* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Genetic Engineering Genetically
Cancer epigenetics wikipedia , lookup
Human genetic variation wikipedia , lookup
History of RNA biology wikipedia , lookup
Genetically modified organism containment and escape wikipedia , lookup
Public health genomics wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Gene expression profiling wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
DNA supercoil wikipedia , lookup
Epigenomics wikipedia , lookup
Non-coding RNA wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Epitranscriptome wikipedia , lookup
Gene therapy wikipedia , lookup
Genome evolution wikipedia , lookup
Molecular cloning wikipedia , lookup
DNA vaccination wikipedia , lookup
Genetic code wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Non-coding DNA wikipedia , lookup
Genetically modified crops wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Genome (book) wikipedia , lookup
Primary transcript wikipedia , lookup
Genome editing wikipedia , lookup
Point mutation wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Genetically modified food wikipedia , lookup
Designer baby wikipedia , lookup
Helitron (biology) wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Microevolution wikipedia , lookup
Genetic Engineering Genetically-modified animals… Bovine Growth Hormone (BGH) • Protein that increases milk production when injected How did scientists get bacteria to produce BGH? Goals: Be able to… • Describe the structure of DNA • Translate DNA into protein • Explain the process of gene expression • Historical source: Ground up cows • New source: Bacteria The structure of Deoxyribonucleic acid What do you know about DNA? Fig 2.13 1 The structure of DNA Nucleotide contains: Nitrogenous base Phosphate Each DNA subunit: nucleotide Sugar Fig 2.13 Fig 2.13 Nitrogenous bases Sugarphosphate backbone Fig 2.13 Fig 2.13 N-bases on one side base pair with partner on the other Fig 2.13 Fig 2.13 2 Why is it important for DNA to have matching base pairing? GENE: DNA sequence that encodes a protein DNA vs. RNA How do DNA instructions result in proteins? Gene expression!! U instead of T DNA Transcription RNA Translation Protein Fig 8.3 DNA nucleotide RNA nucleotide Functional differences… Fig 8.2 mRNA is transcribed from DNA Nucleotides Why is it important that RNA make proteins, not DNA itself? RNA polymerase Transcription: Creating RNA from DNA template mRNA = messenger RNA Fig 8.4 3 Gene expression Keratin DNA Transcription RNA Translation Protein Fig 8.3 Fibroin Lactase The genetic code translates between RNA language and protein language tRNA is the translator molecule Protein 3 mRNA nucleotides = codon = 1 amino acid RNA Fig 8.6 4 mRNA and tRNA meet in the Ribosome tRNA brings in amino acid that matches mRNA codon Ribosome assembles protein: Attaches amino acids in a string Fig 8.5 Fig 8.7 String of amino acids = protein Enzyme, etc… Real-time translation Fig 8.7 Gene mutations Æ different amino acid Æ different protein Genetic mutation: Altered DNA nucleotide Why could a genetic mutation lead to a nonfunctional protein? Fig 8.8 Cystic fibrosis movie Fig 8.8 5 What protein would this DNA sequence make? TACCCGGGGAAGAAATTCACT TACCCGGGGAAGAAATTCACT What protein would this DNA sequence make? AUG GGC CCC UUC UUU AAG UGA TACCCGGGGAAGAAATTCACT AUGGGCCCCUUCUUUAAGUGA mRNA met - gly - pro - phe - phe - lys - stop Which of the following plays a role first during gene expression? A DNA strand that has the nucleotides A C G A G would produce an RNA strand that read A. RNA polymerase A. T G C T C B. Ribosome B. A C G A G C. tRNA C. U G C U C D. mRNA transcript D. G T A G A 6 Bovine Growth Hormone (BGH) Goals: Be able to… • Define genetic engineering How did scientists get bacteria to produce BGH? • Describe the basic steps involved in genetic engineering • List some applications of genetic engineering • Explain how to engineer an animal • Explain how the Ti plasmid works • Support a position on genetic engineering using scientific arguments What would YOU do? 1. Isolate gene of interest Genetic engineering: Using technology to change genes in an organism 2. Put gene into vehicle 1. Isolate gene of interest 2. Put gene into “vehicle” 3. Vehicle puts new gene into organism 3. Vehicle puts new gene into organism Fig 8.12 1. Isolate gene of interest: Remove gene from cow chromosome Use biological scissors: restriction enzymes Fig 8.12 Restriction enzymes cut DNA only at specific sequences 7 2. Put gene into vehicle: Bacterial plasmid Use SAME restriction enzymes to cut plasmid Plasmid is recombinant: contains DNA from >1 source Sticky ends base pair rBGH Fig 8.12 Bacteria are promiscuous TRANSFORMATION 3. Vehicle puts gene into new organism: Bacteria uptakes plasmid Free DNA Bacteria are now transgenic Bacterial DNA Plasmid Fig 8.12 Bacteria produce large amounts of cheap rBGH Design your own multiple choice question about the process of genetic engineering. Test it on your friend. Farmers inject the protein into cows Fig 8.12 8 Human insulin produced in E. coli bacteria Is this genetically engineering humans? If not, what was engineered? How do you feel about genetically engineering bacteria? Socioeconomic Implications rBGH… Are farmers benefiting from using rBGH? Monsanto vs. Oakhurst Humans were not the first genetic engineers… Viruses inject their own genes Fig 10.1 Gene Therapy What is being genetically engineered here? Viral genes make new viruses Viruses inject non-mutant (normal) gene Fig 8.21 9 What are some reasons people want to genetically engineer foods? • More production (bigger) Genetically-engineered foods and crops http://www.colostate.edu/programs/lifesciences/TransgenicCrops/current.html What are some reasons people want to genetically engineer foods? What are some reasons people want to genetically engineer foods? • More production (bigger) • More production (bigger) • Healthier foods • Healthier foods • Herbicide-resistant plants Golden rice What are some reasons people want to genetically engineer foods? • Insect-resistant plants PHARM ANIMALS • More production (bigger) • Healthier foods • Herbicide-resistant plants • Insect-resistant plants • “Pharm”aceutical organisms Cystic fibrosis proteins Multiple sclerosis proteins 10 Creating completely transgenic animals… Insert genes into animal embryos, then transplant into surrogate mother. egg Inject genes Should we allow genetic engineering of humans in order to prevent incurable diseases? GM sheep Genetic engineering of humans? Plant genetic engineering Use a “gene gun” Engineering plants Fig 8.16 Ti (tumor-inducing) plasmid Genetic engineering by bacteria Ti plasmid of Agrobacterium tumefaciens food synthesis T-DNA: transferred to plant Plant hormones Fig 8.15 opbs.okstate.edu/ ~petracek/CHAPTER%2029 11 T-DNA on plasmid Ti plasmid Agrobacterium tumefaciens Agrobacterium Bacteria cuts T-DNA from its plasmid T-DNA inserted into plant chromosome Movie New gene Ti plasmid with new gene instead of T-DNA Recombine engineered Ti plasmid with Agrobacterium Why are plants able to read genetic instructions from bacteria? Agrobacterium infects plant and inserts new gene into plant chromosome Humans have been modifying organisms for thousands of years… What’s different now? 12 GM foods and human health Genetic engineering: What’s different from breeding? • Shorter time period than traditional breeding. • Exchange of genes between organisms that cannot mate in nature. What happens to the DNA that we eat? GM foods and human health GM crops and the environment DNA is not an allergen • Risks to nontarget organisms Some proteins are allergens GM crops and the environment GM crops and the environment • Risks to nontarget organisms Bacillus thuringiensis (Bt) makes toxic protein Bt gene engineered into corn so it produces toxic protein Fig 8.19 Problem: toxin kills ALL caterpillars 13 GM crops and the environment Round-up Ready plants are herbicideresistant • Risks to nontarget organisms • Evolution of resistant pests and weeds Encourages farmers to spray more herbicide Herbicide resistance can also spread in weeds GM crops and the environment • Risks to nontarget organisms • Evolution of resistant pests and weeds • Threats to native diversity Roundup-Ready canola Biological systems are more unpredictable than physical systems Escape and competition Human safety and human error. StarLink corn (Marvier and VanAcker 2005) 14 Do you think that genetically-engineered products should be labeled? Why or why not? How do genetic engineers get genes into bacteria? A. They shoot them with a gene gun. B. They inject the DNA into an egg nucleus. C. They cut open the bacteria using restriction enzymes. D. They incorporate genes into plasmids, which bacteria take up from their surroundings. Which of the following is a true statement? A. A farmer injects rBGH into cows. She is genetically engineering the cows. B. A doctor injects recombinant human insulin into a child. He is engineering the child. C. A doctor injects engineered viruses into a patient in order to modify her DNA. He is engineering the patient. E. Bacteria cannot be genetically engineered. Why does Agrobacterium tumefaciens engineer plants? A. To make the plant produce toxic Bt proteins. B. To make the plant produce food and a home for it. C. To make the plant produce rBGH. D. Agrobacterium does not engineer plants. Humans use its Ti plasmid. Which of the following is NOT a valid argument against genetic engineering? A. It is unnatural. B. Genes may escape into wild relatives. C. Proteins produced may have affects on nontarget organisms. D. Insect pests and weeds may become resistant due to overuse of engineered products. 15