* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download DNA THIS ONE
Zinc finger nuclease wikipedia , lookup
Non-coding RNA wikipedia , lookup
Holliday junction wikipedia , lookup
Messenger RNA wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Expanded genetic code wikipedia , lookup
Human genome wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Genetic engineering wikipedia , lookup
Nutriepigenomics wikipedia , lookup
History of RNA biology wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
DNA profiling wikipedia , lookup
Designer baby wikipedia , lookup
Genomic library wikipedia , lookup
SNP genotyping wikipedia , lookup
Epitranscriptome wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Genetic code wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
DNA polymerase wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Microsatellite wikipedia , lookup
Microevolution wikipedia , lookup
Genealogical DNA test wikipedia , lookup
DNA nanotechnology wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
DNA vaccination wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Point mutation wikipedia , lookup
Molecular cloning wikipedia , lookup
Epigenomics wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Non-coding DNA wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
DNA supercoil wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
History of genetic engineering wikipedia , lookup
Primary transcript wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Helitron (biology) wikipedia , lookup
What is DNA? Is knowing about DNA important? Chapter 8 Questions DNA and Protein Synthesis Chapter 8 Reading requirements: pages 171 - 186 Problems (p.193 & 194): • • Date due •(Recalling) 3-7 •(Reviewing) 1,6,7,9,10 •(Expanding) 6-8 • • Focus on DNA… DNA… What is DNA? What does DNA do? What is DNA composed of? Where is DNA located? things you know about DNA what you think of when you hear the term, DNA ? things you want to know about DNA is it important to know about DNA? Why or why not? The macromolecule DNA Deoxyribonuleic acid It is made up of nucleotides (adenine, guanine, cytosine, and thymine) U.S. Department of Energy Human Genome Program, http://www.ornl.gov/hgmis. The parts of a nucleotide 1. nitrogenous base 2. deoxyribose sugar 3. phosphate group U.S. Department of Energy Human Genome Program, http://w ww.ornl.gov/hgmis. 1 Where is DNA? Focus on DNA… DNA… What is DNA? DNA is a nucleic acid. What does DNA do? DNA contains the instructions for making proteins. What is DNA composed of? Deoxyribose,, phosphate group, nitrogenous Deoxyribose base Where is DNA located? In the nucleus of each cell. Chromosome: Tightly wrapped DNA and protein structure found in our nucleus. Gene: A segment of DNA that determines our traits. What does DNA do? Stores the information for making proteins ______ 1). Discovered the process where genetic information form one bacteria was transferred to another (transformation). ______ 2). Determined genes were made of DNA. ______ 3). Determined the shape of DNA. ______ 4). Used radioactive isotopes to prove DNA controlled traits. Who Discovered DNA? Friedrich Miecher 1869 Isolated DNA from the pus of surgical bandages Discovering DNA (1) • • Worked with the bacteria that cause pneumonia Discovered transformation. -- Transformation Transformation:: Some molecule or group of molecules control the function of organisms. (2) • • Transformation/Griffith Griffith: (1928) Avery: (1944) Worked with bacteria Determined genes were made of DNA 2 Avery & Transformation Discovering DNA— DNA—cont. (3) • • • Discovering DNA-cont. Chargaff: Chargaff: (1950) Worked with the nucleotides of DNA samples Discovered the amount of A = T ; C = G (4) • Rosalind Franklin’ Franklin’s Picture of DNA Franklin: (1951) Worked with X-rays and DNA Produced an X-ray image of DNA Hershey and Chase (5) Hershey and Chase: (1952) Nucleic Acids •Worked with bacteriophages -- Bacteriophage Bacteriophage:: is a virus which infects bacteria •Proved genes were made of DNA not protein Two types: Deoxyribonucleic acids (DNA): contains the instructions for making proteins. (6) Watson and Crick: (1953) •Worked with Franklin’ Franklin’s X-rays of DNA to create the double helix model of DNA Nucleic Acids Large complex molecules made of nucleotide monomers. Nucleotides consist of three parts: a. Five carbon sugar (pentose) b. Phosphate group c. Nitrogenous base Figuring Out DNA Structure The amino acids of proteins are specified by unique sequences of nucleotides in DNA. Ribonucleic acids (RNA): carries out the instructions of DNA for making proteins Who? If you know the three parts that make up a DNA molecule (phosphate group, ribose sugar and a nitrogenous base), could you figure it out? Watson and Crick were able to determine the structure of DNA by building on other scientists’ scientists’ research. 3 DNA Components A DNA molecule is made up of three subunits: Watson-Crick Model of DNA A pentose sugar (deoxyribose (deoxyribose)) Phosphate group Nitrogenous base Between the strands: Nitrogenous bases of each strand are located very close to each other along the center of the double helix. Hydrogen bonds form between the following pairs: A-T Adenine (A) Guanine (G) Cytosine (C) Thymine (T) & C-G * these hydrogen bonds provide the force that holds the two strands together. life.nthu.edu.tw/~lslpc/ StrucBio/chapter7_1.html Watson-Crick Model of DNA The Strands: 2 strands Composed of 5 carbon sugars and phosphate groups (sugar-phosphate backbone) Double helix the sequence of nucleotides on one strand is matched perfectly to the complementary base sequence on the other strand. Nucleotide Pairings If you know the pairings A-T & C-G and I give you a single strand of DNA you should be able to figure out the other strand. 1. The following is part of a gene contained on a single strand of DNA. What is it’ it ’ s matching strand (complementary strand)?: A T T C A G C G T T A A G T C G C A 2. RNA and DNA are both types of Nucleic Acids. What are the 3 main differences between RNA and DNA? life.nthu.edu.tw/~lslpc/ StrucBio/chapter7_1.html 4 RNA and DNA Differences RNA DNA RNA: differs from DNA - Contains a ribose sugar, not deoxyribose - Has uracil (U) instead of thymine (T) - Single stranded What type of sugar is found in DNA nucleotides? library.thinkquest.org/.../ library.thinkquest.org /.../ R NA.htm Journey into DNA Interactive DNA Model DNA Anatomy (animated DNA) Structure of nucleic acids library.thinkquest.org/. ../o verview.html DNA Model Requirements Due on Wednesday, 11/9 Documentation: There must be a clear title identifying the model A key must accompany the model, which identifies every part of the model (each part of the nucleotide, each nitrogenous base, and the hydrogen bond) Identify a nucleotide, including the three parts to a nucleotide Identify the shape of your model Model Construction: Large and neat Creative use of color and materials The model follows the key and there is correct base pairing throughout the model The model is able to form a double helix (1) What will the mRNA code look like after the following strand of DNA is transcribed (changed into mRNA form)? DNA: The big picture DNA: The Big Picture TACGCGATATCGAATATT AU GCGCUAUAGCUUAUAA The Central Idea: Chromatin When a cell is not actively dividing, its nucleus contains chromatin,, a tangle of chromatin fibers composed of protein and DNA. Before cell division chromatin organizes itself into chromosomes chromosomes.. Chromosome: Tightly wrapped DNA and protein structure found in our nucleus Chromatin When the time comes for the cell to divide into two new cells, all the DNA is copied (replicated). Why? DNA is heritable. Each new cell receives a complete copy of all the genetic material in the "parent" cell. http://www.animalgenome.org/edu/doe/fig4.gif 5 One Gene Gene One protein How do genes code for proteins? Each DNA molecule is made up of many genes gen es-individual -individual segments of DNA that contain the instructions needed to direct the synthesis of a specific protein with a specific function. Each gene codes for ONE protein! • • • • • Protein— A chain of Protein— subunits called amino acids. There are 20 amino acids. The Genetic Code— Code— The sequence of nucleotides in a gene determines the sequence of amino acids in a protein. The sequence of amino acids determines function of the protein RNA: Ribonucleic Acid Ultimately, it is our proteins which determine our characteristics! DNA Quick Quiz Gene on DNA strand: TACATGCTAAAGTGCCATATT Transcription mRNA: AUGUACGAUUUCACGGUAUAA Translation Protein: Met-Tyr-Asp-Phe-Thr-Val-stop DNA CANNOT LEAVE THE NUCLEUS HOW CAN IT MAKE PROTEINS? It doesn’ doesn’t make them - it is the instructions. RNA (Ribonucleic Acid): is the principle molecule that carries out the instructions coded in DNA, DNA, primarily it makes proteins. RNA differs from DNA in three main ways: a) What are the 3 differences between DNA and RNA? RNA: Contains a ribose sugar, not deoxyribose Has uracil (U) instead of thymine (T) Single stranded b) Why is RNA necessary for the process of protein synthesis? DNA CANNOT LEAVE THE NUCLEUS! RNA carries the instructions coded in DNA to the cytoplasm (ribosome) where protein synthesis occurs. 2. In the Watson-Crick model of DNA, the two strands of the double helix are joined together by what type of bond? Hydrogen bond 3. What is a gene? gen genes es-individual -individual segments of DNA that contain the instructions needed to direct the synthesis of a specific protein with a specific function. DNA Replication 1. DNA Replication DNA Replication What is DNA Replication? The process of copying a cell’ cell’ s DNA. To replicate = to copy When would DNA need to be replicated? Any time a cell divides to form new cells. Genetic information must be passed to the new cells! Why is DNA Replication described as “Semiconservative Semiconservative”” ? Semiconservative= Semiconservative =each new DNA molecule contains one original strand and one new strand 6 What are the steps in DNA Replication? DNA Replication: (1) DNA double helix unwinds (2) Enzymes separate the 2 strands of DNA by breaking the hydrogen bonds (3) Free nucleotides link up to opposite nucleotides of each DNA strand (4) New hydrogen bonds form (5) 2 new DNA strands wind into double helix Applying DNA Replication Summary of DNA Replication: Each parent double-stranded DNA molecule is copied forming, two identical, doublestranded DNA molecules (daughter DNA molecules) Forms of RNA: 1). Messenger RNA (mRNA): Serves as a messenger from DNA to the rest of the cell and carries the instructions for the assembly of amino acids into polypeptides. 2). Ribosomal RNA (rRNA ): Part of the (rRNA): ribosome where proteins are assembled. 3). Transfer RNA (tRNA ): Transfers (tRNA): Amino acids to the ribosome and helps bind them. Steps of Transcription RNA polymerase binds to DNA at the promoter (start) site –unwinds and breaks the hydrogen bonds of the DNA RNA polymerase assembles free nucleotides into a new mRNA chain, using complementary base pairing As the new mRNA chain grows, RNA polymerase moves along the DNA The making of mRNA continues until the RNA polymerase reaches the terminator (stop) site RNA polymerase and new mRNA strand are released Codons Codon: The group of three nucleotides in mRNA that Codon: specifies an amino acid. Each codes for a specific AA. There are 20 total AA. Some codons are “synonymous synonymous”” (coding for the same AA). There are 64 possible codons codons,, shown on page 184 (when using the four possible nucleotides AUGC). There are three stop signals which signify the end of a genetic message on a mRNA strand. There is one codon that signals the start of the genetic message on the mRNA strand. Slooze Worm Activity The Language of mRNA: Only 4 letters: mRNA: is made of AUCG and is read in groups of three by the ribosome. Example: AAACCCCAU (mRNA Strand) If we break the strand into groups of three what do we get? AAA CCC CAU The Genetic Code UAA, UAG, UGA AUG What amino acid would the codon codon,, AGA,, code for? AGA What amino acid would the codon codon,, CAU,, code for? CAU UAA?? UAA Genetic code: Proteins are made of polypeptides: polypeptides are long chains of AA’ AA’s (there are 20 different amino acids). The order of amino acids determines the properties of the protein. DNA is the instructions for making proteins. Genetic disorders may be a result in poor instructions (DNA). If the instructions are wrong the protein will not work. 7 Steps of Translation (1) Ribosome binds to mRNA at the start codon codon,, AUG (2) tRNA delivers amino acid (AA) (3) tRNA continues to deliver the proper AA’ AA’ s as the ribosome moves along the mRNA (4) The ribosomes assemble the AA’ AA’s into a polypeptide chain (protein) (5) Translation finishes when a stop codon is reached. The ribosome and protein are released Figuring Out DNA Structure If you know the three parts that make up a DNA molecule (phosphate group, ribose sugar and a nitrogenous base), could you figure it out? The Major Players of Translation • • • • Ribosome mRNA--codon mRNA--codon tRNA-tRNA-Amino acids Watson and Crick were able to determine the structure of DNA by building on other scientists’ scientists’ research. RNA Problem The following strand of mRNA came from the transcription of DNA. Using the strand of RNA, break it into codons and determine the protein that will be formed. Nucleic Actual Acid Name mRNA AUAUUUAAACCAGGCGAGAUUCCCUAUGGGGUACGU AUA or AUU = I AAA or GGG or CCC = O GGC = E UUU or UAU = L CCA = V GAG = B GUA = G CGU = Y Shape Location Function in Cell During Protein Synthesis 1. The following section of DNA is the gene that caused the bacteria colonies to fluoresce (glow) in the transformation experiment: TACATGCGTACCGGGCATTATATT a) Transcribe the above strand of DNA into Messenger RNA (mRNA). DNA AUGUACGCAUGGCCCGUAAUAUAA mRNA tRNA Test Review: c) What amino acids will this mRNA code for? AUG UAC GCA UGG CCC GUA AUA UAA Methionine (start) (start)— —Tyrosine Tyrosine— — Alanine Alanine— —Tryptophan-Proline— Proline —Valine--Isoleucine--stop How many codons are in the above mRNA? AUG UAC GCA UGG CCC GUA AUA UAA Define the following terms: Nucleotide: T hree parts of a nucleotide: How they pair up, where they bond together and the type of bond that joins them: T ransformation: Griffith: A very: Hershey-Chase: W atson-Crick: DNA replication: List Three differences between DNA & RNA T ranscription: T hree types of RNA: Genetic Code: Codons:: Codons T ranslation: How do we produce proteins and why are these proteins important: W hat is a Polypeptide: How many AA’ AA ’ s are there: How can DNA code for the production of our traits if there are only four different nucleotides: If given a strand of DNA you should be able to: - Identify the other strand of DNA - Determine the mRNA - Determine the amino acids the mRNA will code for Problem: If you are given the following strand of DNA what is the other strand? What will the mRNA look like after transcription of the given strand? What amino acids will the mRNA code for and where does transcription and translation take place? What is the start codon and what is the stop codon codon?? DNA strand: T ACCCCGGCTTTACT Genes One gene one protein genes specify/code for the proteins that make up an organism and give it it’ it’s traits. What are genes made of? - segments of DNA that code for a specific trait. What are chromosomes? - compacted DNA (storage) Genetic disorders are a result of improper proteins. DNA- DNA RNARNA- Protein Protein gives us a trait 8 Genes Disease and Genetic Counseling What is Huntington’ Huntington’s Disease? How is it transmitted? What are the symptoms? Treatment options? What are the roles of genetic counselors? What do you think about the idea genetic counseling? What are the potential positive things that may result from this process? What are the potential negative results? How do genes actually determine the traits of an organism? Genes specify/code for the proteins that make up an organism and give it it’ it’s traits. What are genes made of? Gel Electro Gel Electro Why do Flies Glow Paternity test - segments of DNA that code for a specific trait. What are chromosomes? - compacted DNA (storage) Translation: nucleotides in mRNA are decoded into a sequence of amino acids forming a polypeptide. This occurs in the cytoplasm of the cell. In a nutshell: - RNA polymerase transcribes DNA, making mRNA (it moves out of the nucleus) - In the cytoplasm of the cell: Ribosome’ Ribosome’s read the codons in mRNA (the message is decoded). - tRNA molecules take the proper AA’ AA’s to the ribosomes ribosomes.. - The ribosomes assemble the AA’ AA’s into a proteins/polypeptide. mRNA, tRNA tRNA,, rRNA rRNA:: Are sections of RNA transcribed from DNA. * there is usually more than one ribosome translating mRNA at a time. Why? 9 Human Genome Project (1990-2003) http://www.ornl.gov/sci/techresources/Human_Genome/home.shtml http:// www.ornl.gov/sci/techresources/Human_Genome/home.shtml Project Goals: identify all genes in human DNA, determine the sequences of the chemical base pairs that make up human DNA, Project Results: • Human DNA is made up of approximately 25,000-33,000 protein-coding genes • This equates to 3 billion chemical base pairs • Surprised? The simple roundworm C. elegans has about 20,000 genes! 10