* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Nucleic Acid Chemistry
United Kingdom National DNA Database wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
SNP genotyping wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Human genome wikipedia , lookup
DNA vaccination wikipedia , lookup
Genealogical DNA test wikipedia , lookup
RNA silencing wikipedia , lookup
Molecular cloning wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Epigenomics wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Polyadenylation wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
History of genetic engineering wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Transfer RNA wikipedia , lookup
DNA polymerase wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
DNA supercoil wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
DNA replication wikipedia , lookup
Non-coding DNA wikipedia , lookup
Microevolution wikipedia , lookup
Messenger RNA wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
History of RNA biology wikipedia , lookup
Frameshift mutation wikipedia , lookup
Expanded genetic code wikipedia , lookup
Non-coding RNA wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Helitron (biology) wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Epitranscriptome wikipedia , lookup
Point mutation wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Nucleic Acid Chemistry Where the info is…interpreting the blueprint Central Dogma Replication DNA ---------------- RNA-------------- protein transcription translation Central Dogma • Replication – DNA making a copy of itself • Making a replica • Transcription – DNA being made into RNA • Still in nucleotide language • Translation – RNA being made into protein • Change to amino acid language Replication • Remember that DNA is self complementary • Replication is semiconservative – One strand goes to next generation – Other is new • Each strand is a template for the other – If one strand is 5’ AGCT 3’ – Other is: 3’ TCGA 5’ Replica • Write the strand complementary to: 3’ ACTAGCCTAAGTCG 5’ Answer Replication is Semiconservative Replication • Roles of enzymes – Topoisomerases – Helicase – DNA polymerases – ligase • DNA binding proteins – DNA synthesis • Leading strand • Lagging strand Replication Replication • Helix opens – Helicase • Causes supercoiling upstream – Topoisomerases (gyrase) • DNA Binding Proteins – Prevent reannealing Replication Replication • Leading strand – 3’ end of template – As opens up, DNA polymerase binds – Makes new DNA 5’ - 3’ • Same direction as opening of helix • Made continuously Replication Replication • Lagging strand – 5’ end of template • Can’t be made continuously as direction is wrong – RNA primer – New DNA made 5’ 3’ • Opposite direction of replication • Discontinuous – Okazaki fragments • Ligase closes gaps Transcription • DNA template made into RNA copy – Uracil instead of Thymine • One DNA strand is template – Sense strand • Other is just for replication – Antisense (not to be confused with nonsense!) • In nucleus – nucleoli Transcription • From following DNA strand, determine RNA sequence 3’ GCCTAAGCTCA 5’ Answer Transcription Transcription • DNA opens up – Enzymes? • RNA polymerase binds – Which strand? – Using DNA template, makes RNA • 5’-3’ • Raw transcript called hnRNA Transcription How does RNA polymerase know where to start? upstream promotor sequences Pribnow Box TATA box RNA polymerase starts transcription X nucleotides downstream of TATA box Introns and Exons • Introns – Intervening sequences – Not all DNA codes for protein – Regulatory info, “junk DNA” • Exons – Code for protein Processing of hnRNA into mRNA • 3 steps – Introns removed • Self splicing – 5’ methyl guanosine cap added – Poly A tail added • Moved to cytosol for translation Processing of hnRNA into mRNA Translation • RNA -- Protein – Change from nucleotide language to amino acid language • On ribosomes • Vectorial nature preserved – 5’ end of mRNA becomes amino terminus of protein – Translation depends on genetic code Genetic Code • Nucleotides read in triplet “codons” – 5’ - 3’ • Each codon translates to an amino acid • 64 possible codons – 3 positions and 4 possiblities (AGCU) makes 43 or 64 possibilities – Degeneracy or redundancy of code • Only 20 amino acids • Implications for mutations Genetic Code Genetic Code • Not everything translated • AUG is start codon – Find the start codon • Also are stop codons • To determine aa sequence – Find start codon – Read in threes – Continue to stop codon Translation • Steps: – Find start codon (AUG) – After start codon, read codons, in threes – Use genetic code to translate Translate the following: GCAGUCAUGGGUAGGGAGGCAACCUGAACCGAC Answer Translation Process • Requires Ribosomes, rRNA, tRNA and, of course, mRNA – Ribosome • Made of protein and rRNA • 2 subunits • Has internal sites for 2 transfer RNA molecules Ribosome Left is cartoon diagram Right is actual picture Transfer RNA • Mostly double stranded – Folds back on itself • Several loops – Anticodon loop • Has complementary nucleotides to codons • 3’ end where aa attach Transfer RNA Translation • Initiation – Ribosomal subunits assemble on mRNA – rRNA aids in binding of mRNA • Elongation – – – – tRNAs with appropriate anticodon loops bind to complex have aa attached (done by other enzymes) Amino acids transfer form tRNA 2 to tRNA 1 Process repeats • Termination – tRNA with stop codon binds into ribosome – No aa attached to tRNA – Complex falls apart Translation Translation • Happening of process (circa 1971) • http://www.youtube.com/watch?v=u9dhO0 iCLww Mutations • Changes in nucleotide sequence • Can cause changes in aa sequence – Degeneracy in genetic code can prevent • Two types – Point mutations • Single nucleotide changes – Frame shift • Insertions or deletions Point Mutations • Single nucleotide changes • Old sequence AUG GGU AGG GAG GCA ACC UGA ACC GAC aa: G R E A T New sequence AUG GGU AGU GAG GCA ACC UGA ACC GAC aa: G S E A T Point mutations • Depending on change, may not change aa sequence • Old sequence AUG GGU AGG GAG GCA ACC UGA ACC GAC aa: G R E A T New sequence AUG GGU AGA GAG GCA ACC UGA ACC GAC aa: G R E A T Point Mutations • Change could make little difference – If valine changed to leucine, both nonpolar • Change could be huge, – Could erase start codon • Old sequence AUG GGU AGG GAG GCA ACC UGA ACC GAC aa: G R E A T New sequence AUU GGU AGA GAG GCA ACC UGA ACC GAC aa: no start codon…protein not made Point Mutations • Other possibilities, – Stop codon inserted • Truncated protein – Stop codon changed • Extra long protein • Bottom line, – Depends on what change is Frame Shift mutations • Insertions or deletions – Change the reading frame • Insertion example Old sequence AUG GGU AGG GAG GCA ACC UGA ACC GAC aa: G R E A T New sequence AUG GGU AGG AGA GGC AAC CUG AAC CGA C aa: G R R G N L N R Frame Shift Mutations • Deletion example • Old sequence AUG GGU AGG GAG GCA ACC UGA ACC GAC aa: G R E A T New sequence Delete second A (Underlined above) AUG GGU GGG AGG CAA CCU GAA CCG AC aa: G G R Q P G P Complementary DNA Strand Template: 3’ ACTAGCCTAAGTCG 5’ 5’ TGATCGGATTCAGC 3’ Back RNA Transcript DNA RNA Back 3’ GCCTAAGCTCA 5’ 5’ CGGAUUCGAGU 3’ Translation Answer Find start codon GCAGUCAUGGGUAGGGAGGCAACCUGAACCGAC Read in threes after that: AUG GGU AGG GAG GCA ACC UGA ACC GAC Using Genetic code AUG GGU AGG GAG GCA ACC UGA ACC GAC G R E A T After stop codon…rest is garbage Back stop