Download Molecular characterization of dioxygenases from polycyclic aromatic

FEMS Microbiology Letters 223 (2003) 177^183
www.fems-microbiology.org
Molecular characterization of dioxygenases from polycyclic aromatic
hydrocarbon-degrading Mycobacterium spp.
a;b
Barbara Brezna
a
, Ashraf A. Khan
a;
, Carl E. Cerniglia
a
Division of Microbiology, National Center for Toxicological Research, U.S. Food and Drug Administration, Je¡erson, AR 72079, USA
b
Institute of Molecular Biology, Slovak Academy of Sciences, 845 51 Bratislava, Slovak Republic
Received 17 April 2003; accepted 17 April 2003
First published online 20 May 2003
Abstract
Polycyclic aromatic hydrocarbon (PAH)-degrading genes nidA and nidB that encode the K and L subunits of the aromatic ringhydroxylating dioxygenase have been cloned and sequenced from Mycobacterium vanbaalenii PYR-1 [Khan et al., Appl. Environ
Microbiol. 67 (2001) 3577^3585]. In this study, the presence of nidA and nidB in 12 other Mycobacterium or Rhodococcus strains was
investigated. Initially, all strains were screened for their ability to degrade PAHs by a spray plate method, and for the presence of the
dioxygenase Rieske center region by polymerase chain reaction (PCR). Only Mycobacterium sp. PAH 2.135 (RJGII-135), M. flavescens
PYR-GCK (ATCC 700033), M. gilvum BB1 (DSM 9487) and M. frederiksbergense FAn9T (DSM 44346), all previously known PAH
degraders, were positive in both tests. From the three positive strains, complete open reading frames of the nidA and nidB genes were
amplified by PCR, using primers designed according to the known nidA and nidB sequences from PYR-1, cloned in the pBAD/ThioTOPO vector and sequenced. The sequences showed s 98% identity with the M. vanbaalenii PYR-1 nidA and nidB genes. Southern
DNA^DNA hybridization using nidA and nidB probes from PYR-1 revealed that there is more than one copy of nidA and nidB genes in
the strains PYR-1, BB1, PYR-GCK and FAn9T. However, only one copy of each gene was observed in PAH2.135.
B 2003 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved.
Keywords : Polycyclic aromatic hydrocarbon degradation; Dioxygenase ; Mycobacterium ; DNA sequence ; Diversity
1. Introduction
Polycyclic aromatic hydrocarbons (PAHs) are ubiquitous environmental pollutants. Because of their human
and eco-toxicity, there is a considerable interest to determine the fate of these compounds in the environment and
to consider the possible use of microorganisms for remediation of polluted sites [1,2].
Bacterial degradation of PAHs under aerobic conditions
begins with oxidation of the aromatic ring, catalyzed by
dioxygenases [3]. In this reaction, both atoms of molecular
oxygen are incorporated into the PAH to form cis-dihydrodiol metabolites. Aromatic ring-hydroxylating dioxygenases are multicomponent enzyme systems consisting of an
* Corresponding author. Tel. : +1 (870) 543-7601;
Fax : +1 (870) 543-7307.
E-mail address : [email protected] (A.A. Khan).
electron transport chain and a terminal dioxygenase [4].
The terminal dioxygenase is composed of large (K) and
small (L) subunits [4,5]. The K subunit is the catalytic
component and contains two conserved regions : the
[Fe2 ^S2 ] Rieske center and the mononuclear iron binding
domain, which are involved in the consecutive electron
transfer to the dioxygen molecule [6]. Both K and L subunits are necessary for function and in determining the
substrate speci¢city of the dioxygenase [7]. Most information about metabolic pathways, enzymes, and genes involved in PAH degradation comes from studies on
Gram-negative bacteria [4,5,8,9]. Genetic analysis and biochemical mechanism data on PAH degradation by Grampositive bacteria, including Rhodococcus, Mycobacterium,
Nocardioides, and Terrabacter species, are less abundant
and have been mostly reported in the past three years [10^
16]. However, Gram-positive bacteria may play more important roles than Gram-negative isolates in environmental degradation of high molecular mass PAHs, especially
in degradation of the four-ring compound pyrene [17^20].
Mycobacterium vanbaalenii strain PYR-1 (isolated from
0378-1097 / 03 / $22.00 B 2003 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved.
doi:10.1016/S0378-1097(03)00328-8
FEMSLE 10997 16-6-03
178
Table 1
Bacterial strains and results of the assaysa
Strain
Isolation
Characteristics
Plate spraying testb PCRc
Southern
hybridizationd
Phe
Pyr
Rieskee
nidAf
nidBg
nidB
PAH degradation [17,21,22,36,37]
PAH degradation [20,38]
+
+
+
+
+
+
+
3
+
n
+
+
+
+
Polluted sediment, Indiana [18]
PAH degradation [18]
+
+
+
+
+
+
+
PAH degradation [19]
+
+
+
+
+
+
+
M. frederiksbergense FAn9T
(DSM 44346)
Rhodococcus sp. R-22 (ATCC 29671)
Former coal gasi¢cation site,
Germany [19]
Coal tar-contaminated soil,
Denmark [32]
Soil
PAH degradation [32]
+
+
+
+
+
+
+
3
3
3
n
n
3
n
M. vaccae JOB-5 (ATCC 29678)
Soil
3
3
3
n
n
3
n
Mycobacterium sp. 7E1B1W
(ATCC 29676)
R. rhodochrous 7E1C (ATCC 19067)
Soil
3
3
3
n
n
n
n
3
3
3
n
n
n
n
M. petroleophilum (ATCC 21497)
Drilling well
3
3
3
n
n
n
n
M. chlorophenolicum PCP-1
(ATCC 49826)
M. austroafricanum (ATCC 33464)
Paper industry-polluted sediment,
Finland
Soil, south Africa
Gaseous, long chain and cyclopara⁄nic
hydrocarbon degradation [39,40]
Gaseous, long chain, cyclopara⁄nic
and monoaromatic hydrocarbon
degradation [40^43]
Gaseous and long chain hydrocarbon
degradation [40,44]
Long chain and cyclopara⁄nic
hydrocarbon degradation [40]
n-Para⁄n utilization, production of
single cell protein [45]
Polychlorinated phenol degradation [46]
3
3
3
n
n
3
n
3
3
3
n
n
3
n
M. aurum (ATCC 23366)
Soil
Type strain, related to M. vanbaalenii
[26,34]
Type strain
3
3
3
n
n
3
n
FEMSLE 10997 16-6-03
a
Soil
+, positive result ; 3, negative result; n, not performed.
Plate spraying test: positive results in the case of Phe (phenanthrene) and Pyr (pyrene) mean formation of signi¢cant clearing in the PAH layer.
c
All primers are listed in Table 2.
d
Digoxigenin-labeled DNA probes were used.
e
Identical results obtained with primer mix P1.1.f, P.1.2.f, P2.1.f, P2.2.f [24] and primer pair DP1, DP2 [25]
f
Identical results for nidA and nidA1 primer pairs.
g
Identical results for nidB and nidB1 primer pairs.
b
B. Brezna et al. / FEMS Microbiology Letters 223 (2003) 177^183
nidA
Oil-contaminated sediment, Texas [17]
Coal gasi¢cation site soil, Illinois [20]
M. vanbaalenii PYR-1 (DSM 7251)
Mycobacterium sp. PAH 2.135
(RJGII-135)
M. £avescens PYR-GCK
(ATCC 700033)
M. gilvum BB1 (DSM 9487)
B. Brezna et al. / FEMS Microbiology Letters 223 (2003) 177^183
a petrogenic chemical-polluted site [17]) can mineralize pyrene, £uoranthene, naphthalene, anthracene, phenanthrene
and biphenyl, and in minor amounts also benzo[a]pyrene,
1-nitropyrene and 6-nitrochrysene [21,22]. Recently, genes
encoding K NidA polypeptide (nidA gene) and L NidB
polypeptide (nidB gene) of the terminal dioxygenase have
been cloned from M. vanbaalenii strain PYR-1, expressed
and sequenced in our laboratory [11]. They represent the
¢rst described sequences of these genes from the genus
Mycobacterium [11]. Except for the new results published
in the present study, the most similar enzyme known to
date is the phenanthrene dioxygenase from Nocardioides
sp. KP7, with the large subunit PhdA only 57% identical
to NidA [13]. The present research goal is to elucidate the
presence and diversity of nidA and nidB genes within the
genus Mycobacterium.
2. Materials and methods
2.1. Chemicals
Pyrene and phenanthrene were purchased from Chem
Service (Media, PA, USA). All of the PAHs and related
compounds were s 99% pure. Other chemicals were of
highest purity commercially available (Sigma, St. Louis,
MO, USA).
2.2. Bacterial strains, media and cultivation conditions
Mycobacterium and Rhodococcus strains used in this
study are listed in Table 1. For cloning purposes, Escherichia coli TOP101 competent cells and pBAD/Thio-TOPO
vector were used (pBAD/TOPO Thiofusion Expression
system, Invitrogen, Carlsbad, CA, USA). Middlebrook
medium from Remel (Lenexa, KS, USA) was used as a
cultivation medium for Mycobacterium and Rhodococcus
strains. A minimal basal salts medium with low level nutrients [17] was used as a base for PAH utilization experiments. To enhance growth, an amended variant of this
medium (sorbitol medium) was used as well, containing
9 g l31 sorbitol as a carbon source and 0.5 g l31 yeast
extract. To determine the PAH-degradative potential of
the studied strains, both minimal and sorbitol medium
agar plates were coated with phenanthrene or pyrene by
the spray plate technique [23], using acetone as a solvent.
Mycobacterium and Rhodococcus strains were cultivated
on these plates at 30‡C for 5 days, then kept sealed at
room temperature for at least a month. The formation
of clearing zones was evaluated. The same media and conditions were used to prepare 3-day-old biomass for DNA
isolation to avoid problems with £occulation and to maintain selection pressure for PAH degradation genes. For
cultivation of E. coli containing recombinant plasmids,
Luria^Bertani medium with 100 Wg ml31 ampicillin was
used.
179
2.3. Polymerase chain reaction (PCR)
Total DNA from the studied strains was puri¢ed with
the Qiagen genomic DNA extraction kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions. To detect Rieske centers, the conserved [Fe2 ^S2 ]
cluster binding region of terminal dioxygenases, a mixture
of degenerate primers P1.1.f, P.1.2.f, P2.1.f and P2.2.f [24]
and, independently, primer pair DP1 and DP2 published
in [25] were used (Table 2). The PCR reaction mix consisted of 50 mM KCl, 10 mM Tris^HCl pH 9, 0.1% Triton
X-100, 1.5 mM MgCl2 , 0.2 mM each dNTP, 0.025 U Wl31
Taq DNA polymerase (Qiagen), 1.5 WM primers and 0.01
Wg template DNA per 20 Wl reaction mix. The initial hold
of 3 min at 95‡C was followed by 40 cycles of 1 min denaturation at 95‡C, 1 min annealing at 53‡C and 1 min
extension at 72‡C, followed by a ¢nal hold at 72‡C for
7 min.
Primers for the ampli¢cation of nidA and nidB genes
were designed from the published sequences of M. vanbaalenii PYR-1 nidA and nidB genes (GenBank accession
numbers AF249301, AF249302) [11]. Another set of primers (NidA1f, NidA1r, NidB1f and NidB1r) were used to
amplify the full length of nidA and nidB genes, which
aligned at the initiation codon and outside the open reading frame (ORF) (forward primer) and the termination
codon and outside the ORF (reverse primer) (Table 2).
These primer pairs were also used to detect the nidA and
nidB homologues in total genomic DNA extracts of strains
Mycobacterium sp. PAH 2.135 (RJGII-135), M. £avescens
PYR-GCK, M. gilvum BB1 and M. frederiksbergense
FAn9T, with M. vanbaalenii PYR-1 as a control. The concentration of the primers was 0.1 Wg. Other PCR reaction
components were present as described above. The PCR
was performed as follows : 3 min at 95‡C, 30 cycles of
30 s denaturation at 94‡C, 1 min annealing at 58‡C and
1 min extension at 72‡C, and 7 min ¢nal extension at
72‡C. For cloning of PCR products, the nidA and nidB
genes were PCR-ampli¢ed using NidA1f, NidA1r and
NidB1f, NidB1r primer pairs and the ProofStart DNA
polymerase (Qiagen) according to the manufacturer’s recommendations. The reaction conditions were the same as
for detection of nidA and nidB, but the extension step was
changed to 1 min 40 s when amplifying nidA.
2.4. Pulsed-¢eld gel electrophoresis (PFGE) and Southern
hybridization
Agarose plugs were used to avoid shearing of DNA and
to ensure the total genomic DNA was analyzed. Bacterial
cultures were grown on sorbitol medium coated with phenanthrene at 30‡C. After 72 h, a suspension of each culture with an adjusted turbidity of 0.69^0.73% in TE bu¡er
(10 mM Tris^HCl, 1 mM EDTA, pH 8.0) was made using
a turbidity meter (Dade Behring). 60 Wl of 10 mg ml31
lysozyme (Sigma) solution was added to 240 Wl of cell
FEMSLE 10997 16-6-03
180
B. Brezna et al. / FEMS Microbiology Letters 223 (2003) 177^183
suspension and incubated for 30 min at 37‡C. Subsequently, 10 Wl of 0.1 mg ml31 mutanolysin (Sigma) was
added. The next steps, including embedding the cells in the
agarose plugs, lysis, washing, XbaI restriction enzyme digestion and the separation of high molecular mass restriction fragments by PFGE, were performed as described
previously [26].
The DNA in the gels was ¢xed, denatured and neutralized according to the Genius system user’s guide for ¢lter
hybridization (Boehringer Mannheim, Indianapolis, IN,
USA). Afterwards, the DNA was transferred onto nylon
membranes by capillary action as described previously
[27]. The digoxigenin (DIG)-labeled probes for nidA and
nidB genes were prepared using NidAf, NidAr and NidBf,
NidBr primer pairs and DIG-PCR labeling reaction kit
(Roche Diagnostics Corporation, Indianapolis, IN, USA).
DNA UV crosslinking, Southern hybridization with DIGlabeled probes and detection were performed according to
the kit manufacturer’s instructions (Roche, DIG DNA
labeling and detection kit).
2.5. Cloning and DNA sequencing of the nidA and nidB
genes
The PCR-ampli¢ed products nidA and nidB were cloned
into pBAD/Thio-TOPO vector (Invitrogen) according to
the manufacturer’s recommendations. The resultant plasmids were isolated with the Qiagen plasmid miniprep kit.
The nucleotide sequences of the nidA and nidB genes were
determined with a model 377 DNA sequencer (Applied
Biosystems, Foster City, CA, USA). Both strands were
sequenced by primer walking with synthetic oligonucleotide primers (Table 2). DNA sequence analysis, translation, and alignment with other related genes and proteins
were done by using the computer program Lasergene
(DNASTAR, Madison, WI, USA).
2.6. DNA sequence analysis
DNA sequence analysis, translation, and alignment with
related genes and proteins were carried out using Lasergene (DNASTAR) and Align Plus (Scienti¢c Educational
Software, State Line, PA, USA) software. The GenBank
program Blast [28] was used to ¢nd similar genes and
proteins.
3. Results and discussion
3.1. Screening of PAH degradation by the spray plate
method
Thirteen Mycobacterium or Rhodococcus strains used in
this study were screened for PAH degradation by the
spray plate technique using pyrene and phenanthrene as
substrates (Table 1). Only those strains known from pre-
1 2 3 4 5 6
7 8 9 10 11 12 13 14 15
100 bp
PCR products
primer dimers
primers
Fig. 1. PCR detection of Rieske center in total genomic DNA extracts,
using the mix of primers P1.1.f, P.1.2.f, P2.1.r and P2.2.r [24]. The
DNA was separated in 3.5% agarose gel. Lanes 1, 15, DNA molecular
mass markers ; 2, M. vanbaalenii PYR-1; 3, Mycobacterium sp.
PAH2.135 ; 4, M. £avescens PYR-GCK; 5, M. gilvum BB1; 6, M. frederiksbergense FAn9T ; 7, Rhodococcus sp. R-22; 8, M. vaccae JOB-5;
9, M. album 7E1B1W; 10, R. rhodochrous 7E1C ; 11, M. petroleophilum;
12, M. chlorophenolicum PCP-1; 13, M. austroafricanum ; 14, M. aurum.
vious studies as PAH degraders, i.e. Mycobacterium sp.
PAH 2.135 (RJGII-135), M. £avescens PYR-GCK,
M. gilvum strain BB1, M. frederiksbergense FAn9T and
M. vanbaalenii PYR-1, showed clearing zones around colonies that had been sprayed with phenanthrene or pyrene
solutions. The remaining eight strains showed no clearance
zones (Table 1).
3.2. PCR ampli¢cation of the Rieske center
Mycobacterium and Rhodococcus strains were screened
for the presence of aromatic ring-hydroxylating dioxygenase by using degenerate PCR primers [24,25] designed
from the [Fe2 ^S2 ] binding region (Rieske center) which is
a conserved sequence of terminal dioxygenases (Table 2).
PCR products of the expected size (78 bp) were ampli¢ed
only in the known PAH-degrading bacteria. The rest of
the screened strains were negative for the PCR (Fig. 1,
Table 1). These results suggest that those strains, which
were positive by the spray plate method, possess terminal
dioxygenases.
3.3. PCR ampli¢cation, cloning and nucleotide sequencing
of nidA and nidB genes
The primers designed according to the known nidA and
nidB sequences from strain PYR-1 ampli¢ed complete
coding sequences of nidA and nidB genes from strains
PYR-GCK, BB1 and FAn9T (Fig. 2). These data suggest
that these three strains, although di¡erent species, have
highly conserved nidA and nidB sequences. However, in
strain PAH 2.135, which was positive by the spray plate
method and the Rieske center PCR method, the nidA gene
was not ampli¢ed (Table 1). This may be due to low homology with the PYR-1 nidA gene. The PCR-ampli¢ed
nidA and nidB genes from strains PYR-GCK, BB1 and
FAn9T were cloned into the pBAD/Thio-TOPO vector.
FEMSLE 10997 16-6-03
B. Brezna et al. / FEMS Microbiology Letters 223 (2003) 177^183
1
2
3
4
5
6
7 8 9 10
bp
2000
1500
1400
1000
750
500
300
Fig. 2. PCR detection of nidA and nidB genes in total genomic DNA
extracts. Lanes 1 and 10, DNA molecular mass markers; 2 and 6,
M. vanbaalenii PYR-1; 3 and 7, M. £avescens PYR-GCK; 4 and 8,
M. gilvum BB1; 5 and 9, M. frederiksbergense FAn9T. In lanes 2^5,
nidA was ampli¢ed with nidAf and nidAr primers; in lanes 6^9, nidB
was ampli¢ed with nidBf and nidBr primers.
Sequences of the cloned nidA and nidB genes were deposited in the GenBank/EMBL DNA database under accession numbers AF548343^AF548348.
The length of the ORF of the nidA gene for M. £avescens PYR-GCK was 1368 bp, the same as the previously
published nidA sequence for M. vanbaalenii PYR-1 [11].
However, in the case of M. frederiksbergense FAn9T and
M. gilvum BB1, the ORF of the nidA gene was 1377 bp,
encoding 458 amino acids. The deduced translated polypeptides of these genes showed di¡erences of three, six and
nine amino acid throughout the whole 458-amino acid
alignment for M. £avescens PYR-GCK, M. frederiksbergense FAn9T and M. gilvum BB1 respectively (Jotun^Hein
alignment, Lasergene software, DNASTAR). Thus, these
translated polypeptides are 99.3%, 98.6% and 98.0% identical to the NidA polypeptide from M. vanbaalenii, respectively. In the case of the NidB polypeptide, the identity
181
was 98.8%, 98.2% and 99.4%; or di¡erences of one, three
and two amino acid throughout the uniform protein size
of 169 amino acids. The Rieske center iron^sulfur binding
site [4], CXHRGX8 GNX5 CXZHG, was found to be conserved in all deduced NidA proteins. Also, two histidine
residues and one aspartate residue, which according to
Parales et al. [6] bind the mononuclear iron, as well as
one aspartate residue proposed to play an important role
in electron transfer to mononuclear iron [6] were conserved (alignment not shown). According to high sequence
similarity to M. vanbaalenii PYR-1 and preservation of
conserved residues, it can be concluded that nidA and
nidB are probably functional genes.
3.4. Screening for nidA and nidB genes in Mycobacterium
spp. by Southern hybridization
Strain Mycobacterium sp. PAH 2.135, which was not
PCR-ampli¢ed for the nidA gene but was able to produce
a clear zone by the spray method and was positive in the
Rieske center PCR test, was tested for the presence of
nidA and nidB genes by Southern hybridization. Four other PAH-degrading Mycobacterium strains, PYR-1, PYRGCK, BB1, FAn9T (positive control), and ¢ve strains that
did not degrade PAHs (negative control) were included for
Southern hybridization studies to con¢rm the previous
results (Table 1). Fig. 3 shows the comparison between
Southern blot patterns of XbaI-digested DNA blotted
with the nidA and nidB gene probes respectively (negative
controls listed in Table 1). One band from Mycobacterium
sp. PAH 2.135 (RJGII-135) hybridized at 48 kb with both
nidA and nidB probes (Fig. 3, lanes 1 and 6). These data
suggest that nidA and nidB genes are present in strain
PAH2.135. However, given the weak signal by Southern
hybridization (and the lack of nidA PCR product), their
sequence homology to PYR-1 may be lower as compared
to the other three Mycobacterium strains PYR-GCK, BB1
Table 2
PCR primer sequencesa
Primer
Sequence (5P to 3P)
Reference
Relative position
P1.1.f
P1.2.f
P2.1.r
P2.2.r
DP1
DP2
NidAf
NidAr
NidBf
NidBr
NidA1f
NidA1r
NidB1f
NidB1r
TGYCGSCAYCGNGGNA
TGYCGNCAYAGRGGNA
CCANCCRTGRTANGARCA
CCANCCRTGRTARCTRCA
TGYMGNCAYMGNGG
CCANCCRTGRTANSWRCA
ATGACCACCGAAACAACCGGAACAGC
TCAAGCACGCCCGCCGAATGCGGGAG
ATGAACGCGGTTGCGGTCGATCGGGA
CTACAGGACTACCGACAGGTTCTTGA
TCCAGAAAGGGTCCAACCATATG
GCCTGGGCAGAAGCTTCATCA
TGGTCGAGGAGTTCGGTGTGATG
GGTGGTGAACGGAGCTGGCCCTA
[24]
[24]
[24]
[24]
[25]
[25]
This
This
This
This
This
This
This
This
289^304b
289^304b
360^348b
360^348b
289^302b
360^348b
1^26b
1368^1343b
1^26c
510^485c
(319)^3b
1386^1366b
(319)^3c
530^508c
study
study
study
study
study
study
study
study
a
Degenerate nucleotides: N = G,A,T,C ; V = G,A,C; B = G,T,C; H = A,T,C ; D = G,A,T; K = G,T ; S = G,C; W = A,T; M = A,C ; Y = C,T ; R = A,G.
Position relative to nidA from M. vanbaalenii, GenBank accession number AF249301.
c
Position relative to nidB from M. vanbaalenii, GenBank accession number AF249302.
b
FEMSLE 10997 16-6-03
182
B. Brezna et al. / FEMS Microbiology Letters 223 (2003) 177^183
1 2
3
4
5
6
7
8
9 10
kb
194
145
97
48
23
nidA
nidB
9.4
Fig. 3. Southern hybridization of XbaI-digested PFGE-separated DNA
of PAH-degrading Mycobacterium spp. with DIG-labeled DNA probes.
Lanes 1^5 were blotted with nidA, lanes 6^10 with nidB. Samples are as
follows: lanes 1 and 6, Mycobacterium sp. PAH 2.135 (RJGII-135);
2 and 7, M. £avescens PYR-GCK; 3 and 8, M. gilvum BB1; 4 and 9,
M. vanbaalenii PYR-1; 5 and 10, M. frederiksbergense FAn9T.
and FAn9T. Probing of M. vanbaalenii PYR-1, M. £avescens PYR-GCK, M. gilvum BB1 and M. frederiksbergense
FAn9T with nidA and nidB probes revealed the presence
of multiple bands (Fig. 3). Restriction enzyme XbaI was
selected because both nidA and nidB genes from these
strains do not have XbaI restriction sites. These data suggest that M. vanbaalenii PYR-1, M. £avescens PYR-GCK,
M. gilvum BB1 and M. frederiksbergense FAn9T contain
more than one nidA and nidB gene in their genomes. We
are currently investigating whether essentially identical
copies or di¡erent homologous genes are present. Several
aromatic compound-degrading microorganisms are known
to possess di¡erent ring-hydroxylating dioxygenases within
the same strain [29,30].
This study showed that four Mycobacterium spp. (Mycobacterium sp. PAH 2.135, M. £avescens PYR-GCK,
M. gilvum BB1, M. frederiksbergense FAn9T and M. vanbaalenii PYR-1) possess nidA and nidB genes, although
they are phylogenetically distant species based on 16S
rDNA sequence comparisons [31^33]. On the other
hand, M. austroafricanum ATCC 33464 does not have a
nidA gene (Table 1), although it is almost identical to
M. vanbaalenii at the 16S rRNA sequence level [26,34].
Bogan et al. [35] reported no or very limited mineralization of phenanthrene, £uoranthene or pyrene by M. austroafricanum ATCC 33464. However, another M. austroafricanum strain, GTI-23, utilizes a wide range of PAHs
[35]. To the best of our knowledge, GTI-23 has not yet
been tested for the presence of the nid genes. Nevertheless,
a possible explanation for these observations is that the
Mycobacterium strains obtained the nid genes later in evolution, possibly by horizontal transfer. The high similarity
of the nidA and nidB genes sequenced in this study to each
other and to the genes in strain PYR-1 also favors this
hypothesis. Whatever the common origin of nidA and nidB
genes is, they are found at various geographical locations,
as documented by the sites of isolation of microorganisms,
USA, Germany and Denmark (Table 1). Truncated nidAlike sequences obtained by reverse transcription PCR from
soil were reported in GenBank by a British research group
(accession numbers AY032941, AY032938, AY032940,
AY032939, AY032942). Also, pdoA1 and pdoB1 sequences
recently submitted from France (accession numbers
MYC494745 and MYC494744) are 98% and 100% identical to M. vanbaalenii nidA and nidB at the translated protein level. The wide distribution of PAH-degrading genes
almost identical to the ones in M. vanbaalenii PYR-1 enhances the importance of previous studies performed on
this strain. The consideration of M. vanbaalenii PYR-1 as
a model strain among PAH-degrading mycobacteria is
supported in this way.
Acknowledgements
This work was supported by the Oak Ridge Institute for
Science and Education Postgraduate and Faculty Research Program at the National Center for Toxicological
Research, US/FDA Je¡erson, AR. We thank John B.
Sutherland, Robert D. Wagner and Robin Stingley for
critical review of the manuscript and Sandra Malone for
graphic assistance.
References
[1] Mumtaz, M.M., George, J.D., Gold, K.W., Cibulas, W. and DeRosa,
C.T. (1996) ATSDR evaluation of health e¡ects of chemicals. IV.
Polycyclic aromatic hydrocarbons (PAHs): understanding a complex
problem. Toxicol. Ind. Health 12, 742^971.
[2] Kalf, D.F., Crommentuijn, T. and van de Plassche, E.J. (1997) Environmental quality objectives for 10 polycyclic aromatic hydrocarbons (PAHs). Ecotoxicol. Environ. Saf. 36, 89^97.
[3] Mueller, J.G., Cerniglia, C.E. and Pritchard, P.H. (1996) In: Bioremediation: Principles and Applications (Crawford, R.L. and Crawford, D.L., Eds.), pp. 125^194. Cambridge University Press, Cambridge.
[4] Mason, J.R. and Cammack, R. (1992) The electron-transport proteins of hydroxylating bacterial dioxygenases. Annu. Rev. Microbiol.
46, 277^305.
[5] Kauppi, B., Lee, K., Carredano, E., Parales, R.E., Gibson, D.T.,
Eklund, H. and Ramaswamy, S. (1998) Structure of an aromaticring-hydroxylating dioxygenase-naphthalene 1,2-dioxygenase. Structure 6, 571^586.
[6] Parales, R.E., Parales, J.V. and Gibson, D.T. (1999) Aspartate 205 in
the catalytic domain of naphthalene dioxygenase is essential for activity. J. Bacteriol. 181, 1831^1837.
[7] Hurtubise, Y., Barriault, D. and Sylvestre, M. (1998) Involvement of
the terminal oxygenase beta subunit in the biphenyl dioxygenase reactivity pattern toward chlorobiphenyls. J. Bacteriol. 180, 5828^5835.
[8] Khan, A.A. and Walia, S.K. (1991) Expression, localization, and
functional analysis of polychlorinated biphenyl degradation genes
cbpABCD of Pseudomonas putida. Appl. Environ. Microbiol. 57,
1325^1332.
[9] Kim, E., Aversano, P.J., Romine, M.F., Schneider, R.P. and Zylstra,
FEMSLE 10997 16-6-03
B. Brezna et al. / FEMS Microbiology Letters 223 (2003) 177^183
[10]
[11]
[12]
[13]
[14]
[15]
[16]
[17]
[18]
[19]
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
G.J. (1996) Homology between genes for aromatic hydrocarbon degradation in surface and deep-subsurface Sphingomonas strains. Appl.
Environ. Microbiol. 62, 1467^1470.
Treadway, S.L., Yanagimachi, K.S., Lankenau, E., Lessard, P.A.,
Stephanopoulos, G. and Sinskey, A.J. (1999) Isolation and characterization of indene bioconversion genes from Rhodococcus strain I24.
Appl. Microbiol. Biotechnol. 51, 786^793.
Khan, A.A., Wang, R.F., Cao, W.W., Doerge, D.R., Wennerstrom,
D. and Cerniglia, C.E. (2001) Molecular cloning, nucleotide sequence, and expression of genes encoding a polycyclic aromatic
ring dioxygenase from Mycobacterium sp. strain PYR-1. Appl. Environ. Microbiol. 67, 3577^3585.
Wang, R.F., Wennerstrom, D., Cao, W.W., Khan, A.A. and Cerniglia, C.E. (2000) Cloning, expression, and characterization of the
katG gene, encoding catalase-peroxidase, from the polycyclic aromatic hydrocarbon-degrading bacterium Mycobacterium sp. strain
PYR-1. Appl. Environ. Microbiol. 66, 4300^4304.
Saito, A., Iwabuchi, T. and Harayama, S. (2000) A novel phenanthrene dioxygenase from Nocardioides sp. strain KP7 expression in
Escherichia coli. J. Bacteriol. 182, 2134^2141.
Kasuga, K., Habe, H., Chung, J.S., Yoshida, T., Nojiri, H., Yamane,
H. and Omori, T. (2001) Isolation and characterization of the genes
encoding a novel oxygenase component of angular dioxygenase from
the gram-positive dibenzofuran-degrader Terrabacter sp. strain
DBF63. Biochem. Biophys. Res. Commun. 283, 195^204.
Larkin, M.J., Allen, C.C., Kulakov, L.A. and Lipscomb, D.A. (1999)
Puri¢cation and characterization of a novel naphthalene dioxygenase
from Rhodococcus sp. strain NCIMB12038. J. Bacteriol. 181, 6200^
6204.
Andreoni, V., Bernasconi, S., Colombo, M., van Beilen, J.B. and
Cavalca, L. (2000) Detection of genes for alkane and naphthalene
catabolism in Rhodococcus sp. strain 1BN. Environ. Microbiol. 2,
572^577.
Heitkamp, M.A., Franklin, W. and Cerniglia, C.E. (1988) Microbial
metabolism of polycyclic aromatic hydrocarbons: isolation and characterization of a pyrene-degrading bacterium. Appl. Environ. Microbiol. 54, 2549^2555.
Dean-Ross, D. and Cerniglia, C.E. (1996) Degradation of pyrene by
Mycobacterium £avescens. Appl. Microbiol. Biotechnol. 46, 307^312.
Boldrin, B., Tiehm, A. and Fritzsche, C. (1993) Degradation of phenanthrene, £uorene, £uoranthene, and pyrene by a Mycobacterium sp.
Appl. Environ. Microbiol. 59, 1927^1930.
Grosser, R.J., Warshawsky, D. and Vestal, J.R. (1991) Indigenous
and enhanced mineralization of pyrene, benzo[a]pyrene, and carbazole in soils. Appl. Environ. Microbiol. 57, 3462^3469.
Heitkamp, M.A. and Cerniglia, C.E. (1988) Mineralization of polycyclic aromatic hydrocarbons by a bacterium isolated from sediment
below an oil ¢eld. Appl. Environ. Microbiol. 54, 1612^1614.
Moody, J.D., Doerge, D.R., Freeman, J.P. and Cerniglia, C.E. (2002)
Degradation of biphenyl by Mycobacterium sp. strain PYR-1. Appl.
Microbiol. Biotechnol. 58, 364^369.
Kiyohara, H., Nagao, K. and Yana, K. (1982) Rapid screen for
bacteria degrading water-insoluble, solid hydrocarbons on agar
plates. Appl. Environ. Microbiol. 43, 454^457.
Hamann, C., Hegemann, J. and Hildebrandt, A. (1999) Detection of
polycyclic aromatic hydrocarbon degradation genes in di¡erent soil
bacteria by polymerase chain reaction and DNA hybridization.
FEMS Microbiol. Lett. 173, 255^263.
Fleming, M.A., Kukor, J.J. and Haggblom, M. (2002) In: Abstracts :
American Society for Microbiology, 102nd General Meeting, p. 384,
Salt Lake City, UT.
Khan, A.A., Kim, S.-J., Paine, D.D. and Cerniglia, C.E. (2002) Classi¢cation of a polycyclic aromatic hydrocarbon-metabolizing bacterium, Mycobacterium sp. strain PYR-1, as Mycobacterium vanbaalenii
sp. nov. Int. J. Syst. Evol. Microbiol. 52, 1997^2002.
Khan, A.A. and Cerniglia, C.E. (1994) Detection of Pseudomonas
aeruginosa from clinical and environmental samples by ampli¢cation
[28]
[29]
[30]
[31]
[32]
[33]
[34]
[35]
[36]
[37]
[38]
[39]
[40]
[41]
[42]
[43]
[44]
[45]
[46]
183
of the exotoxin A gene using PCR. Appl. Environ. Microbiol. 60,
3739^3745.
Altschul, S.F., Madden, T.L., Scha¡er, A.A., Zhang, J., Zhang, Z.,
Miller, W. and Lipman, D.J. (1997) Gapped BLAST and PSIBLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389^3402.
Zylstra, G.J. and Kim, E. (1997) Aromatic hydrocarbon degradation
by Sphingomonas yanoikuiae B1. J. Ind. Microbiol. Biotechnol. 19,
408^414.
Kitagawa, W., Suzuki, A., Hoaki, T., Masai, E. and Fukuda, M.
(2001) Multiplicity of aromatic ring hydroxylation dioxygenase genes
in a strong PCB degrader, Rhodococcus sp. strain RHA1 demonstrated by denaturing gradient gel electrophoresis. Biosci. Biotechnol.
Biochem. 65, 1907^1911.
Wang, R.F., Cao, W.W. and Cerniglia, C.E. (1995) Phylogenetic
analysis of polycyclic aromatic hydrocarbon degrading mycobacteria
by 16S rRNA sequencing. FEMS Microbiol. Lett. 130, 75^80.
Willumsen, P., Karlson, U., Stackebrandt, E. and Kroppenstedt,
R.M. (2001) Mycobacterium frederiksbergense sp. nov., a novel polycyclic aromatic hydrocarbon-degrading Mycobacterium species. Int.
J. Syst. Evol. Microbiol. 51, 1715^1722.
Bastiaens, L., Springael, D., Wattiau, P., Harms, H., deWachter, R.,
Verachtert, H. and Diels, L. (2000) Isolation of adherent polycyclic
aromatic hydrocarbon (PAH)-degrading bacteria using PAH-sorbing
carriers. Appl. Environ. Microbiol. 66, 1834^1843.
Bottger, E.C., Kirschner, P., Springer, B. and Zumft, W. (1997) Mycobacteria degrading polycyclic aromatic hydrocarbons. Int. J. Syst.
Bacteriol. 47, 247.
Bogan, B.W., Lahner, L.M., Sullivan, W.R. and Paterek, J.R. (2003)
Degradation of straight-chain aliphatic and high-molecular-weight
polycyclic aromatic hydrocarbons by a strain of Mycobacterium austroafricanum. J. Appl. Microbiol. 94, 230^239.
Heitkamp, M.A. and Cerniglia, C.E. (1989) Polycyclic aromatic hydrocarbon degradation by a Mycobacterium sp. in microcosms containing sediment and water from a pristine ecosystem. Appl. Environ.
Microbiol. 55, 1968^1973.
Moody, J.D., Freeman, J.P., Doerge, D.R. and Cerniglia, C.E. (2001)
Degradation of phenanthrene and anthracene by cell suspensions of
Mycobacterium sp. strain PYR-1. Appl. Environ. Microbiol. 67,
1476^1483.
Schneider, J., Grosser, R., Jayasimhulu, K., Xue, W. and Warshawsky, D. (1996) Degradation of pyrene, benz[a]anthracene, and benzo[a]pyrene by Mycobacterium sp. strain RJGII-135, isolated from a
former coal gasi¢cation site. Appl. Environ. Microbiol. 62, 13^19.
Cerniglia, C.E., Blevins, W.T. and Perry, J.J. (1976) Microbial oxidation and assimilation of propylene. Appl. Environ. Microbiol. 32,
764^768.
Beam, H.W. and Perry, J.J. (1974) Microbial degradation of cyclopara⁄nic hydrocarbons via co-metabolism and commensalism.
J. Gen. Microbiol. 82, 163^169.
Vestal, J.R. and Perry, J.J. (1969) Divergent metabolic pathways for
propane and propionate utilization by a soil isolate. J. Bacteriol. 99,
216^221.
King, D.H. and Perry, J.J. (1975) The origin of fatty acids in the
hydrocarbon-utilizing microorganism Mycobacterium vaccae. Can. J.
Microbiol. 21, 85^89.
Burback, B.L. and Perry, J.J. (1993) Biodegradation and biotransformation of groundwater pollutant mixtures by Mycobacterium vaccae.
Appl. Environ. Microbiol. 59, 1025^1029.
Blevins, W.T. and Perry, J.J. (1972) Metabolism of propane, n-propylamine, and propionate by hydrocarbon-utilizing bacteria. J. Bacteriol. 112, 513^518.
Iizuka, H. et al. (1975) Method of recovering microbial cells containing protein. US Patent No. 3888736.
Apajalahti, J.H. and Salkinoja-Salonen, M.S. (1987) Dechlorination
and para-hydroxylation of polychlorinated phenols by Rhodococcus
chlorophenolicus. J. Bacteriol. 169, 675^681.
FEMSLE 10997 16-6-03