* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Chapter 10 Protein Synthesis Test Study Guide THERE WILL BE 21
Transcription factor wikipedia , lookup
Genomic library wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Microevolution wikipedia , lookup
Expanded genetic code wikipedia , lookup
DNA polymerase wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Frameshift mutation wikipedia , lookup
RNA silencing wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
DNA vaccination wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
Molecular cloning wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Epigenomics wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
History of genetic engineering wikipedia , lookup
DNA supercoil wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Polyadenylation wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Non-coding DNA wikipedia , lookup
History of RNA biology wikipedia , lookup
Genetic code wikipedia , lookup
Point mutation wikipedia , lookup
Helitron (biology) wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Non-coding RNA wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
RNA-binding protein wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Messenger RNA wikipedia , lookup
Chapter 10 Protein Synthesis Test Study Guide THERE WILL BE 21 MULTIPLE CHOICE QUESTIONS ON THIS TEST. QUESTIONS 1-21 WILL BE FROM THIS STUDY GUIDE. 1. 2. 3. 4. 5. 6. What is the primary function of DNA? (p. 196) What is the relationship between a cell, DNA and protein? Explain. (p. 204) List the three types of RNA and their functions. (p. 205) List the four ways RNA differs from DNA. (p. 205) In RNA, the base adenine is complementary to the base ______________. (p. 205) How are DNA replication and transcription similar? Think about where each takes place, the enzymes involved and the end result. (Replication – p. 200, Transcription – p. 206) 7. What is transcription? (p. 206) 8. Where does transcription happen in the cell? (p. 206) 9. What is translation? (p. 208) 10. Where does translation happen in the cell? (p. 208) 11. During translation, mRNA must bind to a ______________ which is where proteins are assembled. (208) 12. Transcribe the following DNA sequence CCCGAGTAACAT. (p. 206) 13. Using pg. 207 in your textbook, determine the series of amino acids encoded for by the mRNA sequence CUCAAGUGCUUC. 14. Using pg. 207 in your textbook, determine the series of amino acids encoded for by the mRNA sequence AUGGACAAUUCG. 15. What would the sequence of DNA be from which the mRNA strand CUCAAGUGCUUC was made? 16. The original DNA sequence below undergoes the following change TACACACAAACGGGGTACACACAAACGGGT What effect would this mutation have on the organism? You must transcribe the mutated DNA into mRNA, then mRNA into protein to determine the effect on the organism. 17. Why is the mRNA code considered to be “universal” in all living things? (p. 207) 18. What are codons and on which type of RNA are they located? (p. 207) 19. What are anticodons and on which type of RNA are they located? (p. 208) 20. What would the anticodons be for the codons in the mRNA C U C A A G U G C U U C?