* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download RPS17 - Diamond Blackfan Anemia Foundation, Inc.
Gene expression programming wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Non-coding DNA wikipedia , lookup
Genetic engineering wikipedia , lookup
Metagenomics wikipedia , lookup
Frameshift mutation wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Neocentromere wikipedia , lookup
X-inactivation wikipedia , lookup
Genomic library wikipedia , lookup
Gene expression profiling wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Minimal genome wikipedia , lookup
Human genome wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Genomic imprinting wikipedia , lookup
Oncogenomics wikipedia , lookup
Quantitative trait locus wikipedia , lookup
Genome (book) wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Genome evolution wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Helitron (biology) wikipedia , lookup
Genome editing wikipedia , lookup
Point mutation wikipedia , lookup
History of genetic engineering wikipedia , lookup
Designer baby wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Genetics 101/Clinical Significance Camp Sunshine July 22, 2013 Diamond Blackfan Anemia Foundation Diamond Blackfan Anemia Canada THE FUNDAMENTALS • Humans have 46 chromosomes in each cell: 23 pairs. Sperm and egg cells have 23 chromosomes, 1 of each pair. • Genes are segments of DNA that tell your body what proteins to make. There are over 40,000 genes in a human cell: 20,000 on the chromosomes from your mother and a matching set of 20,000 on the chromosomes from your father. • Changes in the sequence of the DNA in a gene can alter the function of the protein, causing disease. HUMAN CHROMOSOMES THE FUNDAMENTALS • Humans have 46 chromosomes in each cell: 23 pairs. Sperm and egg cells have 23 chromosomes, 1 of each pair. • Genes are segments of DNA that tell your body what proteins to make. There are over 40,000 genes in a human cell: 20,000 on the chromosomes from your mother and a matching set of 20,000 on the chromosomes from your father. • Changes in the sequence of the DNA in a gene can alter the function of the protein, causing disease. GENETICS 101 GENETICS IN PEA PLANTS AND OTHER MODELS: YOU CAN MAKE THE MATINGS YOU WANT! Mendel’s tall pea plants and short pea plants make similar offspring: breed true GENETICS IN PEA PLANTS AND OTHER MODELS: YOU CAN MAKE THE MATINGS YOU WANT! Tall pea plants crossed to short pea plants make tall offspring GENETICS IN PEA PLANTS AND OTHER MODELS: YOU CAN MAKE THE MATINGS YOU WANT! Crossing the tall progeny of the original cross gives 3 tall plants to every 1 short plant. Mendel’s conclusions: The tall trait masks the short trait, but the short trait is present in the parents. The tall and short traits segregate independently of each other. THE FUNDAMENTALS • Humans have 46 chromosomes in each cell: 23 pairs. Sperm and egg cells have 23 chromosomes, 1 of each pair. (Peas have 7 pairs). • Genes are segments of DNA that tell your body what proteins to make. There are over 40,000 genes in a human cell: 20,000 on the chromosomes from your mother and a matching set of 20,000 on the chromosomes from your father. (Peas have 10s of thousands of genes too). • Changes in the sequence of the DNA in a gene can alter the function of the protein, causing disease. GENETICS IN PEA PLANTS AND OTHER MODELS: YOU CAN MAKE THE MATINGS YOU WANT! T/T T/T T/T T/T T/T T/T t/t t/t t/t t/t t/t t/t Mendel’s tall pea plants and short pea plants breed true because they are homozygous (2 copies) for the tall or short trait. GENETICS IN PEA PLANTS AND OTHER MODELS: YOU CAN MAKE THE MATINGS YOU WANT! T/t T/t T/T t/t T/t T/t T/t T/t Tall pea plants crossed to short pea plants makes heterozygous offspring. The heterozygous offspring are tall because tall is a dominant trait. GENETICS IN PEA PLANTS AND OTHER MODELS: YOU CAN MAKE THE MATINGS YOU WANT! T/t T/t T/T T/t T/t t/t Crossing the tall progeny of the original cross gives 3 tall plants to every 1 short plant ON AVERAGE. MENDEL’S CROSS: THEORY Plant 1- pollen T t T T/T T/t t T/t t/t Plant 2 – egg THE FUNDAMENTALS • Humans have 46 chromosomes in each cell: 23 pairs. Sperm and egg cells have 23 chromosomes, 1 of each pair. • Genes are segments of DNA that tell your body what proteins to make. There are over 40,000 genes in a human cell: 20,000 on the chromosomes from your mother and a matching set of 20,000 on the chromosomes from your father. • Changes in the sequence of the DNA in a gene can alter the function of the protein, causing disease. MENDEL’S CROSS: REALITY Plant 1- pollen T t T T / T T / t t T / t t / t Plant 2 – egg PATTERNS OF INHERITANCE Autosomal Dominant: Homozygous and Heterozygous individuals show the trait. Autosomal Recessive: Only Homozygous individuals show the trait. X-Linked: The trait is only seen in males. INHERITANCE OF A HUMAN TRAIT Attached ears INHERITANCE OF A HUMAN TRAIT 1. Non-attached ears does not breed true in this family Attached ears INHERITANCE OF A HUMAN TRAIT 1. Non-attached ears does not breed true in this family 2. Attached ears does not breed true in this family Attached ears INHERITANCE OF A HUMAN TRAIT 1. Non-attached ears does not breed true in this family 2. Attached ears does not breed true in this family 3. Attached ears can be inherited from one parent Attached ears INHERITANCE OF A HUMAN TRAIT 1. Non-attached ears does not breed true in this family 2. Attached ears does not breed true in this family 3. Attached ears can be inherited from one parent 4. A parent with attached ears can have nonattached children Attached ears Is Attached ears inherited as a Dominant or Recessive trait? THE FUNDAMENTALS • Humans have 46 chromosomes in each cell: 23 pairs. Sperm and egg cells have 23 chromosomes, 1 of each pair. • Genes are segments of DNA that tell your body what proteins to make. There are over 40,000 genes in a human cell: 20,000 on the chromosomes from your mother and a matching set of 20,000 on the chromosomes from your father. • Changes in the sequence of the DNA in a gene can alter the function of the protein, causing disease. INHERITANCE OF A HUMAN TRAIT A/a a/a a/a a/a A/a a/a a/a A/a a/a a/a Attached ears a/a a/a Dominant! DBA IS MORE COMPLICATED: AUTOSOMAL DOMINANT WITH INCOMPLETE PENETRANCE Willig T et al. Blood 1999;94:4294-4306 ©1999 by American Society of Hematology MUTATIONS Genes make RNA which is translated into proteins. Mutations are changes in the DNA that are inherited. Deletion: complete loss of a segment of DNA containing multiple gene or part of a gene. Point Mutation: A change in the DNA sequence the amino acid sequence of a protein. Indel: The addition or loss of a base into a sequence that alters the amino acid sequence of a protein. DIAMOND BLACKFAN ANEMIA MUTATIONS RPS19: Draptchinskaia et al. Nat Genet. 1999. 21: 169-175. RPS24: Gazda et al.. Am J Hum Genet. 2006. 79: 1110-1118. RPS17: Cmejla et al. Hum Mutation 2007. 28: 1178-1182. RPL35a: Farrar et al. Blood, 2008. 112: 1582-1592. RPL11/RPL5: Gazda et al. Am J Hum Genet, 2008. 83: 769-780. RPS10/26: Doherty et al. Am J Hum Genet, 2010. 86: 222-228. RPS19 RPL5 RPL11 RPS26 RPS24 RPL35a RPS10 RPS17 RPS7 others unknown Ribosome 28S rRNA Small Subunit 40S Large Subunit 60S 18S rRNA WHY IS IT IMPORTANT TO IDENIFY THE MUTATIONS IN THE REMAINING DBA PATIENTS? Improve clinical opportunities Stem cell transplant from matched sibling donor WITHOUT the mutation – incomplete penetrance Genotype/phenotype correlations Remission ~15% of patients Steroid responsiveness ~40% of patients THE IMPORTANCE OF GENOTYPING Willig T et al. Blood 1999;94:4294-4306 ©1999 by American Society of Hematology DIAMOND BLACKFAN ANEMIA MUTATIONS RPS19: Draptchinskaia et al. Nat Genet. 1999. 21: 169-175. RPS24: Gazda et al.. Am J Hum Genet. 2006. 79: 1110-1118. RPS17: Cmejla et al. Hum Mutation 2007. 28: 1178-1182. RPL35a: Farrar et al. Blood, 2008. 112: 1582-1592. RPL11/RPL5: Gazda et al. Am J Hum Genet, 2008. 83: 769-780. RPS10/26: Doherty et al. Am J Hum Genet, 2010. 86: 222-228. Hypothesis: Deletions and copy number variations cause DBA RPS19 RPL5 RPL11 RPS26 RPS24 RPL35a RPS10 RPS17 RPS7 others unknown THE FUNDAMENTALS • Humans have 46 chromosomes in each cell: 23 pairs. Sperm and egg cells have 23 chromosomes, 1 of each pair. • Genes are segments of DNA that tell your body what proteins to make. There are over 40,000 genes in a human cell: 20,000 on the chromosomes from your mother and a matching set of 20,000 on the chromosomes from your father. • Changes in the sequence of the DNA in a gene can alter the function of the protein, causing disease. HUMAN CHROMOSOMES HUMAN CHROMOSOMES SINGLE NUCLEOTIDE POLYMORPHISMS • 99.9% of the bases are identical in all people – but that leaves 3 MILLION bases that can be different between any two people • ~ 8 million validated human SNPs identified to date – Represent individual point mutations – 1 SNP per 500-1000 bp – Human genome may contain as many as 12 million SNPs – Over 200,000 SNPs may be present within genes • Provides a means to identify individual parts of a genome DETECTION TECHNOLOGY DETECTION TECHNOLOGY DECIPHERING THE DATA RPS19 DELETIONS DBA COPY NUMBER VARIANT DETECTION High resolution SNP array genotyping n=106 Deletions of known DBA genes (14 + 2 new genes) Variable, mosaic copy number loss of 3q (2), 13q, 15q (2), 19q North American DBA Registry ~10% of DBA patients have a deletion of a DBA gene Mosaic copy loss of 5q33 (RPS14) (2) RPS19 RPL5 RPL11 RPS26 RPS24 RPL35a RPS10 RPS17 RPS7 other unknown deletions DIAMOND BLACKFAN ANEMIA MUTATIONS RPS19 RPL5 RPL11 RPS26 ~30-35% of patients do not have a molecular diagnosis RPS24 RPL35a RPS10 RPS17 RPS7 other unknown deletions Hypothesis: Mutations in non-ribosomal genes cause DBA SELECTION OF PATIENTS FOR SEQUENCING Resequencing patients without mutations North American DBA Registry New patients (screened) negative SNP array analysis for Copy Number Variants negative Family 1 Family 2 Family 3 Informed consent for exome capture sequencing Family 4 WHOLE EXOME SEQUENCING 1 Enrich Sequence Biotinylated probes 29 x 106 bp (85% of coding sequence) Select Exome with Streptavidin beads Minimum requirements: >50 x 106 100 bp reads 30X coverage; 85% of exome Family 1: 112x106; 85X; 91.5% Family 2: 109x106; 79X; 91.2% Family 3: 108x106; 73X; 90.5% Family 4: 103x106; 82X; 90.8% Elute Exome for sequencing NIH Intramural Sequencing Center (NISC) WHOLE EXOME SEQUENCING 2 Align Filter Variants in Variants in 1000 Genomes ClinSeq ref. 1 2 3 4 5 6 7 8 9 … n MPG: CATGGTGTCTGTTTGAGGTTGCTA CATGGTGTCTGTTTGAGGTTGCTA CATGGTGTCTGTTTGAGGATGCTA CATGGTGTCTGTTTGAGGTTGCTA CATGGTGTCTGTTTGAGGATGCTA CATGGTGTCTGTTTGAGGATGCTA CATGGTGTCTGTTTGAGGATGCTA CATGGTGTCTGTTTGAGGTTGCTA CATGGTGTCTGTTTGAGGTTGCTA CATGGTGTCTGTTTGAGGATGCTA <100 variants per patient CATGGTGTCTGTTTGAGGTTGCTA CATGGTGTCTGTTTGAGGTTGCTA A 8-10,000 variants/patient NIH Intramural Sequencing Center (NISC) THE FUNDAMENTALS • Humans have 46 chromosomes in each cell: 23 pairs. Sperm and egg cells have 23 chromosomes, 1 of each pair. • Genes are segments of DNA that tell your body what proteins to make. There are over 40,000 genes in a human cell: 20,000 on the chromosomes from your mother and a matching set of 20,000 on the chromosomes from your father. • Changes in the sequence of the DNA in a gene can alter the function of the protein, causing disease. WHOLE EXOME SEQUENCING 3 VarSifter Analysis of inheritance Prioritize CDPred score Erythroid Gene (severity) expression function Functional Validation De novo X-linked Aut. Dom. Aut. Rec. ~5 candidate mutations/family Frequency Validation KNOCKDOWN OF RPL15 AND RPL31 INHIBITS RED CELL PRODUCTION IN VITRO RPL31 shRNA CD235 ∂ Relative mRNA Level ∂ ∂ RPL15 shRNA ∂ CD41 Luc shRNA RPL15 RPL31 Luc L15 L31 shRNA FINAL THOUGHTS Thanks to all of you who took the time and made the effort to be here. You are providing the most valuable contributions of all: Hope, Support and a Sense of Community. No DBA patient or family could feel alone in the presence of people like you. Any researcher would feel inspired by all of you.