* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Protein Synthesis Project
Genetic engineering wikipedia , lookup
SNP genotyping wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Designer baby wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Primary transcript wikipedia , lookup
Oncogenomics wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Molecular cloning wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Epigenomics wikipedia , lookup
DNA vaccination wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
DNA supercoil wikipedia , lookup
Non-coding DNA wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
History of genetic engineering wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Expanded genetic code wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Genome editing wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Microsatellite wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Genetic code wikipedia , lookup
Microevolution wikipedia , lookup
Helitron (biology) wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Protein Synthesis Activity Name _________________ Date ____________ Period _______ The following segments of DNA are taken from the gene that code for the protein pro-insulin. DNA Molecule Segment 1: TCTTCCCTCGCGCTCCTAAACGTTCAACCGGTTCAACTTAAT CCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTGATGCG DNA Molecule Segment 2: AATCTCCCATCAGACGTTTTTGCCCCGTAACAACTTGTTACAACA TGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACGTTAACT DNA Molecule Segment 3: TACAAACATTTAGTTGTAAACACACCCTCAGTGGACCAACTC CGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGGGGGTTTTGG 1. Decode the above strands of DNA. Write out the resulting m-RNA in the space below. m-RNA: Segment 1: ______________________________________________________________________ ________________________________________________________________________________ Segment 2: ______________________________________________________________________ ________________________________________________________________________________ Segment 3: ______________________________________________________________________ ________________________________________________________________________________ 2. Divide the m-RNA into its codons by placing a vertical line between them. Using the amino acid chart found in your textbook, determine the name of the amino acid that each codon codes for. Write the abbreviation of the amino acids in their proper order, in the space below. Segment 1: ______________________________________________________________________ ________________________________________________________________________________ Segment 2: ______________________________________________________________________ ________________________________________________________________________________ Segment 3: ______________________________________________________________________ ________________________________________________________________________________ 3. After examining the polypeptide chains just constructed, determine which is the beginning, the middle, and the end segment of the pro-insulin molecule. 4. Record the entire list of amino acids in the space below. Start with the beginning segment, followed by the middle, and ending with tail. ________________________________________________________________________________ ________________________________________________________________________________ ________________________________________________________________________________ ________________________________________________________________________________ 5. How many molecules of water are lost in the process of creating this entire protein? __________. 6. Name the enzymes/events needed for the following processes to occur: t-RNA activation _____________________________________________________________ m-RNA start-up (transcription) __________________________________________________ termination of protein synthesis _________________________________________________ 7. Explain how the proper amino acid is attached to their correct t-RNA molecule. ________________________________________________________________________________ ________________________________________________________________________________ ________________________________________________________________________________ ________________________________________________________________________________ 8. How many amino acids does this complete protein contain? _____________ 9. This protein is called pro-insulin. In order for it to operate in the body, a segment between #30 and #66 amino acids must be removed. The remaining sections are reconnected to form insulin. How many amino acids are there in the protein insulin? ____________. Protein Synthesis Activity Name _________________ Date ____________ Period _______ MUTATIONS Sometimes when DNA is copied (replicated) errors occur. We call these mutations. When these mutations occur in gametes, they have the potential of being passed on to offspring and therefore will affect the next generation. Sometimes mutations cause only minor changes to a gene and therefore make only minor changes in the protein produced from that gene. These types of mutations may cause only minor effects to the phenotype of an organism. But sometimes mutations can cause great changes to the gene and therefore greatly alter the protein that is made from that gene. This will likely have great effects on the organism, since the protein will not be able to perform its normal function. This may lead to the inheritance of a genetic disease. Use the following DNA sequence as the “original DNA sequence” for this section on mutations. 5’ 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 3’ C T G A G C T A C T G A G C T G A G C T G C A G A G C C G A G C T C C T G T G T A A A C T T G MET THR ARG LEU ASP VAL SER ALA ARG GLY HIS ILE STOP 1. POINT MUTATION 1: One mutation is called a point mutation where only one base in the DNA is copied incorrectly during DNA replication. Here is an original DNA sequence and the amino acid sequence that was translated from it: a. Let’s simulate a point mutation at the 24th base. It was accidentally changed during replication from a G to a C. Now transcribe this new DNA strand into mRNA, and then translate it into its amino acid sequence. 5’ 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 3’ C T G A G C T A C T G A G C T G A G C T G C A C A G C C G A G C T C C T G T G T A A A C T T G b. Did this change in the DNA sequence cause any significant change to the protein produced? Explain. ____________________________________________________________________________________________________________ ____________________________________________________________________________________________________________ ____________________________________________________________________________________________________________ c. What is the name of this type of point mutation and why is it referred to by this terminology? ____________________________________________________________________________________________________________ ____________________________________________________________________________________________________________ 2. POINT MUTATION 2: Refer to the original DNA sequence from this section on mutations and the amino acid sequence that was translated from it: a. Now, let’s simulate a point mutation at the 13th base. It was accidentally changed during replication from a G to an A. Now transcribe this new DNA strand into mRNA, and then translate it into its amino acid sequence. 5’ 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 3’ C T G A G C T A C T G A A C T G A G C T G C A C A G C C G A G C T C C T G T G T A A A C T T G b. Did this change in the DNA sequence cause any significant change to the protein produced? Explain. ____________________________________________________________________________________________________________ ____________________________________________________________________________________________________________ ____________________________________________________________________________________________________________ c. What is the name of this type of point mutation and why is it referred to by this terminology? ____________________________________________________________________________________________________________ ____________________________________________________________________________________________________________ 3. POINT MUTATION 3: Refer to the original DNA sequence from this section on mutations and the amino acid sequence that was translated from it: a. Finally, let’s simulate a point mutation at the 21st base. It was accidentally changed during replication from a G to a T. Now transcribe this new DNA strand into mRNA, and then translate it into its amino acid sequence. 5’ 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 3’ C T G A G C T A C T G A G C T G A G C T T C A C A G C C G A G C T C C T G T G T A A A C T T G b. Did this change in the DNA sequence cause any significant change to the protein produced? Explain. ____________________________________________________________________________________________________________ ____________________________________________________________________________________________________________ _________________________________________________________________________________________________ ___________ c. What is the name of this type of point mutation and why is it referred to by this terminology? ____________________________________________________________________________________________________________ ____________________________________________________________________________________________________________ d. Why could a mutation in a gamete have more profound biological consequences than a mutation in a somatic cell? ____________________________________________________________________________________________________________ ____________________________________________________________________________________________________________ 4. Sickle cell anemia is an example of a genetic disease caused by a point mutation. a. Describe the specific DNA changes that produce the abnormal sickle cell hemoglobin. ____________________________________________________________________________________________________________ ____________________________________________________________________________________________________________ ____________________________________________________________________________________________________________ b. Explain the structural effect that this point mutation has on the hemoglobin protein. ____________________________________________________________________________________________________________ ____________________________________________________________________________________________________________ c. Explain why the sickle cell mutation is selected for in certain areas of the world. ____________________________________________________________________________________________________________ ____________________________________________________________________________________________________________ 5. FRAMESHIFT MUTATION 1: Another group of mutations is called frameshift mutations where at least one base is either added to or deleted from the DNA as it is copied during DNA replication. Let’s investigate the effects of these. Refer to the original DNA sequence from this section on mutations and the amino acid sequence that was translated from it: a. Let’s simulate a frameshift mutation by adding an additional base between the 36th & 37th bases. The base A was accidentally added to the sequence of the gene. Now transcribe this new DNA strand into mRNA, and then also translate it into its amino acid sequence. 37 38 39 40 41 42 43 44 45 46 47 5’ 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 3’ C T G A G C T A C T G A G C T G A G C T T C A C A G C C G A G C T C C T A G T G T A A A C T T G b. Did this change in the DNA sequence cause any significant change to the protein produced? Explain. ____________________________________________________________________________________________________________ ____________________________________________________________________________________________________________ c. Why are insertions and deletions called “frameshift” mutations, and what is meant by the “reading frame” of a gene? ____________________________________________________________________________________________________________ ____________________________________________________________________________________________________________ 6. FRAMESHIFT MUTATION 2: Refer to the original DNA sequence from this section on mutations and the amino acid sequence that was translated from it: a. Now let’s simulate a frameshift mutation by deleting the 10th base. Now transcribe this new DNA strand into mRNA, and then also translate it into its amino acid sequence. 5’ 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 3’ C T G A G C T A C G A G C T G A G C T T C A C A G C C G A G C T C C T G T G T A A A C T T G b. Did this change in the DNA sequence cause any significant change to the protein produced? Explain. ____________________________________________________________________________________________________________ ____________________________________________________________________________________________________________ c. Which do you think would cause a more profound biological impact: (1) a deletion/insertion near the beginning of a gene, or (2) a deletion/insertion towards the end of a gene? Explain. ____________________________________________________________________________________________________________ ____________________________________________________________________________________________________________ ____________________________________________________________________________________________________________ 7. Cystic fibrosis is an example of a genetic disease caused by a frameshift mutation. a. Describe the specific DNA changes that produce the abnormal cystic fibrosis protein (the delta F508 mutation). ____________________________________________________________________________________________________________ ____________________________________________________________________________________________________________ ____________________________________________________________________________________________________________ b. Explain the structural and functional effects that this frameshift mutation has on lung cells. ____________________________________________________________________________________________________________ ____________________________________________________________________________________________________________ c. Explain why cystic fibrosis shortens life span. ____________________________________________________________________________________________________________ ____________________________________________________________________________________________________________ ____________________________________________________________________________________________________________ 8. Are mutations always deleterious? What is the evolutionary value of mutations? Explain. _______________________________________________________________________________________________________________ ___________________________________________________________________________________________________ ____________ _______________________________________________________________________________________________________________