks proteins with DNA, too, it is also possible that the non-specific DNA binding proteins and some of the other putative interaction partners detected by MS might result from indirect crosslinking with protein-DNA complexes located in close vicinity to DNA bound CcpA. Furthermore, SPINE-MS revealed also 33 proteins with yet unknown function. Considering the important role of CcpA in B. subtilis physiology it is not surprising that a large number of putative CcpA interaction partners were detected by MS after SPINE. However, SPINE-MS identified also ribosomal proteins, proteases, chaperones and stress proteins that are likely crosslinked with CcpA due to contacts during translation, maintenance and degradation of CcpA. Since formaldehyde crosslinks proteins with DNA, too, it is also possible that the non-specific DNA binding proteins and some of the other putative interaction partners detected by MS might result from indirect crosslinking with protein-DNA complexes located in close vicinity to DNA bound CcpA. Therefore, many of the proteins listed in Table A1 (Appendix) (data from SPINE eluates of WH1012 with and without glucose derive from MS analysis performed in collaboration with Dr. Elke Hammer and Prof. Dr. Uwe Völker, ErnstMoritz-Arndt-Universität Greifswald) originate from contacts which do not influence the regulatory activity of CcpA, however, not all proteins are functionally relevant. Consequently, for detailed analyses the interaction partners of CcpA listed in the Table A1 (Appendix) should be carefully preselected based on physiological but also on experimental data indicating an involvement in CcpA-dependent regulation. Interestingly, the MS analysis of elution fractions from SPINE did not reveal the known interaction partners like HPr or HPrSer46P as the most abundant proteins, even though the HPrSer46P-CcpA interaction is well established and has been characterized in many other studies (Horstmann et al., 2007; Reizer et al., 1996; Schumacher et al., 2004; Seidel et al., 2005). However, immunoblotting clearly proved the presence of HPr in the SPINE eluates and thus indicated that HPr was likely missing at least partially in the MS analysis. This is very likely due to the low molecular weight (88 amino acids) of HPr and the corresponding small number of specific peptides might explain the remarkable low number of identified peptides in MS for HPr or HPrSer46P. Immunoblotting identified HPr in SPINE elutions from cells grown in medium supplemented with glucose but not in a ptsH1 mutant. Complex formation in the presence, but not DISCUSSION 75 in the absence of glucose, as well as the lack of StrepCcpA-HPrSer46Ala complexes in SPINE eluates is consistent with previous in vivo and in vitro studies (Fujita, 2009; Stülke & Hillen, 2000). Although, HPrSer46P is the main coeffector, CrhSer46P also leads to the stimulation of CcpA binding to cre (Galinier et al., 1997). However, Crh was not detected in SPINE eluates, neither in the wildtype strain nor in the ptsH1 mutant strain. This agrees with studies which showed that a ptsH1 mutant encoding for HPrS46A exhibits strongly reduced CCR at many genes as CrhSer46P can only partially substitute for HPrSer46P (Galinier et al., 1999; Galinier et al., 1997; Zeng et al., 2000). Thus there are obviously less CcpA-CrhP complexes. There are only few specific peptides for the small Crh protein (85 amino acids) available and thus the determination of Crh is even more difficult than detection of HPr. Thus, the number of Crh specific peptides might be below the selection criteria and, consequently, Crh was not detected in MS analysis. This is in good agreement with the results of the SPINE immunoblot analysis in which a signal for Crh was not observed, too. Furthermore, the initiation of a glycolytic bypass was identified as an exclusively Crh specific but CcpA-independent function of Crh (Landmann et al., 2011; Landmann et al., 2012). The methylglyoxal synthase MgsA is inhibited by interaction with Crh, however, CrhSerP abolishes this inhibitory interaction and thereby prevents accumulation of phosphorylated glycolytic intermediates in the cell. However, since CrhSer46P binds CcpA in vitro and CrhSer46P substitutes HPrSer46P in vivo at least partially in an HPrSer46Ala mutant (Galinier et al., 1997; Singh et al., 2008), it is not clear how or under which conditions CrhSer46P is important for CcpA-dependent CCR. 6.2 Binary protein-protein interactions analyzed by BACTH In SPINE in vivo crosslinking is mediated by formaldehyde. Because formaldehyde reacts with amino and imino groups of proteins and nucleic acids (Das et al., 2004), indirect binding of proteins via DNA and RNA, can be misinterpreted for direct binding (Spencer et al., 2003). Therefore, it is very likely that some of the putative interaction partners detected by MS might form complexes with proteins located in close vicinity to DNA bound by CcpA and consequently a BACTH system was applied to verify binary protein-protein interactions. In contrast to enzymes involved in glycolysis, CcpA represses the synthesis of almost all the TCA cycle enzymes in the presence of glucose (Tobisch et al., 1999a). These genes are derepressed by growth of the cells in medium containing glutamate or ribose (Sonenshein, 2007). While CcpA represses transcription of citZ directly, the expression of citB is obviously indirectly repressed by CcpA (Blencke et al., 2003; Kim et al., 2002). Interestingly, in SPINE eluates several TCA cylce 76 DISCUSSION enzymes were identified with a large number of specific peptides. BACTH analyses indicated that CcpA interacts weakly with CitZ, Icd and Mdh. Combinations of CcpA with CitB and CitG showed no interaction with CcpA in BACTH assays. In the presence of glucose CcpA activates the transcription of genes of the overflow metabolism and those for utilization of carbon sources of the TCA cycle are repressed. Recently, Meyer et al. detected protein-protein interactions among TCA enzymes and suggested a TCA cycle metabolon (Meyer et al., 2011). In presence of glucose CcpA represses citZ transcription (Sonenshein, 2007) and additionally CcpA might interact with Mdh, Icd and CitZ, the core TCA metabolon. However, there is no evidence for a specific role of CcpA-TCA metabolon interactions and the function of CcpA interactions with TCA cycle enzymes remains unclear. Although CodY was identified in SPINE eluates by MS and immunoblotting in cells grown with and without glucose, the BACTH analyses did not show any interaction of CodY with CcpA and RpoA and of CcpA and αCTD, respectively. However, the interaction of CcpA and HPr and HPrS46D, a mutant which binds CcpA, was also not detected by the BACTH assay (Liebl, 2009). This might be due to steric hindrance or wrong orientation of the Cya domains in the fusion proteins, preventing Cya dimerization and thus Cya activity. In one approach, linkers with different lengths, 35 and 15 amino acids (Ün, 2009), respectively, were inserted between each Cya fusion of either CcpA or HPrS46D, however, Cya activity was not restored (data not shown). It is well known that only a fraction of the actual protein-protein interactions is detected by each individual method for investigation of binary protein-protein interactions (Li et al., 2004; Rual et al., 2005; Yu et al., 2008). False negatives in two-hybrid screens may occur out of several reasons: (1) Misfolding of fusion proteins abolish the interactions (Strauch & Georgiou, 2007). (2) The Cya domains cannot reconstitute for a functional enzyme in a complex with the fusion proteins as their orientation in the fusion protein is insufficient for proper dimerization of the fused Cya domains. Different protein sizes of the interaction partners or the physical distance of the Cya domains can prevent an actual positive interaction. (3) The interaction requires posttranslational modification which induce conformational changes on the interaction surfaces of the proteins (Ito et al., 2000). The orientation of the small 8 kDa αCTD in a complex with the 38 kDa CcpA monomer is likely insufficient for proper dimerization of the fused Cya domains and might explain the negative result in the BACTH assay. This might also explain the missing interaction of CcpA and HPr or HPrS46D and also the negative results for interactions of CodY and CcpA or RpoA in the BACTH assays. DISCUSSION 77 6.3 Interactions of CcpA, CodY and RpoA involved in activation of ackA Transcriptional activation in bacteria is mostly mediated by interactions of transcriptional activators with different subdomains of the RNA polymerase and influences the recruitment of RNA polymerase in the transcription initiation. These interactions increase RNA polymerase binding to the promoter or facilitate the open complex formation (Browning & Busby, 2004; Busby & Ebright, 1994). In E. coli several activators directly interact with at least one of each subunit of the RNA polymerase (α, β, β′ and ω) (Hochschild & Dove, 1998). Only few activators contact the β or the β′ subunits of the RNA polymerase (Kulkarni & Summers, 1999; Lee & Hoover, 1995; Miller et al., 1997; Szalewska-Palasz et al., 1998). Most transcriptional activators primarily interact with α or σ subunits (Busby & Ebright, 1994; Hochschild & Dove, 1998) such as the transcriptional regulators CAP, FNR, IHF, FIS, NtrC and MarA in E. coli (Browning & Busby, 2004). Interactions of activators with the αCTD stabilize the binding of the RNA polymerase to the promoter (Gourse et al., 2000). In contrast the main function of the αNTD is the dimerization of the RNA polymerase and activators binding to the αNTD mainly increase the rate of isomerization (Ishihama, 1993; Niu et al., 1996) and is the target of only few activators (Niu et al., 1996). Among the interaction partners of CcpA, isolated by SPINE and identified by MS, the transcriptional regulator CodY and all RNA polymerase subunits, RpoA, RpoB and RpoC were observed. The SPINE-immunoblot analysis with an anti-RpoA antibody confirmed the presence of RpoA in the elution fractions from in vivo crosslinking of cells grown with or without glucose. In contrast to the data derived from SPINE, in the BACTH assays only the interaction of CcpA with RpoA was detected, but not with RpoB and RpoC. This is likely due to the fact that crosslinking in SPINE connects all proteins in heterooligomeric complexes, such as the RNA polymerase subunits (α2ββ′), whereas the two-hybrid assay only detects binary interaction partners. In more detail, the BACTH assay revealed interactions between CcpA and RpoA or the αNTD and self-interactions of CcpA, RpoA and the αNTD due to their dimerization. The SPR analysis confirmed binding of CcpA to the αNTD and detected additionally binding of CcpA to the CTD of RpoA as well as interactions of CodY with both subunits of RpoA. These different observations are not surprising because in SPR the analyte can bind in every possible orientation, as long as the interaction surface of the ligand is exposed to the solvent whereas the BACTH depends on a proper orientation of the interacting proteins. The interactions of CcpA and CodY with the αNTD are unusual as transcriptional activators mainly interact with the different activating regions of αCTD or with the σ subunit of RNA polymerase (Browning & Busby, 2004). Interestingly, the only protein which is known so far to interact with the αNTD is the functional 78 DISCUSSION homologue of CcpA in E. coli, the catabolite activating protein CAP (Browning & Busby, 2004; Niu et al., 1996). In E. coli, CAP-αNTD contacts are involved in regulation of galactosidase expression at the galP1 and melR promoters (Niu et al., 1996). Interestingly, in B. subtilis both regulators, CcpA and CodY, interact with both the αCTD and the αNTD of the RNA polymerase. The KDs of 5 and 8 µM of the CcpA complexes with the RpoA subunits are similar to that of CAP with the αCTD and the αNTD in E. coli (Niu et al., 1996). The intracellular concentrations of CcpA and RpoA are in the low micromolar range for CcpA (Miwa et al., 1994) 15 – 30 µM for the RNAP holoenzyme (Doherty et al., 2010; Lopez de Saro et al., 1999). This combination of the KDs and the intracellular concentrations of CcpA and RpoA suggests that a subpopulation of CcpA forms complexes with the α subunit already before DNA binding, as it was demonstrated for CAP, SoxS and MarA (Heyduk et al., 1993; Martin et al., 2002; Shah & Wolf, 2004). This is also in good agreement with the result of SPINE because CcpA-RpoA complexes were detected in eluates from cells grown with and without glucose. This result suggests that preformed complexes of CcpA with RpoA or with the RNA polymerase holoenzyme are directed to a cre site for gene activation after glucose-dependent binding of HPrSer46P. However, it is not clear if a CcpA-RpoA complex can also bind to cre sites of repressed genes or if it plays any role in repression. The SPR analyses in this study show also that CodY binds the αCTD as well as the αNTD of RpoA at similar KDs like CcpA. This means that CodY is able to bind to RNA polymerase independently from CcpA. This is in good agreement with studies on ackA expression because, like CcpA, CodY alone is also able to activate ackA (Shivers et al., 2006). The latter publication also demonstrated that cooperative activation of ackA by CcpA and CodY exceeds the sum of the individual activation. This synergism might be due to the rather weak complex formation between CodY and CcpA. The high KD for CcpA-CodY maintains individual control of gene expression by either regulator because it prevents permanent binding to each other in the cytoplasm. On the other hand, binding of both regulators to consecutive DNA binding sites in close vicinity, e.g. in the ackA regulatory region, leads to an increased local concentration which likely allows complex formation even for the high KD of 60 µM. This assumption is strongly supported by the results from SPINE with cultures grown with and without glucose. CcpA binds DNA in the presence of glucose. Consequently, CodY-CcpA complex formation occurred strongly in cells grown with glucose and only marginally in the absence of glucose. Furthermore, neither the αCTD nor the αNTD inhibited the binding of CcpA to CodY in SPR indicating that the αCTD and the αNTD do not interact with CcpA at overlapping binding sites. However, amine coupling of ligands has a commonly known great disadvantage, as by this random immobilization method, the ligand is bound to the chip surface in various orientations. The presence of lysine groups in the vicinity of the binding site on the protein surface might not DISCUSSION 79 be suitable for coupling of this protein. The binding site might be blocked or hampered, thus influencing the binding constants. The biotin / streptavidin interaction is a high affinity, non-covalent binding which is also suitable for immobilization of ligands on the sensor chip surface. Biotinylated molecues are coupled sitespecifically on the chip surface, due to the very strong interaction between streptavidin and a biotinylated molecule (KD 10-15 M). In contrast to unspecific in vitro biotinylation systems, the Avi-tag is site-specifically biotinylated by BirA. The biotinylated proteins can be immobilized directly on streptavidin or neutravidine coated sensor chips. The major advantage of this immobilization method over the amine coupling is that all immobilized proteins have the same orientation due to site-directed coupling via the biotinylated Avi-tag. Therefore, CcpA was fused to the Avi-tag because other interaction analyses with RpoA and CodY could be maintained on one chip surface. Biotinylated C- and N-terminally Avi-tagged CcpA were able to bind HPrSer46P suggesting that the HPrSer46P binding sites of CcpA are exposed in both N- and Cterminally coupled Avi-tagged CcpA. In contrast, only αNTD bound to C-terminally immobilized but not to N-terminally coupled CcpA, indicating that the N-terminally immobilized protein is blocked for αNTD binding. Thus, αNTD binding to CcpA might also overlap with the N-terminal subdomain of CcpA. Although, binding of HPrSer46P and of αNTD was detected qualitatively using biotinlyated CcpA coupled to a neutravidine chip, this experimental approach was not used for analysis of CcpA interactions because of the high “bulk effects” at higher concentrations of αNTD. The bulk effect describes a signal offset due to a refractive index mismatch by contribution of the bulk solute concentration to the SPR response that occurs in addition to the response which is clearly observed as “peak” in the sensorgrams at the beginning and the end of an injection. Because this bulk effect might impair the kinetic analyses which was not the case to the amine coupling of the proteins on a CM5 chip, these measurements were not used for kinetic analyses. In summary, the data is in good agreement with published in vivo analyses because only a ∆ccpA∆codY double mutant abolishes activation of ackA, the ∆ccpA and ∆codY single mutants activate ackA intermediately whereas ackA activation in wildtype cells clearly exceeds ackA expression of the single deletion mutants (Shivers et al., 2006). Moreover, in vitro analyses showed CodY and CcpA high affinity binding to DNA motifs located -83 bp and -56.5 bp upstream of the promoter, respectively (Grundy et al., 1993a; Shivers et al., 2006; Turinsky et al., 1998). Taking all this into account the regulatory protein-DNA complex shown in Figure 6.1 for cooperative initiation of transcription of ackA can be proposed. This assumption is supported as follows: 1. CcpA and CodY interact both with the αNTD and the αCTD. 2. CcpA binds to the cre close to the αNTD but CodY binds a distant DNA binding site. 3. In vitro, CcpA binds to CodY in 80 DISCUSSION the absence of HPrSer46P. 4. αNTD and αCTD bind to CodY at a different binding site than CcpA. 5. HPrSer46P points towards CodY in an HPrSer46P-CcpA-cre complex (Schumacher et al., 2004) and presents an obstacle preventing CodY from directly contacting the αNTD. The most likely orientation for CodY to form a complex with CcpA and the αNTD at the same time is, therefore, to induce a bend in the DNA and to contact its interaction partners. CodY αCTD αNTD β´ β HPrSer46P σ CcpA -35 -10 Figure 6.1: Putative model for the transcriptional activation of ackA Schematic representation of an arrangement of CcpA, CodY and the RNAP in a initiation complex which involves all interactions detected in this study: blue CcpA homodimer; red: HPrSer46P; orange: CodY homodimer; green homodimer of the α subtunit of the RNA polymerase, grey: β, β′ subunits of the RNA polymerase; black: σ factor; grey boxes: DNA binding domains of CcpA (cre) and CodY. In summary, CodY and RpoA as novel interaction partners of CcpA were identified and characterized and a model for a transcription initiation complex was proposed. Further studies may focus on the identification of residues, which are involved in the interaction. Moreover, after careful preselection of the interaction partners of CcpA listed in Table A1 (Appendix) additional direct interaction partners of CcpA might be identified and analyzed in detail. REFERENCES 81 7 References Arantes, O. & Lereclus, D. (1991). Construction of cloning vectors for Bacillus thuringiensis. Gene 108, 115-119. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (1994). Current Protocols in Molecular Biology: New York: Greene Publishing Assoziates. Bachem, S. & Stülke, J. (1998). Regulation of the Bacillus subtilis GlcT antiterminator protein by components of the phosphotransferase system. J Bacteriol 180, 5319-5326. Barbe, V., Cruveiller, S., Kunst, F., Lenoble, P., Meurice, G., Sekowska, A., Vallenet, D., Wang, T., Moszer, I., Medigue, C. & Danchin, A. (2009). From a consortium sequence to a unified sequence: the Bacillus subtilis 168 reference genome a decade later. Microbiology 155, 1758-1775. Barker, D. F. & Campbell, A. M. (1981). The birA gene of Escherichia coli encodes a biotin holoenzyme synthetase. J Mol Biol 146, 451-467. Bartholomae, M. (2008). Identifizierung und Signaltransduktion der Interaktionspartner der Kohlenstoffkatabolitenregulation in Bacillus subtilis. Lehrstuhl für Mikrobiologie, Diplomarbeit, Friedrich-Alexander-Universität Erlangen-Nürnberg. Bayer, E. A. & Wilchek, M. (1990). Protein biotinylation. Methods Enzymol 184, 138-160. Beckett, D., Kovaleva, E. & Schatz, P. J. (1999). A minimal peptide substrate in biotin holoenzyme synthetase-catalyzed biotinylation. Protein Sci 8, 921-929. Bettenbrock, K., Sauter, T., Jahreis, K., Kremling, A., Lengeler, J. W. & Gilles, E. D. (2007). Correlation between growth rates, EIIACrr phosphorylation, and intracellular cyclic AMP levels in Escherichia coli K-12. J Bacteriol 189, 6891-6900. Blencke, H. M., Homuth, G., Ludwig, H., Mäder, U., Hecker, M. & Stülke, J. (2003). Transcriptional profiling of gene expression in response to glucose in Bacillus subtilis: regulation of the central metabolic pathways. Metab Eng 5, 133-149. Bradford, M. (1976). A rapid and sensitive method for quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248-254. Browning, D. F. & Busby, S. J. (2004). The regulation of bacterial transcription initiation. Nat Rev Microbiol 2, 57-65. Brückner, R. & Titgemeyer, F. (2002). Carbon catabolite repression in bacteria: choice of the carbon source and autoregulatory limitation of sugar utilization. FEMS Microbiol Lett 209, 141-148. Busby, S. & Ebright, R. H. (1994). Promoter structure, promoter recognition, and transcription activation in prokaryotes. Cell 79, 743-746. Busby, S. & Ebright, R. H. (1999). Transcription activation by catabolite activator protein (CAP). J Mol Biol 293, 199-213. 82 REFERENCES Cases, I., Velazquez, F. & de Lorenzo, V. (2007). The ancestral role of the phosphoenolpyruvatecarbohydrate phosphotransferase system (PTS) as exposed by comparative genomics. Res Microbiol 158, 666-670. Chambliss, G. H. (1993). Carbon source-mediated catabolite repression. In Bacillus subtilis and other Gram-positive bacteria, (ed. A. L. Sonenshein J. A. Hoch & R. Losick), pp. 213-218. Washington D.C.: American Society for Microbiology. Chapman-Smith, A. & Cronan, J. E., Jr. (1999a). The enzymatic biotinylation of proteins: a posttranslational modification of exceptional specificity. Trends Biochem Sci 24, 359-363. Chapman-Smith, A. & Cronan, J. E., Jr. (1999b). Molecular biology of biotin attachment to proteins. J Nutr 129, 477S-484S. Choi, S. K. & Saier, M. H., Jr. (2005). Regulation of sigL expression by the catabolite control protein CcpA involves a roadblock mechanism in Bacillus subtilis: potential connection between carbon and nitrogen metabolism. J Bacteriol 187, 6856-6861. Cognet, I., Guilhot, F., Gabriac, M., Chevalier, S., Chouikh, Y., Herman-Bert, A., Guay-Giroux, A., Corneau, S., Magistrelli, G., Elson, G. C., Gascan, H. & Gauchat, J. F. (2005). Cardiotrophinlike cytokine labelling using BirA biotin ligase: a sensitive tool to study receptor expression by immune and non-immune cells. J Immunol Methods 301, 53-65. Cronan, J. E., Jr. (1990). Biotination of proteins in vivo. A post-translational modification to label, purify, and study proteins. J Biol Chem 265, 10327-10333. Cronan, J. E., Jr. & Reed, K. E. (2000). Biotinylation of proteins in vivo: a useful posttranslational modification for protein analysis. Methods Enzymol 326, 440-458. Crutz, A. M., Steinmetz, M., Aymerich, S., Richter, R. & Le Coq, D. (1990). Induction of levansucrase in Bacillus subtilis: an antitermination mechanism negatively controlled by the phosphotransferase system. J Bacteriol 172, 1043-1050. Cull, M. G. & Schatz, P. J. (2000). Biotinylation of proteins in vivo and in vitro using small peptide tags. Methods Enzymol 326, 430-440. Darbon, E., Ito, K., Huang, H. S., Yoshimoto, T., Poncet, S. & Deutscher, J. (1999). Glycerol transport and phosphoenolpyruvate-dependent enzyme I- and HPr- catalysed phosphorylation of glycerol kinase in Thermus flavus. Microbiology 145, 3205-3212. Darbon, E., Servant, P., Poncet, S. & Deutscher, J. (2002). Antitermination by GlpP, catabolite repression via CcpA and inducer exclusion triggered by P-GlpK dephosphorylation control Bacillus subtilis glpFK expression. Mol Microbiol 43, 1039-1052. Das, P. M., Ramachandran, K., vanWert, J. & Singal, R. (2004). Chromatin immunoprecipitation assay. Biotechniques 37, 961-969. Débarbouillé, M., Arnaud, M., Fouet, A., Klier, A. & Rapoport, G. (1990). The sacT gene regulating the sacPA operon in Bacillus subtilis shares strong homology with transcriptional antiterminators. J. Bacteriol. 172, 3966-3973. Débarbouillé, M., Martin-Verstraete, I., Klier, A. & Rapoport, G. (1991a). The levanase regulator LevR of Bacillus subtilis has domains homologous to both σ54- and PTS-dependent regulators. Proc Natl Acad Sci USA 88, 2212-2216. REFERENCES 83 Débarbouillé, M., Martin-Verstraete, I., Klier, A. & Rapoport, G. (1991b). The transcriptional regulator LevR of Bacillus subtilis has domains homologous to both σ54- and phosphotransferase system-dependent regulators. Proc Natl Acad Sci USA 88, 2212-2216. Dedon, P. C., Soults, J. A., Allis, C. D. & Gorovsky, M. A. (1991). A simplified formaldehyde fixation and immunoprecipitation technique for studying protein-DNA interactions. Anal Biochem 197, 83-90. Deutscher, J. (2008). The mechanisms of carbon catabolite repression in bacteria. Curr Opin Microbiol 11, 87-93. Deutscher, J., Fischer, C., Charrier, V., Galinier, A., Lindner, C., Darbon, E. & Dossonnet, V. (1997). Regulation of carbon metabolism in gram-positive bacteria by protein phosphorylation. Folia Microbiol 42, 171-178. Deutscher, J., Francke, C. & Postma, P. W. (2006). How phosphotransferase system-related protein phosphorylation regulates carbohydrate metabolism in bacteria. Microbiol Mol Biol Rev 70, 939-1031. Deutscher, J., Küster, E., Bergstedt, U., Charrier, V. & Hillen, W. (1995). Protein kinasedependent HPr/CcpA interaction links glycolytic activity to carbon catabolite repression in grampositive bacteria. Mol Microbiol 15, 1049-1053. Deutscher, J., Reizer, J., Fischer, C., Galinier, A., Saier Jr., M. H. & Steinmetz, M. (1994). Loss of protein kinase-catalyzed phosphorylation of HPr, a phosphocarrier protein of the phosphotransferase system, by mutation of the ptsH gene confers catabolite repression resistance to several catabolic genes of Bacillus subtilis. J. Bacteriol. 176, 3336-3344. Diel, M. (2005). Fluoreszenzspektroskopische Analyse der Interaktionen von Einzeltryptophanmutanten des Katabolit-Kontrollproteins CcpA aus Bacillus subtilis mit Cofaktoren und cre. Lehrstuhl für Mikrobiologie, Doktorarbeit, Friedrich-Alexander Universität ErlangenNürnberg. Doherty, G. P., Fogg, M. J., Wilkinson, A. J. & Lewis, P. J. (2010). Small subunits of RNA polymerase: localization, levels and implications for core enzyme composition. Microbiology 156, 3532-3543. Dreisbach, A., Otto, A., Becher, D., Hammer, E., Teumer, A., Gouw, J. W., Hecker, M. & Völker, U. (2008). Monitoring of changes in the membrane proteome during stationary phase adaptation of Bacillus subtilis using in vivo labeling techniques. Proteomics 8, 2062-2076. Eisenberg, M. A., Prakash, O. & Hsiung, S. C. (1982). Purification and properties of the biotin repressor. A bifunctional protein. J Biol Chem 257, 15167-15173. Favier, A., Brutscher, B., Blackledge, M., Galinier, A., Deutscher, J., Penin, F. & Marion, D. (2002). Solution structure and dynamics of Crh, the Bacillus subtilis catabolite repression HPr. J Mol Biol 317, 131-144. Fisher, S. H., Rohrer, K. & Ferson, A. E. (1996). Role of CodY in regulation of the Bacillus subtilis hut operon. J Bacteriol 178, 3779-3784. Fuchsbauer, N. (2003). Zur molekularen Funktion des Regulatorproteins CcpA aus Bacillus subtilis. Lehrstuhl für Mikrobiologie, Doktorarbeit, Friedrich-Alexander Universität Erlangen-Nürnberg. 84 REFERENCES Fujita, Y. (2009). Carbon catabolite control of the metabolic network in Bacillus subtilis. Biosci Biotechnol Biochem 73, 245-259. Galinier, A., Deutscher, J. & Martin-Verstraete, I. (1999). Phosphorylation of either Crh or HPr mediates binding of CcpA to the Bacillus subtilis xyn cre and catabolite repression of the xyn operon. J Mol Biol 286, 307-314. Galinier, A., Haiech, J., Kilhofer, M.-C., Jaquinod, M., Stülke, J., Deutscher, J. & MartinVerstraete, I. (1997). The Bacillus subtilis crh gene encodes a HPr-like protein involved in carbon catabolite repression. Proc Natl Acad Sci USA 94, 8439-8444. Galinier, A., Kravanja, M., Engelmann, R., Hengstenberg, W., Kilhoffer, M. C., Deutscher, J. & Haiech, J. (1998). New protein kinase and protein phosphatase families mediate signal transduction in bacterial catabolite repression. Proc Natl Acad Sci USA 95, 1823-1828. Görke, B., Fraysse, L. & Galinier, A. (2004). Drastic differences in Crh and HPr synthesis levels reflect their different impacts on catabolite repression in Bacillus subtilis. J Bacteriol 186, 2992-2995. Görke, B. & Stülke, J. (2008). Carbon catabolite repression in bacteria: many ways to make the most out of nutrients. Nat Rev Microbiol 6, 613-624. Gourse, R. L., Ross, W. & Gaal, T. (2000). UPs and downs in bacterial transcription initiation: the role of the α subunit of RNA polymerase in promoter recognition. Mol Microbiol 37, 687-695. Green, N. M. (1990). Avidin and streptavidin. Methods Enzymol 184, 51-67. Grundy, F. J., Waters, D. A., Allen, S. H. & Henkin, T. M. (1993a). Regulation of the Bacillus subtilis acetate kinase gene by CcpA. J Bacteriol 175, 7348-7355. Grundy, F. J., Waters, D. A., Takova, T. Y. & Henkin, T. M. (1993b). Identification of genes involved in utilization of acetate and acetoin in Bacillus subtilis. Mol Microbiol 10, 259-271. Gunnewijk, M. G., van den Bogaard, P. T., Veenhoff, L. M., Heuberger, E. H., de Vos, W. M., Kleerebezem, M., Kuipers, O. P. & Poolman, B. (2001). Hierarchical control versus autoregulation of carbohydrate utilization in bacteria. J Mol Microbiol Biotechnol 3, 401-413. Hammer, E., Goritzka, M., Ameling, S., Darm, K., Steil, L., Klingel, K., Trimpert, C., Herda, L. R., Dörr, M., Kroemer, H. K., Kandolf, R., Staudt, A., Felix, S. B. & Völker, U. (2011). Characterization of the human myocardial proteome in inflammatory dilated cardiomyopathy by labelfree quantitative shotgun proteomics of heart biopsies. J Proteome Res 10, 2161-2171. Hanson, R. S. & Cox, D. P. (1967). Effect of different nutritional conditions on the synthesis of tricarboxylic acid cycle enzymes. J Bacteriol 93, 1777-1787. Henkin, T., Grundy, F., Nicholson, W. & Chambliss, G. (1991). Catabolite repression of α-amylase gene expression in Bacillus subtilis involves a trans-acting gene product homologous to the Escherichia coli lacI and galR repressors. Mol Microbiol 5, 575-584. Herzberg, C., Weidinger, L. A., Dörrbecker, B., Hübner, S., Stülke, J. & Commichau, F. M. (2007). SPINE: a method for the rapid detection and analysis of protein-protein interactions in vivo. Proteomics 7, 4032-4035. Heyduk, T., Lee, J. C., Ebright, Y. W., Blatter, E. E., Zhou, Y. & Ebright, R. H. (1993). CAP interacts with RNA polymerase in solution in the absence of promoter DNA. Nature 364, 548-549. REFERENCES 85 Hochschild, A. & Dove, S. L. (1998). Protein-protein contacts that activate and repress prokaryotic transcription. Cell 92, 597-600. Hogema, B. M., Arents, J. C., Bader, R., Eijkemans, K., Yoshida, H., Takahashi, H., Aiba, H. & Postma, P. W. (1998). Inducer exclusion in Escherichia coli by non-PTS substrates: the role of the PEP to pyruvate ratio in determining the phosphorylation state of enzyme IIAGlc. Mol Microbiol 30, 487-498. Horstmann, N. (2006). Influence of various coeffectors on differential carbon catabolite regulation exerted by CcpA. Lehrstuhl für Mikrobiologie, Doktorarbeit, Friedrich-Alexander Universität Erlangen-Nürnberg. Horstmann, N., Seidel, G., Aung-Hilbrich, L. M. & Hillen, W. (2007). Residues His-15 and Arg-17 of HPr participate differently in catabolite signal processing via CcpA. J Biol Chem 282, 1175-1182. Hueck, C. J., Kraus, A., Schmiedel, D. & Hillen, W. (1995). Cloning, expression and functional analyses of the catabolite control protein CcpA from Bacillus megaterium. Mol. Microbiol. 16, 855864. Inoue, H., Nojima, H. & Okayama, H. (1990). High efficiency transformation of Escherichia coli with plasmids. Gene 96, 23-28. Ishihama, A. (1993). Protein-protein communication within the transcription apparatus. J Bacteriol 175, 2483-2489. Ito, T., Tashiro, K., Muta, S., Ozawa, R., Chiba, T., Nishizawa, M., Yamamoto, K., Kuhara, S. & Sakaki, Y. (2000). Toward a protein-protein interaction map of the budding yeast: A comprehensive system to examine two-hybrid interactions in all possible combinations between the yeast proteins. Proc Natl Acad Sci USA 97, 1143-1147. Jault, J. M., Fieulaine, S., Nessler, S., Gonzalo, P., Di Pietro, A., Deutscher, J. & Galinier, A. (2000). The HPr kinase from Bacillus subtilis is a homo-oligomeric enzyme which exhibits strong positive cooperativity for nucleotide and fructose 1,6-bisphosphate binding. J Biol Chem 275, 17731780. Jokiranta, T. S. & Meri, S. (1993). Biotinylation of monoclonal antibodies prevents their ability to activate the classical pathway of complement. J Immunol 151, 2124-2131. Jones, B. E., Dossonnet, V., Küster, E., Hillen, W., Deutscher, J. & Klevit, R. E. (1997). Binding of the catabolite repressor protein CcpA to its DNA target is regulated by phosphorylation of its corepressor HPr. J Biol Chem 272, 26530-26535. Jourlin-Castelli, C., Mani, N., Nakano, M. M. & Sonenshein, A. L. (2000). CcpC, a novel regulator of the LysR family required for glucose repression of the citB gene in Bacillus subtilis. J Mol Biol 295, 865-878. Karimova, G., Pidoux, J., Ullmann, A. & Ladant, D. (1998). A bacterial two-hybrid system based on a reconstituted signal transduction pathway. Proc Natl Acad Sci USA 95, 5752-5756. Kim, H. J., Roux, A. & Sonenshein, A. L. (2002). Direct and indirect roles of CcpA in regulation of Bacillus subtilis Krebs cycle genes. Mol Microbiol 45, 179-190. Kim, J. H., Yang, Y. K. & Chambliss, G. H. (2005). Evidence that Bacillus catabolite control protein CcpA interacts with RNA polymerase to inhibit transcription. Mol Microbiol 56, 155-162. 86 REFERENCES Kotrba, P., Inui, M. & Yukawa, H. (2001). Bacterial phosphotransferase system (PTS) in carbohydrate uptake and control of carbon metabolism. J Biosci Bioeng 92, 502-517. Kraus, A., Hueck, C., Gärtner, D. & Hillen, W. (1994). Catabolite repression of the Bacillus subtilis xyl operon involves a cis element functional in the context of an unrelated sequence, and glucose exerts an additional xylR-dependent repression. J Bacteriol 176, 1738-1745. Krüger, S. & Hecker, M. (1995). Regulation of the putative bglPH operon for aryl-beta-glucoside utilization in Bacillus subtilis. J Bacteriol 177, 5590-5597. Kulkarni, R. D. & Summers, A. O. (1999). MerR cross-links to the α, β, and σ70 Subunits of RNA polymerase in the preinitiation complex at the merTPCAD promoter. Biochemistry 38, 3362-3368. Kunst, F. & Rapoport, G. (1995). Salt stress is an environmental signal affecting degradative enzyme synthesis in Bacillus subtilis. J Bacteriol 177, 2403-2407. Küster-Schöck, E., Wagner, A., Völker, U. & Hillen, W. (1999). Mutations in catabolite control protein CcpA showing glucose-independent regulation in Bacillus megaterium. J Bacteriol 181, 76347638. Küster, E., Luesink, E. J., de Vos, W. M. & Hillen, W. (1996). Immunological Crossreactivity to Catabolite control Protein CcpA from Bacillus megaterium is found in many Gram-positive Bacteria. FEMS Microbiol. Lett. 139, 109-115. Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685. Landmann, J. J., Busse, R. A., Latz, J. H., Singh, K. D., Stülke, J. & Görke, B. (2011). Crh, the paralogue of the phosphocarrier protein HPr, controls the methylglyoxal bypass of glycolysis in Bacillus subtilis. Mol Microbiol 82, 770-787. Landmann, J. J., Werner, S., Hillen, W., Stülke, J. & Görke, B. (2012). Carbon source control of the phosphorylation state of the Bacillus subtilis carbon-flux regulator Crh in vivo. FEMS Microbiol Lett 327, 47-53. Langbein, I., Bachem, S. & Stülke, J. (1999). Specific interaction of the RNA-binding domain of the Bacillus subtilis transcriptional antiterminatior GlcT with its RNA target, RAT. Journal of Molecular Biology 293, 795-805. Lee, J. H. & Hoover, T. R. (1995). Protein crosslinking studies suggest that Rhizobium meliloti C4dicarboxylic acid transport protein D, a σ54-dependent transcriptional activator, interacts with σ54 and the β subunit of RNA polymerase. Proc Natl Acad Sci USA 92, 9702-9706. Lehnik-Habrink, M., Pförtner, H., Rempeters, L., Pietack, N., Herzberg, C. & Stülke, J. (2010). The RNA degradosome in Bacillus subtilis: identification of CshA as the major RNA helicase in the multiprotein complex. Mol Microbiol 77, 958-971. Li, S., Armstrong, C. M., Bertin, N., Ge, H., Milstein, S., Boxem, M., Vidalain, P. O., Han, J. D., Chesneau, A., Hao, T., Goldberg, D. S., Li, N., Martinez, M., Rual, J. F., Lamesch, P., Xu, L., Tewari, M., Wong, S. L., Zhang, L. V., Berriz, G. F., Jacotot, L., Vaglio, P., Reboul, J., Hirozane-Kishikawa, T., Li, Q., Gabel, H. W., Elewa, A., Baumgartner, B., Rose, D. J., Yu, H., Bosak, S., Sequerra, R., Fraser, A., Mango, S. E., Saxton, W. M., Strome, S., Van Den Heuvel, S., Piano, F., Vandenhaute, J., Sardet, C., Gerstein, M., Doucette-Stamm, L., Gunsalus, K. C., REFERENCES 87 Harper, J. W., Cusick, M. E., Roth, F. P., Hill, D. E. & Vidal, M. (2004). A map of the interactome network of the metazoan C. elegans. Science 303, 540-543. Liebl, A. (2009). Untersuchung der Interaktion von CcpA mit HPr und HPrS46D mittels BACTH. Lehrstuhl für Mikrobiologie, Bachelorarbeit, Friedrich-Alexander Universität Erlangen-Nürnberg. Liedberg, B., Nylander, C. & Lundstrom, I. (1995). Biosensing with surface plasmon resonance how it all started. Biosens Bioelectron 10, i-ix. Lopez de Saro, F. J., Yoshikawa, N. & Helmann, J. D. (1999). Expression, abundance, and RNA polymerase binding properties of the δ factor of Bacillus subtilis. J Biol Chem 274, 15953-15958. Lorca, G. L., Chung, Y. J., Barabote, R. D., Weyler, W., Schilling, C. H. & Saier, M. H., Jr. (2005). Catabolite repression and activation in Bacillus subtilis: dependency on CcpA, HPr, and HprK. J Bacteriol 187, 7826-7839. Lulko, A. T., Buist, G., Kok, J. & Kuipers, O. P. (2007). Transcriptome analysis of temporal regulation of carbon metabolism by CcpA in Bacillus subtilis reveals additional target genes. J Mol Microbiol Biotechnol 12, 82-95. Magasanik, B. (1961). Catabolite repression. Cold Spring Harb Symp Quant Biol 26, 249-256. Martin-Verstraete, I., Charrier, V., Stülke, J., Galinier, A., Erni, B., Rapoport, G. & Deutscher, J. (1998). Antagonistic effects of dual PTS-catalysed phosphorylation on the Bacillus subtilis transcriptional activator LevR. Mol Microbiol 28, 293-303. Martin-Verstraete, I., Stülke, J., Klier, A. & Rapoport, G. (1995). Two different mechanisms mediate catabolite repression of the Bacillus subtilis levanase operon. J Bacteriol 177, 6919-6927. Martin, R. G., Gillette, W. K., Martin, N. I. & Rosner, J. L. (2002). Complex formation between activator and RNA polymerase as the basis for transcriptional activation by MarA and SoxS in Escherichia coli. Mol Microbiol 43, 355-370. Meyer, F. M., Gerwig, J., Hammer, E., Herzberg, C., Commichau, F. M., Völker, U. & Stülke, J. (2011). Physical interactions between tricarboxylic acid cycle enzymes in Bacillus subtilis: evidence for a metabolon. Metab Eng 13, 18-27. Mijakovic, I., Poncet, S., Galinier, A., Monedero, V., Fieulaine, S., Janin, J., Nessler, S., Marquez, J. A., Scheffzek, K., Hasenbein, S., Hengstenberg, W. & Deutscher, J. (2002). Pyrophosphate-producing protein dephosphorylation by HPr kinase/phosphorylase: a relic of early life? Proc Natl Acad Sci USA 99, 13442-13447. Miller, A., Wood, D., Ebright, R. H. & Rothman-Denes, L. B. (1997). RNA polymerase β' subunit: a target of DNA binding-independent activation. Science 275, 1655-1657. Miwa, Y., Nagura, K., Eguchi, S., Fukuda, H., Deutscher, J. & Fujita, Y. (1997). Catabolite repression of the Bacillus subtilis gnt operon exerted by two catabolite-responsive elements. Mol Microbiol 23, 1203-1213. Miwa, Y., Nakata, A., Ogiwara, A., Yamamoto, M. & Fujita, Y. (2000). Evaluation and characterization of catabolite-responsive elements (cre) of Bacillus subtilis. Nucleic Acids Res 28, 1206-1210. 88 REFERENCES Miwa, Y., Saikawa, M. & Fujita, Y. (1994). Possible function and some properties of the CcpA protein of Bacillus subtilis. Microbiology 140, 2567-2575. Molle, V., Nakaura, Y., Shivers, R. P., Yamaguchi, H., Losick, R., Fujita, Y. & Sonenshein, A. L. (2003). Additional targets of the Bacillus subtilis global regulator CodY identified by chromatin immunoprecipitation and genome-wide transcript analysis. J Bacteriol 185, 1911-1922. Moreno, M., Schneider, B., Maile, R., Weyler, W. & Saier, M., Jr. (2001). Catabolite repression mediated by the CcpA protein in Bacillus subtilis: novel modes of regulation revealed by wholegenome analyses. Mol Microbiol 39, 1366-1381. Mullis, K., Faloona, F., Scharf, S., Saiki, R., Horn, G. & Erlich, H. (1986). Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harb Symp Quant Biol 51, 263-273. Nakano, M. M., Lin, A., Zuber, C. S., Newberry, K. J., Brennan, R. G. & Zuber, P. (2010). Promoter recognition by a complex of Spx and the C-terminal domain of the RNA polymerase α subunit. PLoS One 5, e8664. Nicholson, W. L., Park, Y.-K., Henkin, T. M., Won, M., Weickert, M. J., Gaskell, J. A. & Chambliss, G. H. (1987). Catabolite repression-resistant mutations of the Bacillus subtilis α-amylase promoter affect transcription levels and are in an operator-like sequence. J. Mol. Biol. 198, 609-618. Niu, W., Kim, Y., Tau, G., Heyduk, T. & Ebright, R. H. (1996). Transcription activation at class II CAP-dependent promoters: two interactions between CAP and RNA polymerase. Cell 87, 1123-1134. Old, W. M., Meyer-Arendt, K., Aveline-Wolf, L., Pierce, K. G., Mendoza, A., Sevinsky, J. R., Resing, K. A. & Ahn, N. G. (2005). Comparison of label-free methods for quantifying human proteins by shotgun proteomics. Mol Cell Proteomics 4, 1487-1502. Parche, S., Schmid, R. & Titgemeyer, F. (1999). The phosphotransferase system (PTS) of Streptomyces coelicolor identification and biochemical analysis of a histidine phosphocarrier protein HPr encoded by the gene ptsH. Eur J Biochem 265, 308-317. Parrott, M. B. & Barry, M. A. (2000). Metabolic biotinylation of recombinant proteins in mammalian cells and in mice. Mol Ther 1, 96-104. Poncet, S., Mijakovic, I., Nessler, S., Gueguen-Chaignon, V., Chaptal, V., Galinier, A., Boel, G., Maze, A. & Deutscher, J. (2004). HPr kinase/phosphorylase, a Walker motif A-containing bifunctional sensor enzyme controlling catabolite repression in Gram-positive bacteria. Biochim Biophys Acta 1697, 123-135. Postma, P. W., Lengeler, J. W. & Jacobson, G. R. (1993). Phosphoenolpyruvate:carbohydrate phosphotransferase systems of bacteria. Microbiol. Rev. 57, 543-504. Presecan-Siedel, E., Galinier, A., Longin, R., Deutscher, J., Danchin, A., Glaser, P. & MartinVerstraete, I. (1999). Catabolite regulation of the pta gene as part of carbon flow pathways in Bacillus subtilis. J. Bacteriol. 181, 6889-6897. Reizer, J., Bachem, S., Reizer, A., Arnaud, M., Saier, M. H., Jr. & Stülke, J. (1999). Novel phosphotransferase system genes revealed by genome analysis - the complete complement of PTS proteins encoded within the genome of Bacillus subtilis. Microbiology 145, 3419-3429. REFERENCES 89 Reizer, J., Bergstedt, U., Galinier, A., Küster, E., Saier, M. H., Jr., Hillen, W., Steinmetz, M. & Deutscher, J. (1996). Catabolite repression resistance of gnt operon expression in Bacillus subtilis conferred by mutation of His-15, the site of phosphoenolpyruvate-dependent phosphorylation of the phosphocarrier protein HPr. J Bacteriol 178, 5480-5486. Reizer, J., Hoischen, C., Titgemeyer, F., Rivolta, C., Rabus, R., Stülke, J., Karamata, D., Saier, M. H., Jr. & Hillen, W. (1998). A novel protein kinase that controls carbon catabolite repression in bacteria. Mol Microbiol 27, 1157-1169. Renna, M. C., Najimudin, N., Winik, L. R. & Zahler, S. A. (1993). Regulation of the Bacillus subtilis alsS, alsD, and alsR genes involved in post-exponential-phase production of acetoin. J Bacteriol 175, 3863-3875. Rojo, F. (2010). Carbon catabolite repression in Pseudomonas: optimizing metabolic versatility and interactions with the environment. FEMS Microbiol Rev 34, 658-684. Rual, J. F., Venkatesan, K., Hao, T., Hirozane-Kishikawa, T., Dricot, A., Li, N., Berriz, G. F., Gibbons, F. D., Dreze, M., Ayivi-Guedehoussou, N., Klitgord, N., Simon, C., Boxem, M., Milstein, S., Rosenberg, J., Goldberg, D. S., Zhang, L. V., Wong, S. L., Franklin, G., Li, S., Albala, J. S., Lim, J., Fraughton, C., Llamosas, E., Cevik, S., Bex, C., Lamesch, P., Sikorski, R. S., Vandenhaute, J., Zoghbi, H. Y., Smolyar, A., Bosak, S., Sequerra, R., Doucette-Stamm, L., Cusick, M. E., Hill, D. E., Roth, F. P. & Vidal, M. (2005). Towards a proteome-scale map of the human protein-protein interaction network. Nature 437, 1173-1178. Rygus, T. & Hillen, W. (1991). Inducible high-level expression of heterologous genes in Bacillus megaterium using the regulatory elements of the xylose-utilization operon. Appl. Microbiol. Biotechnol. 35, 594-599. Saier, M. H., Jr. (1989). Protein phosphorylation and allosteric control of inducer exclusion and catabolite repression by the bacterial phosphoenolpyruvate:sugar phosphotransferase system. Microbiol. Rev. 53, 109-120. Saier, M. H., Jr. & Reizer, J. (1994). The bacterial phosphotransferase system: new frontiers 30 years later. Mol Microbiol 13, 755-764. Saier, M. H., Jr. & Roseman, S. (1976). Sugar transport. The crr mutation: its effect on repression of enzyme synthesis. J Biol Chem 251, 6598-6605. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular cloning: a laboratory manual. Cold Spring Harbor, N. Y.: Cold Spring Harbor Laboratory Press. Sanger, F., Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with chain terminating inhibitors. Proc Natl Acad Sci USA 74, 5463-5467. Schägger, H. & von Jagow, G. (1987). Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal Biochem 166, 368379. Schatz, P. J. (1993). Use of peptide libraries to map the substrate specificity of a peptide-modifying enzyme: a 13 residue consensus peptide specifies biotinylation in Escherichia coli. Biotechnology (N Y) 11, 1138-1143. 90 REFERENCES Schmalisch, M. H., Bachem, S. & Stülke, J. (2003). Control of the Bacillus subtilis antiterminator protein GlcT by phosphorylation. Elucidation of the phosphorylation chain leading to inactivation of GlcT. J Biol Chem 278, 51108-51115. Schmidt, T. G. & Skerra, A. (2007). The Strep-tag system for one-step purification and high-affinity detection or capturing of proteins. Nat Protoc 2, 1528-1535. Schnetz, K., Stülke, J., Gertz, S., Krüger, S., Krieg, M., Hecker, M. & Rak, B. (1996). LicT, a Bacillus subtilis transcriptional antiterminator protein of the BglG family. Journal of Bacteriology 178, 1971-1979. Schumacher, M. A., Allen, G. S., Diel, M., Seidel, G., Hillen, W. & Brennan, R. G. (2004). Structural basis for allosteric control of the transcription regulator CcpA by the phosphoprotein HPrSer46-P. Cell 118, 731-741. Schumacher, M. A., Seidel, G., Hillen, W. & Brennan, R. G. (2006). Phosphoprotein Crh-Ser46-P displays altered binding to CcpA to effect carbon catabolite regulation. J Biol Chem 281, 6793-6800. Schumacher, M. A., Seidel, G., Hillen, W. & Brennan, R. G. (2007). Structural Mechanism for the Fine-tuning of CcpA Function by The Small Molecule Effectors Glucose 6-Phosphate and Fructose 1,6-Bisphosphate. J Mol Biol 368, 1042-1050. Schumacher, M. A., Sprehe, M., Bartholomae, M., Hillen, W. & Brennan, R. G. (2011). Structures of carbon catabolite protein A-(HPr-Ser46-P) bound to diverse catabolite response element sites reveal the basis for high-affinity binding to degenerate DNA operators. Nucleic Acids Res 39, 2931-2942. Seidel, G. (2005). Interactions and molecular function of the transcriptional regulator CcpA from Bacillus subtilis and B. megaterium. Lehrstuhl für Mikrobiologie, Doktorarbeit, Friedrich-Alexander Universität Erlangen-Nürnberg. Seidel, G., Diel, M., Fuchsbauer, N. & Hillen, W. (2005). Quantitative interdependence of coeffectors, CcpA and cre in carbon catabolite regulation of Bacillus subtilis. FEBS J 272, 2566-2577. Shah, I. M. & Wolf, R. E., Jr. (2004). Novel protein-protein interaction between Escherichia coli SoxS and the DNA binding determinant of the RNA polymerase α subunit: SoxS functions as a cosigma factor and redeploys RNA polymerase from UP-element-containing promoters to SoxSdependent promoters during oxidative stress. J Mol Biol 343, 513-532. Shin, B. S., Choi, S. K. & Park, S. H. (1999). Regulation of the Bacillus subtilis phosphotransacetylase gene. J Biochem (Tokyo) 126, 333-339. Shivers, R. P., Dineen, S. S. & Sonenshein, A. L. (2006). Positive regulation of Bacillus subtilis ackA by CodY and CcpA: establishing a potential hierarchy in carbon flow. Mol Microbiol 62, 811822. Singh, K. D., Schmalisch, M. H., Stülke, J. & Görke, B. (2008). Carbon catabolite repression in Bacillus subtilis: quantitative analysis of repression exerted by different carbon sources. J Bacteriol 190, 7275-7284. Slack, F. J., Serror, P., Joyce, E. & Sonenshein, A. L. (1995). A gene required for nutritional repression of the Bacillus subtilis dipeptide permease operon. Mol. Microbiol. 15, 689-702. REFERENCES 91 Sonenshein, A. L. (2005). CodY, a global regulator of stationary phase and virulence in Grampositive bacteria. Curr Opin Microbiol 8, 203-207. Sonenshein, A. L. (2007). Control of key metabolic intersections in Bacillus subtilis. Nat Rev Microbiol 5, 917-927. Spencer, V. A., Sun, J. M., Li, L. & Davie, J. R. (2003). Chromatin immunoprecipitation: a tool for studying histone acetylation and transcription factor binding. Methods 31, 67-75. Sprehe, M. (2007). Mechanismen der Katabolitenregulation in Bacilli. Lehrstuhl für Mikrobiologie, Doktorarbeit, Friedrich-Alexander Universität Erlangen-Nürnberg. Sprehe, M., Seidel, G., Diel, M. & Hillen, W. (2007). CcpA mutants with differential activities in Bacillus subtilis. J Mol Microbiol Biotechnol 12, 96-105. Steinmetz, M., Le Coq, D. & Aymerich, S. (1989). Induction of saccharolytic enzymes by sucrose in Bacillus subtilis: evidence for two partially interchangeable regulatory pathways. J Bacteriol 171, 1519-1523. Strauch, E. M. & Georgiou, G. (2007). A bacterial two-hybrid system based on the twin-arginine transporter pathway of E. coli. Protein Sci 16, 1001-1008. Stülke, J., Arnaud, M., Rapoport, G. & Martin-Verstraete, I. (1998). PRD - a protein domain involved in PTS-dependent induction and carbon catabolite repression of catabolic operons in bacteria. Mol Microbiol 28, 865-874. Stülke, J. & Hillen, W. (1999). Carbon catabolite repression in bacteria. Current Opinion in Microbiology 2, 195-201. Stülke, J. & Hillen, W. (2000). Regulation of carbon catabolism in Bacillus species. Annu Rev Microbiol 54, 849-880. Stülke, J., Martin-Verstraete, I., Zagorec, M., Rose, M., Klier, A. & Rapoport, G. (1997). Induction of the Bacillus subtilis ptsGHI operon by glucose is controlled by a novel antiterminator, GlcT. Mol Microbiol 25, 65-78. Szalewska-Palasz, A., Wegrzyn, A., Blaszczak, A., Taylor, K. & Wegrzyn, G. (1998). DnaAstimulated transcriptional activation of oriλ: Escherichia coli RNA polymerase β subunit as a transcriptional activator contact site. Proc Natl Acad Sci USA 95, 4241-4246. Tagami, H. & Aiba, H. (1998). A common role of CRP in transcription activation: CRP acts transiently to stimulate events leading to open complex formation at a diverse set of promoters. EMBO J 17, 1759-1767. Titgemeyer, F. & Hillen, W. (2002). Global control of sugar metabolism: a gram-positive solution. Antonie Van Leeuwenhoek 82, 59-71. Tobisch, S., Glaser, P., Krüger, S. & Hecker, M. (1997). Identification and characterization of a new β-glucoside utilization system in Bacillus subtilis. J. Bacteriol. 179, 496-506. Tobisch, S., Stülke, J. & Hecker, M. (1999a). Regulation of the lic operon of Bacillus subtilis and characterization of potential phosphorylation sites of the LicR regulator protein by site-directed mutagenesis. J Bacteriol 181, 4995-5003. 92 REFERENCES Tobisch, S., Zühlke, D., Bernhardt, J., Stülke, J. & Hecker, M. (1999b). Role of CcpA in regulation of the central pathways of carbon catabolism in Bacillus subtilis. J Bacteriol 181, 69967004. Tojo, S., Satomura, T., Morisaki, K., Deutscher, J., Hirooka, K. & Fujita, Y. (2005). Elaborate transcription regulation of the Bacillus subtilis ilv-leu operon involved in the biosynthesis of branchedchain amino acids through global regulators of CcpA, CodY and TnrA. Mol Microbiol 56, 1560-1573. Tortosa, P., Declerck, N., Dutartre, H., Lindner, C., Deutscher, J. & Le Coq, D. (2001). Sites of positive and negative regulation in the Bacillus subtilis antiterminators LicT and SacY. Mol Microbiol 41, 1381-1393. Turinsky, A. J., Grundy, F. J., Kim, J. H., Chambliss, G. H. & Henkin, T. M. (1998). Transcriptional activation of the Bacillus subtilis ackA gene requires sequences upstream of the promoter. J Bacteriol 180, 5961-5967. Turinsky, A. J., Moir-Blais, T. R., Grundy, F. J. & Henkin, T. M. (2000). Bacillus subtilis ccpA gene mutants specifically defective in activation of acetoin biosynthesis. J Bacteriol 182, 5611-5614. Ün, S. (2009). Charakterisierung von Peptiden für die Bindung essentieller Penicillin-bindender Proteine und die Variationen der Linkerlänge einzelkettiger TetR Varianten. Lehrstuhl für Mikrobiologie, Doktorarbeit, Friedrich-Alexander Universität Erlangen-Nürnberg. Warner, J. B. & Lolkema, J. S. (2003). CcpA-dependent carbon catabolite repression in bacteria. Microbiol Mol Biol Rev 67, 475-490. Weickert, M. J. & Adhya, S. (1992). A family of bacterial regulators homologous to Gal and Lac Repressors. J. Biol. Chem. 267, 15869-15874. Weickert, M. J. & Chambliss, G. H. (1990). Site-directed mutagenesis of a catabolite repression operator sequence in Bacillus subtilis. Proc. Natl. Acad. Sci. USA 87, 6238-6242. Yoshida, K., Kobayashi, K., Miwa, Y., Kang, C. M., Matsunaga, M., Yamaguchi, H., Tojo, S., Yamamoto, M., Nishi, R., Ogasawara, N., Nakayama, T. & Fujita, Y. (2001). Combined transcriptome and proteome analysis as a powerful approach to study genes under glucose repression in Bacillus subtilis. Nucleic Acids Res 29, 683-692. Yu, H., Braun, P., Yildirim, M. A., Lemmens, I., Venkatesan, K., Sahalie, J., HirozaneKishikawa, T., Gebreab, F., Li, N., Simonis, N., Hao, T., Rual, J. F., Dricot, A., Vazquez, A., Murray, R. R., Simon, C., Tardivo, L., Tam, S., Svrzikapa, N., Fan, C., de Smet, A. S., Motyl, A., Hudson, M. E., Park, J., Xin, X., Cusick, M. E., Moore, T., Boone, C., Snyder, M., Roth, F. P., Barabasi, A. L., Tavernier, J., Hill, D. E. & Vidal, M. (2008). High-quality binary protein interaction map of the yeast interactome network. Science 322, 104-110. Zeng, X., Galinier, A. & Saxild, H. H. (2000). Catabolite repression of dra-nupC-pdp operon expression in Bacillus subtilis. Microbiology 146, 2901-2908. PUBLICATIONS 93 8 Publications Wünsche A., Hammer E., Bartholomae M., Völker U., Burkovski A., Seidel G. & Hillen W. (2012). CcpA forms complexes with CodY and RpoA in Bacillus subtilis. FEBS J (in Press) Bertram R., Wünsche A., Sprehe M. & Hillen W. (2006). Regulated expression of HPrK/P does not affect carbon catabolite repression of the xyn operon and of rocG in Bacillus subtilis. FEMS Microbiol Lett., 259, 147-152. APPENDIX 94 9 Appendix 9.1 Proteins identified across all crosslinked and non-crosslinked samples of WH1012 grown with glucose The following Table A1 shows the data from MS analysis of crosslinked and non-crosslinked eluates of WH1012 grown with glucose. The MS analysis of the samples was performed in collaboration with Dr. Elke Hammer and Prof. Dr. Uwe Völker (Ernst-Moritz-Arndt-Universität Greifswald). Table A1: Proteins identified across all cross-linked samples with an enrichment ratio higher than 1.5fold and at least 6 spectra in one sample N14 Gene name Accession Number tufA metE srfAA fusA srfAB rpoC rpoB purB dhbF BSU01130 BSU13180 BSU03480 BSU01120 BSU03490 BSU01080 BSU01070 BSU06440 BSU31960 gapA dnaK gltA Bio View: Identified Proteins (625) elongation factor Tu methionine synthase surfactin synthetase / competence elongation factor G surfactin synthetase / competence RNA polymerase beta' subunit RNA polymerase beta subunit adenylsuccinate lyase involved in 2,3-dihydroxybenzoate biosynthesis BSU33940 Glyceraldehyde 3-phosphate dehydrogenase, NAD-dependent, glycolytic enzyme BSU25470 class I heat-shock protein (molecular chaperone) BSU18450 large subunit of glutamate synthase MW crosslink_1 N15 N14 no crosscrosslink_2 link_1 N15 N15 cR1 crossno link / no crosscrosscross- link_3 link_2 link 44 kDa 87 kDa 402 kDa 77 kDa 401 kDa 134 kDa 134 kDa 49 kDa 264 kDa 82 63 61 53 51 35 33 30 30 22 7 14 3 10 13 8 n.d. 3 78 64 59 59 52 34 35 26 28 24 4 11 3 19 13 8 n.d. 3 3.5 11.5 4.8 18.7 3.6 2.7 4.3 36 kDa 29 9 21 66 kDa 29 9 169 kDa 27 n.d. N14 N15 no crosscrosslink_4 link_3 N14 cR2 crossno link / no crosscrosslink_4 link 27 9 19 4 12 16 9 n.d. 9 63 44 29 36 46 24 19 23 17 24 8 18 2 8 11 11 n.d. 6 2.2 5.6 1.9 12.7 4.3 1.9 1.8 9.7 51 52 40 40 39 28 16 23 19 10 2.6 22 10 24 10 2.3 28 9 3.2 23 13 22 16 1.6 25 n.d. 17 n.d. 14 n.d. 2.4 APPENDIX 95 N14 Gene name Accession Number tsf gndA BSU16500 elongation factor Ts BSU23860 NADP-dependent phosphogluconate dehydrogenase BSU06480 phosphoribosylformylglycinamidine synthase BSU33900 enolase, glycolytic/ gluconeogenic enzyme, universally conserved protein BSU18000 trigger enzyme: aconitase and RNA binding protein BSU40100 alkyl hydroperoxide reductase (large subunit) / NADH dehydrogenase BSU06520 phosphoribosylaminoimidazole carboxamide formyltransferase BSU32670 synthesis of Fe-S-clusters BSU28290 ketol-acid reductoisomerase (2,3dihydroxy-3-methylbutanoate, 2acetolactate) BSU03510 surfactin synthetase / competence BSU35300 preprotein translocase subunit (ATPase) BSU29130 isocitrate dehydrogenase BSU00860 ATP-dependent Clp protease, ATPase subunit BSU04580 DEAD-box RNA helicase BSU22880 similar to ribosomal protein S1 BSU28220 ATP-dependent Clp protease ATP-binding subunit (class III heat-shock protein) BSU03360 putative metallochaperone BSU16630 translation initiation factor IF-2 BSU38960 unknown purL eno citB ahpF purH sufB ilvC srfAC secA icd clpC cshA ypfD clpX yciC infB yxjG Bio View: Identified Proteins (625) MW crosslink_1 N15 N14 no crosscrosslink_2 link_1 N15 N15 cR1 crossno link / no crosscrosscross- link_3 link_2 link 32 kDa 52 kDa 27 26 n.d. n.d. 30 29 n.d. n.d. 80 kDa 25 10 23 11 47 kDa 24 n.d. 19 99 kDa 23 n.d. 55 kDa 21 56 kDa N14 N15 no crosscrosslink_4 link_3 N14 cR2 crossno link / no crosscrosslink_4 link 20 21 n.d. n.d. 17 17 n.d. n.d. 22 14 18 11 1.6 n.d. 17 5 12 5 2.9 24 n.d. 20 n.d. 19 n.d. n.d. 21 n.d. 11 n.d. 8 n.d. 21 n.d. 22 n.d. 14 n.d. 12 n.d. 53 kDa 37 kDa 21 21 n.d. 2 21 23 n.d. n.d. 18 10 2 n.d. 15 8 n.d. 4 144 kDa 96 kDa 46 kDa 90 kDa 20 19 19 18 n.d. n.d. 4 n.d. 22 18 22 19 n.d. n.d. 6 n.d. 14 16 13 10 n.d. n.d. 6 n.d. 10 13 12 8 n.d. n.d. 7 n.d. 57 kDa 42 kDa 46 kDa 18 18 18 n.d. n.d. 5 19 16 17 n.d. 2 8 11 15 13 n.d. 2 8 7 16 12 n.d. 3 8 45 kDa 79 kDa 43 kDa 18 17 16 5 n.d. n.d. 21 20 19 4 n.d. n.d. 15 16 17 10 n.d. n.d. 16 16 15 10 n.d. n.d. 2.3 22.0 4.1 17.0 2.7 4.3 16.5 4.5 1.9 6.2 1.6 1.6 APPENDIX 96 N14 Gene name Accession Number aspS guaA mdh pgcA BSU27550 BSU06360 BSU29120 BSU09310 mtnK hbs metK glnA BSU13560 BSU22790 BSU30550 BSU17460 glyA tkt bdhA mtnA accC BSU36900 BSU17890 BSU06240 BSU13550 BSU24340 sufD gatA ileS guaB tig rnjA rpsC yceH pdhD BSU32700 BSU06680 BSU15430 BSU00090 BSU28230 BSU14530 BSU01220 BSU02940 BSU14610 ykpA BSU14430 crosslink_1 N15 N14 no crosscrosslink_2 link_1 N15 N15 cR1 crossno link / no crosscrosscross- link_3 link_2 link Bio View: Identified Proteins (625) MW aspartyl-tRNA synthetase GMP synthase (glutamine-hydrolysing) malate dehydrogenase alpha-phosphoglucomutase, required for UDP-glucose synthesis 5-methylthioribose kinase non-specific DNA-binding protein Hbsu S-adenosylmethionine synthetase trigger enzyme: glutamine synthetase and effector of TnrA and GlnR serine hydroxymethyltransferase transketolase acetoine/ butanediol dehydrogenase 5-methylthioribose-1-phosphate isomerase acetyl-CoA carboxylase (biotin carboxylase subunit) synthesis of Fe-S-clusters production of glutamyl-tRNA (Gln) isoleucyl-tRNA synthetase IMP dehydrogenase trigger factor (prolyl isomerase) RNase J1 ribosomal protein S3 similar to toxic anion resistance protein dihydrolipoamide dehydrogenase E3 subunit of both pyruvate dehydrogenase and 2-oxoglutarate dehydrogenase complexes similar to ABC transporter (ATP-binding protein) 66 kDa 58 kDa 34 kDa 65 kDa 16 16 16 16 n.d. n.d. 2 3 17 13 17 16 n.d. n.d. n.d. 5 45 kDa 10 kDa 44 kDa 50 kDa 16 16 16 15 4 3 5 n.d. 17 15 14 20 6 5 5 n.d. 45 kDa 72 kDa 37 kDa 39 kDa 49 kDa 15 15 15 15 15 n.d. n.d. n.d. n.d. 2 16 17 15 13 15 n.d. n.d. n.d. n.d. n.d. 48 kDa 53 kDa 105 kDa 53 kDa 47 kDa 62 kDa 24 kDa 42 kDa 50 kDa 15 15 14 14 14 14 14 14 14 2 3 n.d. n.d. n.d. n.d. 3 2 7 19 15 14 16 12 13 15 15 12 n.d. 3 n.d. n.d. n.d. 3 4 2 9 61 kDa 13 n.d. 13 n.d. 16.5 4.0 3.3 3.9 3.0 15.0 17.0 5.0 9.0 4.1 7.3 1.6 N14 N15 no crosscrosslink_4 link_3 N14 cR2 crossno link / no crosscrosslink_4 link 15 11 16 9 n.d. n.d. 2 n.d. 11 13 13 7 n.d. n.d. n.d. 2 17 17 10 10 2 7 6 n.d. 15 13 12 9 4 5 5 n.d. 12 11 11 10 12 n.d. n.d. n.d. n.d. n.d. 13 9 11 9 14 n.d. n.d. n.d. n.d. n.d. 8 12 10 10 10 12 14 13 12 3 5 n.d. n.d. n.d. n.d. 3 6 7 13 11 7 7 12 11 10 12 16 2 3 n.d. n.d. n.d. n.d. 3 5 6 9 n.d. 8 n.d. 14.5 8.0 5.3 2.5 2.0 4.2 2.9 4.0 2.3 2.2 APPENDIX 97 N14 Gene name Accession Number pdhA BSU14580 pyruvate dehydrogenase (E1 alpha subunit) BSU28630 phenylalanyl-tRNA synthetase (beta subunit) BSU29470 acetate kinase BSU06210 unknown BSU08760 sporulation-control gene BSU29140 citrate synthase BSU29220 malic enzyme BSU14590 pyruvate dehydrogenase (E1 beta subunit) BSU22620 histidinol-phosphate aminotransferase / tyrosine and phenylalanine aminotransferase BSU27850 quinolinate synthetase BSU32690 cysteine desulfurase BSU06180 phage shock protein A homolog BSU37120 fructose 1.6-bisphosphate aldolase. glycolytic/ gluconeogenic enzyme BSU35670 UTP-glucose-1-phosphate uridylyltransferase. general stress protein BSU02890 similar to tellurium resistance protein BSU28470 aspartokinase II (alpha and beta subunits) BSU06450 phosphoribosylaminoimidazole succinocarboxamide synthase BSU36810 ATP synthase (subunit beta) BSU16940 multifunctional protein involved in homologous recombination and DNA repair (LexA-autocleavage) BSU33910 phosphoglycerate mutase, glycolytic / gluconeogenic enzyme pheT ackA ydjI spo0M citZ ytsJ pdhB hisC nadA sufS pspA fbaA gtaB yceC lysC purC atpD recA pgm Bio View: Identified Proteins (625) MW crosslink_1 N15 N14 no crosscrosslink_2 link_1 N15 N15 cR1 crossno link / no crosscrosscross- link_3 link_2 link N14 N15 no crosscrosslink_4 link_3 N14 cR2 crossno link / no crosscrosslink_4 link 42 kDa 13 n.d. 12 n.d. 5 n.d. 7 n.d. 88 kDa 13 n.d. 14 n.d. 11 n.d. 9 n.d. 43 kDa 36 kDa 30 kDa 42 kDa 44 kDa 35 kDa 40 kDa 13 13 13 13 13 13 12 n.d. 2 2 n.d. n.d. 5 n.d. 13 12 13 15 13 17 12 n.d. n.d. 3 2 2 7 n.d. 15 9 9 8 8 11 10 n.d. n.d. n.d. 3 2 8 n.d. 12 9 8 9 4 11 10 2 n.d. 2 n.d. 2 6 n.d. 41 kDa 45 kDa 25 kDa 30 kDa 12 12 12 12 n.d. n.d. n.d. n.d. 10 15 13 10 n.d. n.d. n.d. n.d. 8 8 8 14 n.d. n.d. 2 4 6 8 8 11 n.d. n.d. n.d. n.d. 8.0 6.3 33 kDa 12 n.d. 14 n.d. 9 2 10 4 3.2 22 kDa 44 kDa 27 kDa 12 12 12 5 n.d. 2 11 12 13 5 2 n.d. 2.3 12.0 12.5 11 7 12 3 4 5 9 10 10 4 2 4 2.9 2.8 2.4 51 kDa 38 kDa 12 12 3 6 14 15 3 6 4.3 2.3 10 14 5 6 10 9 6 8 1.8 1.6 56 kDa 11 n.d. 12 n.d. 9 n.d. 11 n.d. 12.5 5.2 14.0 13.0 2.5 13.5 8.5 5.7 3.0 1.6 APPENDIX 98 N14 Gene name Accession Number hisS ppaC yxjH purF BSU27560 BSU40550 BSU38950 BSU06490 ptsI BSU13910 prsA BSU09950 lutB proS citG cysK BSU34040 BSU16570 BSU33040 BSU00730 cysS metS purA yjoB BSU00940 BSU00380 BSU40420 BSU12420 ykwC yyaF argG ftsH pnpA metI BSU13960 BSU40920 BSU29450 BSU00690 BSU16690 BSU11870 rpoA BSU01430 crosslink_1 N15 N14 no crosscrosslink_2 link_1 N15 N15 cR1 crossno link / no crosscrosscross- link_3 link_2 link Bio View: Identified Proteins (625) MW histidyl-tRNA synthetase inorganic pyrophosphatase unknown glutamine phosphoribosyldiphosphate amidotransferase Enzyme I, general (non sugar-specific) component of the PTS. Enzyme I transfers the phosphoryl group from phosphoenolpyruvate (PEP) to the phosphoryl carrier protein (PtsH |HPr) protein secretion (post-translocation molecular chaperone) lactate catabolic enzyme prolyl-tRNA synthetase fumarase trigger enzyme: cysteine synthetase A and control of CymR activity cysteine-tRNA synthetase methionyl-tRNA synthetase adenylosuccinate synthetase AAA family, ATPase activity , similar to cell-division protein FtsH putative beta-hydroxyacid dehydrogenase GTP-binding protein/ GTPase argininosuccinate synthase, reversible ATP-dependent metalloprotease polynucleotide phosphorylase, RNase O-succinylhomoserine lyase (L-cysteine, H2S, methanethiol, elimination) RNA polymerase alpha subunit 48 kDa 34 kDa 43 kDa 52 kDa 11 11 11 11 n.d. n.d. n.d. n.d. 13 10 14 7 n.d. n.d. n.d. n.d. 63 kDa 11 3 11 3 33 kDa 11 2 12 4 53 kDa 63 kDa 51 kDa 33 kDa 10 10 10 10 n.d. n.d. n.d. n.d. 13 8 8 10 54 kDa 76 kDa 48 kDa 49 kDa 10 10 10 10 n.d. n.d. n.d. n.d. 31 kDa 40 kDa 45 kDa 71 kDa 77 kDa 42 kDa 10 10 10 10 10 10 35 kDa 10 N14 N15 no crosscrosslink_4 link_3 N14 cR2 crossno link / no crosscrosslink_4 link 12 7 11 2 n.d. n.d. n.d. n.d. 11 6 10 4 n.d. n.d. n.d. n.d. 3.7 12 2 10 2 5.5 3.8 10 4 9 2 3.2 n.d. n.d. n.d. n.d. 8 8 6 9 n.d. n.d. n.d. n.d. 5 8 4 8 n.d. n.d. n.d. n.d. 8 9 10 7 n.d. n.d. n.d. n.d. 5 6 10 5 n.d. n.d. n.d. n.d. 4 4 8 4 n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. 4 9 8 11 11 12 11 n.d. n.d. n.d. n.d. n.d. 3 3.0 5 5 7 9 5 7 n.d. n.d. 2 3 2 3 9 4 7 10 7 6 n.d. n.d. n.d. n.d. n.d. 3 7.0 6.3 6.0 2.2 3 11 3 3.5 11 4 8 5 2.1 APPENDIX 99 N14 Gene name Accession Number rpsD pdxS BSU29660 ribosomal protein S4 BSU00110 pyridoxal-5'-phosphate synthase (synthase domain) BSU31750 putative nicotinate phosphoribosyltransferase BSU11690 hydroxyethylthiazole phosphate biosynthesis BSU22710 chorismate synthase BSU15910 beta-ketoacyl-acyl carrier protein reductase BSU18440 small subunit of glutamate synthase BSU25070 similar to peptidoglycan acetylation, 1-hydroxy-2-methyl-2-(E)-butenyl-4diphosphate synthase BSU28260 3-isopropylmalate dehydratase (large subunit) BSU30320 Leu-tRNA synthetase BSU16600 transcription termination factor BSU00510 phosphoribosylpyrophosphate synthetase, universally conserved protein BSU06420 phosphoribosylaminoimidazole carboxylase (ATP-dependent) BSU15590 sulfate adenylyltransferase BSU21870 dihydroxy-acid dehydratase (2,3dihydroxy-3-methylbutanoate, 2,3dihydroxy-3-methylpentanoate) BSU11720 enoyl-acyl carrier protein reductase BSU01030 ribosomal protein L1 BSU40090 alkyl hydroperoxide reductase (small subunit) pncB thiG aroF fabG gltB ispG leuC leuS nusA prs purE sat ilvD fabI rplA ahpC Bio View: Identified Proteins (625) MW crosslink_1 N15 N14 no crosscrosslink_2 link_1 N15 N15 cR1 crossno link / no crosscrosscross- link_3 link_2 link N14 N15 no crosscrosslink_4 link_3 N14 cR2 crossno link / no crosscrosslink_4 link 23 kDa 32 kDa 10 10 n.d. 5 7 9 2 3 8.5 2.4 5 11 3 5 5 11 2 6 2.0 2.0 56 kDa 10 n.d. 9 2 9.5 6 3 6 4 1.7 27 kDa 10 4 10 6 2.0 7 5 8 4 1.7 43 kDa 26 kDa 9 9 n.d. n.d. 11 6 n.d. n.d. 10 8 n.d. n.d. 10 5 n.d. n.d. 55 kDa 41 kDa 9 9 n.d. n.d. 14 10 n.d. n.d. 5 6 n.d. n.d. 5 9 n.d. n.d. 52 kDa 9 n.d. 10 n.d. 8 n.d. 8 n.d. 92 kDa 42 kDa 35 kDa 9 9 9 n.d. n.d. n.d. 10 12 10 n.d. n.d. n.d. 3 7 6 n.d. n.d. n.d. 3 7 6 n.d. n.d. n.d. 17 kDa 9 n.d. 10 n.d. 5 n.d. 6 n.d. 43 kDa 60 kDa 9 9 n.d. n.d. 10 8 n.d. n.d. 7 4 n.d. 2 4 3 n.d. n.d. 3.5 28 kDa 25 kDa 21 kDa 9 9 9 4 4 2 10 9 12 4 2 2 10 6 9 3 2 3 11 9 8 2 2 3 4.2 3.8 2.8 2.4 3.0 5.3 APPENDIX 100 N14 Gene name Accession Number ftsZ BSU15290 cell-division initiation protein (septum formation) BSU07350 similar to benzaldehyde dehydrogenase BSU32710 ABC transporter (ATP-binding protein), synthesis of Fe-S clusters BSU22360 asparagyl-tRNA synthetase BSU31980 2,3-dihydroxybenzoate-AMP ligase (enterobactin synthetase component E) BSU11540 oligoendopeptidase BSU32110 ferredoxin-NAD(P)+ oxidoreductase BSU24080 valine dehydrogenase, isoleucine dehydrogenase, L-leucine dehydrogenase BSU31350 glucose 6-phosphate isomerase, glycolytic / gluconeogenic enzyme BSU14770 similar to GTP-binding elongation factor BSU23850 glucose 6-phosphate dehydrogenase, pentose-phosphate pathway BSU01370 adenylate kinase BSU30230 lysine-8-amino-7-oxononanoate aminotransferase BSU13620 1,2,-dihydroxy-3-keto-5methylthiopentene dioxygenase BSU13590 2,3-diketo-5-methylthiopentyl-1-phosphate enolase, Rubisco-like protein BSU29180 pyruvate kinase, glycolytic enzyme BSU16100 succinyl-CoA synthetase (alpha subunit) BSU30540 asparagine synthase (glutaminehydrolysing) BSU36830 ATP synthase (subunit alpha) yfmT sufC asnS dhbE pepF yumC bcd pgi ylaG zwf adk bioA mtnD mtnW pyk sucD asnB atpA Bio View: Identified Proteins (625) MW crosslink_1 N15 N14 no crosscrosslink_2 link_1 N15 N15 cR1 crossno link / no crosscrosscross- link_3 link_2 link N14 N15 no crosscrosslink_4 link_3 N14 cR2 crossno link / no crosscrosslink_4 link 40 kDa 9 n.d. 10 2 9.5 7 4 5 2 2.0 53 kDa 29 kDa 9 9 2 n.d. 7 11 3 3 3.2 6.7 5 8 3 5 5 8 2 4 2.0 1.8 49 kDa 60 kDa 8 8 n.d. n.d. 8 8 n.d. n.d. 8 9 n.d. n.d. 5 11 n.d. n.d. 77 kDa 37 kDa 40 kDa 8 8 8 n.d. n.d. n.d. 8 12 9 n.d. n.d. n.d. 3 8 2 n.d. n.d. n.d. 2 7 4 n.d. n.d. n.d. 51 kDa 8 n.d. 10 n.d. 5 n.d. 4 n.d. 68 kDa 56 kDa 8 8 n.d. n.d. 9 9 n.d. n.d. 5 4 n.d. n.d. 6 5 n.d. n.d. 24 kDa 50 kDa 8 8 n.d. n.d. 7 8 n.d. n.d. 6 3 n.d. n.d. 7 5 n.d. n.d. 21 kDa 8 n.d. 8 n.d. 4 n.d. 5 n.d. 45 kDa 8 n.d. 9 n.d. 5 n.d. 4 n.d. 62 kDa 31 kDa 73 kDa 8 8 8 n.d. n.d. n.d. 6 9 9 n.d. n.d. n.d. 7 8 5 n.d. n.d. 3 5 7 7 n.d. n.d. 3 2.0 55 kDa 8 6 9 4 6 4 8 3 2.0 1.7 APPENDIX 101 N14 Gene name Accession Number cheV BSU14010 modulation of CheA activity in response to attractants BSU41010 glucose-inhibited division protein, tRNA uridine 5-carboxymethylaminomethyl modification enzyme BSU21770 threonine dehydratase BSU22370 aspartate transaminase BSU11240 carbamoyl-phosphate transferase-arginine subunit B) BSU25260 glycyl-tRNA synthetase (beta subunit) BSU28870 translation initiation factor IF-3 BSU37330 arginyl-tRNA synthetase, universally conserved protein BSU22600 3-phosphoshikimate 1carboxyvinyltransferase BSU16750 aspartate-semialdehyde dehydrogenase BSU31970 isochorismatase BSU38860 UDP glucose 4-epimerase BSU28440 succinate dehydrogenase (flavoprotein subunit) BSU32250 threonine synthase BSU31370 similar to NADH-dependent butanol dehydrogenase BSU01190 ribosomal protein L2 BSU02910 general stress protein, similar to tellurium resistance protein BSU32750 methionine ABC transporter (ATP-binding protein) BSU11190 N-acetyl-g-glutamyl-phosphate reductase gidA ilvA aspB carB glyS infC argS aroE asd dhbB galE sdhA thrC yugJ rplB yceE metN argC Bio View: Identified Proteins (625) MW crosslink_1 N15 N14 no crosscrosslink_2 link_1 N15 N15 cR1 crossno link / no crosscrosscross- link_3 link_2 link N14 N15 no crosscrosslink_4 link_3 N14 cR2 crossno link / no crosscrosslink_4 link 35 kDa 7 n.d. 7 n.d. 5 n.d. 4 n.d. 70 kDa 7 n.d. 8 n.d. 7 n.d. 3 n.d. 47 kDa 43 kDa 113 kDa 7 7 7 n.d. n.d. n.d. 7 10 6 n.d. n.d. n.d. 6 7 8 n.d. n.d. n.d. 7 6 6 n.d. n.d. n.d. 76 kDa 20 kDa 63 kDa 7 7 7 n.d. n.d. n.d. 4 7 6 n.d. n.d. n.d. 5 10 2 n.d. n.d. n.d. 4 11 2 n.d. n.d. n.d. 45 kDa 7 n.d. 8 n.d. 6 n.d. 5 n.d. 38 kDa 35 kDa 37 kDa 65 kDa 7 7 7 7 n.d. n.d. n.d. n.d. 8 8 7 8 n.d. n.d. n.d. n.d. 7 6 3 3 n.d. n.d. n.d. n.d. 6 6 4 6 n.d. n.d. n.d. n.d. 37 kDa 43 kDa 7 7 n.d. n.d. 8 8 n.d. n.d. 2 5 n.d. n.d. 2 5 n.d. n.d. 30 kDa 21 kDa 7 7 n.d. n.d. 6 6 n.d. n.d. 6 4 n.d. n.d. 6 7 n.d. 2 38 kDa 7 n.d. 8 2 7.5 3 n.d. 2 n.d. 38 kDa 7 n.d. 7 3 4.7 5 n.d. 5 n.d. 5.5 APPENDIX 102 N14 Gene name Accession Number rplL gatB pfkA salA lonA BSU01050 BSU06690 BSU29190 BSU01540 BSU28200 murB BSU15230 obg BSU27920 pyrC ykuQ BSU15500 BSU14180 cysC pyrF argJ bioB cysI dapG deoD dltA fabD BSU15600 BSU15550 BSU11200 BSU30200 BSU33430 BSU16760 BSU19630 BSU38500 BSU15900 fabL folE2 BSU08650 BSU03340 glmS BSU01780 ribA BSU23260 crosslink_1 N15 N14 no crosscrosslink_2 link_1 N15 N15 cR1 crossno link / no crosscrosscross- link_3 link_2 link Bio View: Identified Proteins (625) MW ribosomal protein L12 production of glutamyl-tRNA (Gln) phosphofructokinase, glycolytic enzyme negative regulator of scoC expression class III heat-shock ATP-dependent protease UDP-N-acetylenolpyruvoylglucosamine reductase GTP-binding protein involved in initiation of sporulation dihydroorotase similar to tetrahydrodipicolinate succinylase adenylyl-sulfate kinase orotidine 5'-phosphate decarboxylase N-acetylglutamate synthase biotin synthase sulfite reductase (NADPH2) aspartokinase I (alpha and beta subunits) purine nucleoside phosphorylase D-alanyl-D-alanine carrier protein ligase malonyl CoA-acyl carrier protein transacylase enoyl-acyl carrier protein reductase GTP cyclohydrolase IB, replaces FolE under conditions of zinc starvation glutamine-fructose-6-phosphate transaminase GTP cyclohydrolase II/ 3,4-dihydroxy-2butanone 4-phosphate synthase 13 kDa 53 kDa 34 kDa 39 kDa 87 kDa 7 7 7 7 6 2 n.d. 2 4 n.d. 6 9 6 4 6 2 2 2 n.d. n.d. 33 kDa 6 n.d. 7 48 kDa 6 n.d. 47 kDa 25 kDa 6 6 23 kDa 26 kDa 43 kDa 37 kDa 65 kDa 43 kDa 25 kDa 56 kDa 34 kDa 3.3 8.0 3.3 2.8 N14 N15 no crosscrosslink_4 link_3 N14 cR2 crossno link / no crosscrosslink_4 link 6 6 4 7 5 2 3 2 3 n.d. 5 6 4 6 3 2 3 2 5 n.d. n.d. 3 n.d. 4 n.d. 4 n.d. 5 n.d. 2 n.d. n.d. n.d. 7 7 n.d. n.d. 5 7 n.d. n.d. 5 4 n.d. n.d. 6 6 6 6 6 6 6 6 6 n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. 5 7 5 6 4 6 4 7 3 n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. 4 4 7 4 2 4 2 4 3 n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. 4 4 5 4 3 2 2 3 5 n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. 27 kDa 35 kDa 6 6 n.d. n.d. 6 6 n.d. n.d. 5 4 n.d. n.d. 3 4 n.d. n.d. 65 kDa 6 n.d. 4 n.d. 5 n.d. 4 n.d. 44 kDa 6 n.d. 5 n.d. 2 n.d. 2 n.d. 2.8 2.0 2.0 1.6 APPENDIX 103 N14 Gene name Accession Number uvrA yhfJ ykvY greA thrS trxA BSU35160 BSU10250 BSU13860 BSU27320 BSU28950 BSU28500 ptsH BSU13900 yqeY ytiA BSU25400 BSU30700 ywjH minD folD BSU37110 BSU27990 BSU24310 codY BSU16170 tpx dnaN BSU29490 BSU00020 yxxG gltX BSU39220 BSU00920 rnjB dhbC sodA BSU16780 BSU31990 BSU25020 crosslink_1 N15 N14 no crosscrosslink_2 link_1 N15 N15 cR1 crossno link / no crosscrosscross- link_3 link_2 link N14 N15 no crosscrosslink_4 link_3 N14 cR2 crossno link / no crosscrosslink_4 link Bio View: Identified Proteins (625) MW excinuclease ABC (subunit A) similar to lipoate-protein ligase similar to Xaa-Pro dipeptidase transcription elongation factor threonyl-tRNA synthetase (major) antioxidative action by facilitating the reduction of other proteins by cysteine thiol-disulfide exchange HPr, General component of the sugar phosphotransferase system (PTS). unknown general stress protein, binds in the stationary phase to the ribosome, replaces RpmE under conditions of zinc limitation transaldolase cell-division inhibitor (septum placement) methylenetetrahydrofolate dehydrogenase (NADP) regulation of a large region in response to branched-chain amino acid limitation probable thiol peroxidase DNA polymerase III (beta subunit), beta clamp unknown glutamyl-tRNA synthetase, universally conserved protein RNase J2 isochorismate synthase superoxide dismutase, general stress protein 106 kDa 38 kDa 40 kDa 17 kDa 74 kDa 11 kDa 6 6 6 6 6 6 n.d. n.d. n.d. n.d. n.d. n.d. 5 5 6 6 6 7 n.d. n.d. n.d. n.d. n.d. n.d. 6 3 5 4 7 7 n.d. n.d. n.d. n.d. n.d. n.d. 2 3 4 3 5 7 n.d. n.d. n.d. n.d. n.d. n.d. 9 kDa 6 n.d. 4 n.d. 4 n.d. 3 n.d. 17 kDa 10 kDa 6 6 n.d. n.d. 7 7 n.d. n.d. 2 4 n.d. n.d. 3 4 n.d. n.d. 23 kDa 29 kDa 31 kDa 6 6 6 n.d. n.d. n.d. 5 5 5 n.d. n.d. n.d. 5 4 4 n.d. 2 2 7 5 3 n.d. n.d. 2 29 kDa 6 n.d. 4 n.d. 3 n.d. 3 n.d. 18 kDa 42 kDa 6 6 n.d. 2 7 6 2 2 6.5 3.0 5 4 n.d. 2 4 5 2 n.d. 4.5 4.5 16 kDa 56 kDa 6 5 2 n.d. 6 9 n.d. n.d. 6.0 6 3 2 n.d. 5 4 2 n.d. 2.8 61 kDa 43 kDa 22 kDa 5 5 5 n.d. n.d. n.d. 9 8 7 n.d. n.d. n.d. 8 3 3 n.d. n.d. n.d. 6 3 4 n.d. n.d. n.d. 4.5 1.8 APPENDIX 104 N14 Gene name Accession Number gyrA murE BSU00070 DNA-Gyrase (subunit A) BSU15180 UDP-N-acetylmuramoyl-L-alanyl-Dglutamyl-meso-2,6-diaminopimelate synthetase BSU35310 general stress protein, similar to Sigma-54 (SigL) modulating factor of gram-negative bacteria BSU33400 glyoxal reductase, general stress protein BSU29560 similar to acetate-CoA ligase BSU01770 phosphoglucosamine mutase, required for cell wall synthesis BSU34030 lactate catabolic enzyme BSU18550 similar to xylulokinase BSU20800 unknown BSU16520 ribosome recycling factor BSU00120 pyridoxal-5'-phosphate synthase (glutaminase domain) BSU26230 unknown BSU01420 ribosomal protein S11 BSU01150 ribosomal protein S10 BSU00820 lysyl-tRNA synthetase BSU15980 signal recognition particle (SRP) component BSU22960 trigger enzyme: glutamate dehydrogenase (cryptic in 168 and derivatives) BSU21600 similar to delta-endotoxin BSU35360 flagellin protein BSU32000 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase BSU11650 thiaminase II yvyD yvgN ytcI glmM lutC yoaC yopQ frr pdxT yqaP rpsK rpsJ lysS ffh gudB yokG hag dhbA tenA Bio View: Identified Proteins (625) MW crosslink_1 N15 N14 no crosscrosslink_2 link_1 N15 N15 cR1 crossno link / no crosscrosscross- link_3 link_2 link N14 N15 no crosscrosslink_4 link_3 N14 cR2 crossno link / no crosscrosslink_4 link 92 kDa 54 kDa 5 5 n.d. n.d. 7 7 n.d. n.d. 3 5 n.d. n.d. 5 4 n.d. n.d. 22 kDa 5 n.d. 6 n.d. 6 n.d. 3 n.d. 32 kDa 59 kDa 48 kDa 5 5 5 n.d. n.d. n.d. 6 6 6 n.d. n.d. n.d. 3 5 3 n.d. n.d. n.d. 2 2 2 n.d. n.d. n.d. 26 kDa 54 kDa 54 kDa 21 kDa 21 kDa 5 5 5 5 5 n.d. n.d. n.d. n.d. n.d. 6 6 6 6 6 n.d. n.d. n.d. n.d. n.d. 6 4 3 4 3 n.d. n.d. n.d. n.d. n.d. 4 2 3 4 4 n.d. n.d. n.d. n.d. n.d. 35 kDa 14 kDa 12 kDa 58 kDa 50 kDa 5 5 5 4 4 n.d. n.d. n.d. n.d. n.d. 5 5 4 7 7 n.d. n.d. n.d. n.d. n.d. 6 6 6 4 4 n.d. n.d. 3 n.d. n.d. 6 5 5 4 3 n.d. n.d. n.d. n.d. n.d. 47 kDa 4 n.d. 7 n.d. 4 n.d. 2 n.d. 41 kDa 33 kDa 27 kDa 4 4 4 n.d. n.d. n.d. 6 6 6 n.d. n.d. n.d. 3 4 5 n.d. n.d. n.d. 2 5 3 n.d. n.d. n.d. 27 kDa 4 n.d. 6 n.d. 4 n.d. 6 n.d. 3.7 APPENDIX 105 N14 Gene name Accession Number Bio View: Identified Proteins (625) divIVA BSU15420 cell-division initiation protein (septum placement) spoVG BSU00490 negative effector of asymmetric septation at the onset of sporulation BSU02900 general stress protein, similar to tellurium yceD resistance protein BSU01440 ribosomal protein L17 rplQ BSU16160 two-component ATP-dependent protease, clpY ATPase subunit BSU11700 hydroxyethylthiazole phosphate thiF biosynthesis BSU13010 general stress protein ykgB BSU01040 ribosomal protein L10 rplJ MW: cR: n. d.: red highlighted: Molecular weight combined ratio not detected experimentally validated interaction partners MW crosslink_1 N15 N14 no crosscrosslink_2 link_1 N15 N15 cR1 crossno link / no crosscrosscross- link_3 link_2 link N14 N15 no crosscrosslink_4 link_3 N14 cR2 crossno link / no crosscrosslink_4 link 19 kDa 4 n.d. 5 n.d. 6 n.d. 6 n.d. 11 kDa 4 n.d. 5 n.d. 6 n.d. 5 n.d. 21 kDa 4 n.d. 4 n.d. 6 n.d. 3 n.d. 14 kDa 53 kDa 4 4 n.d. n.d. 4 6 n.d. 2 6 6 n.d. 2 3 5 n.d. 2 36 kDa 3 n.d. 7 n.d. 7 n.d. 6 n.d. 38 kDa 18 kDa 2 2 n.d. n.d. 5 6 n.d. n.d. 6 5 n.d. 3 4 2 n.d. n.d. 5.0 2.8 2.3
