* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Transcription and Translation
Metalloprotein wikipedia , lookup
Community fingerprinting wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Molecular cloning wikipedia , lookup
RNA silencing wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Genetic engineering wikipedia , lookup
DNA supercoil wikipedia , lookup
Polyadenylation wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Proteolysis wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Non-coding DNA wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Biochemistry wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Point mutation wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Messenger RNA wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Gene expression wikipedia , lookup
Epitranscriptome wikipedia , lookup
Transcription and Translation Decoding DNA’s Information DNA carries instructions on how to make proteins Each protein’s instructions are in a gene These proteins determine your traits We need to “photocopy” a gene in order to produce the protein (trait) RNA = Ribonucleic acid Nucleic acid that is directly involved in the making of proteins The “photocopy” is called RNA Genes – segments of DNA nucleotides that code for specific proteins DNA is in nucleus, but cell’s “machinery” to make proteins is in the cytosol…how do we follow DNA’s instructions? RNA vs. DNA Structure 3 structural differences between RNA & DNA: 1. RNA nucleotide has the sugar Ribose (not deoxyribose) 2. RNA is single stranded 3. RNA uses the base Uracil (U) instead of Thymine (T) a. A pairs with U instead RNA…the “link” between DNA and Proteins DNA must stay in the nucleus of a cell. Proteins are assembled at the ribosomes (in the cytoplasm). 3 different types of RNA used to make proteins: 1. mRNA = (messenger RNA) carries information from DNA to Ribosomes. 2. tRNA = (transfer RNA) reads the mRNA and brings the correct amino acid to build the protein. 3. rRNA = (ribosomal RNA) part of the Ribosome that grabs on to the mRNA to position it for protein synthesis to occur. Protein Structure Made up of amino acids Polypeptide- string of amino acids 20 amino acids are arranged in different orders to make a variety of proteins Assembled on a ribosome Replication DNA •DNA double helix unwinds •DNA now single-stranded •New DNA strand forms using complementary base pairing (A-T, C-G) •Used to prepare DNA for cell division •Whole genome copied/replicated Transcription and Translation: An Overview (aka the Central Dogma) DNA Transcription RNA Translation Protein RNA vs. DNA DNA Double stranded Deoxyribose sugar Bases: C,G A,T RNA Single stranded Ribose sugar Bases: C,G,A,U Both contain a sugar, phosphate, and base. Transcription The information contained in DNA is stored in blocks called genes the genes code for proteins the proteins determine what a cell will be like The DNA stores this information safely in the nucleus where it never leaves instructions are copied from the DNA into messages comprised of RNA these messages are sent out into the cell to direct the assembly of proteins Transcription The path of information is often referred to as the central dogma DNA RNA protein The use of information in DNA to direct the production of particular proteins is called gene expression, which takes place in two stages transcription is the process when a messenger RNA (mRNA) is made from a gene within the DNA translation is the process of using the mRNA to direct the production of a protein Transcription RNA forms base pairs with DNA C-G A-U Primary transcriptlength of RNA that results from the process of transcription TRANSCRIPTION ACGATACCCTGACGAGCGTTAGCTATCG UGCUAUGGGACU WHY is TRANSCRIPTION Important? It is needed to get the DNA message out of the nucleus so the ribosomes know what protein to make! Without transcription, the ribosome would have no idea what proteins the body needed and would not make any. You could NOT replace the hair that we loose every day; could NOT grow long fingernails; be able to fight off diseases; cells would fall apart because the proteins were not being replaced!! TRANSCRIPTION DNA is copied into a complementary strand of mRNA. WHY? DNA cannot leave the nucleus. Proteins are made in the cytoplasm. mRNA serves as a “messenger” and carries the protein building instructions to the ribosomes in the cytoplasm. Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplaye r. Major players in transcription mRNA- type of RNA that encodes information for the synthesis of proteins and carries it to a ribosome from the nucleus Major players in transcription RNA polymerasecomplex of enzymes with 2 functions: Unwind DNA sequence Produce primary transcript by stringing together the chain of RNA nucleotides mRNA Processing Primary transcript is not mature mRNA DNA sequence has coding regions (exons) and noncoding regions (introns) Introns must be removed before primary transcript is mRNA and can leave nucleus Transcription is done…what now? Now we have mature mRNA transcribed from the cell’s DNA. It is leaving the nucleus through a nuclear pore. Once in the cytoplasm, it finds a ribosome so that translation can begin. We know how mRNA is made, but how do we “read” the code? Translation Second stage of protein production mRNA is on a ribosome Translation To correctly read a gene, a cell must translate the information encoded in the DNA (nucleotides) into the language of proteins (amino acids) translation follows rules set out by the genetic code the mRNA is “read” in three-nucleotide units called codons each codon corresponds to a particular amino acid Translation The genetic code was determined from trial-and-error experiments to work out which codons matched with which amino acids The genetic code is universal and employed by all living things Figure 13.2 The genetic code (RNA codons) There are 64 different codons in the genetic code. Translation Translation occurs in ribosomes, which are the protein-making factories of the cell each ribosome is a complex of proteins and several segments of ribosomal RNA (rRNA) ribosomes are comprised of two subunits small subunit large subunit the small subunit has a short sequence of rRNA exposed that is identical to a leader sequence that begins all genes mRNA binds to the small subunit 13.2 Translation The large RNA subunit has three binding sites for transfer RNA (tRNA) located directly adjacent to the exposed rRNA sequence on the small subunit these binding sites are called the A, P, and E sites it is the tRNA molecules that bring amino acids to the ribosome to use in making proteins Figure 13.3 A ribosome is composed of two subunits Translation The structure of a tRNA molecule is important to its function it has an amino acid attachment site at one end and a three-nucleotide sequence at the other end this three-nucleotide sequence is called the anticodon and is complementary to 1 of the 64 codons of the genetic code activating enzymes match amino acids with their proper tRNAs Figure 13.4 The structure of tRNA. Translation Once an mRNA molecule has bound to the small ribosomal subunit, the other larger ribosomal subunit binds as well, forming a complete ribosome during translation, the mRNA threads through the ribosome three nucleotides at a time a new tRNA holding an amino acid to be added enters the ribosome at the A site Translation Second stage of protein production mRNA is on a ribosome tRNA brings amino acids to the ribosome tRNA Transfer RNA Bound to one amino acid on one end Anticodon on the other end complements mRNA codon tRNA Function Amino acids must be in the correct order for the protein to function correctly tRNA lines up amino acids using mRNA code Translation Before a new tRNA can be added, the previous tRNA in the A site shifts to the P site At the P site, peptide bonds from between the incoming amino acid and the growing chain of amino acids The now empty tRNA in the P site eventually shifts to the E site where it is released Figure 13.5 How translation works Translation Translation continues until a “stop” codon is encountered that signals the end of the protein The ribosome then falls apart and the newly made protein is released into the cell WHY is TRANSLATION Important? Makes all the proteins that the body needs Without translation, proteins wound not be made and we could not replace the proteins that are depleted or damaged Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplaye r. SUMMARY of PROTEIN SYNTHESIS DNA: TAC CTT GTG CAT GGG ATC mRNA AUG GAA CAC GUA CCC UAG A.A MET G.A HIS VAL PRO STOP IMPORTANT CODONS AUG = start translation (Met) UAA, UAG, UGA= stop translation Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplaye r. Figure 13.6 Ribosomes guide the translation process Ribosomes 2 subunits, separate in cytoplasm until they join to begin translation Large Small Contain 3 binding sites E P A Reading the DNA code Every 3 DNA bases pairs with 3 mRNA bases Every group of 3 mRNA bases encodes a single amino acid Codon- coding triplet of mRNA bases The Genetic Code We now know the complete genetic code 64 “words,” or codons 61 represent an amino acid More than one codon for some amino acids AUG is the start signal and represents methionine UAG, UAA and UGA are the stop signals Universal Non-overlapping No spaces between codons The language of amino acids is based on codons 1 codon = 3 mRNA nucleotides 1 codon = 1 amino acid AUA U A U G C C C GC How many codons are in this sequence of mRNA? Using this chart, you can determine which amino acid the codon “codes” for! Which amino acid is encoded in the codon CAC? Find the first letter of the codon CAC Find the second letter of the codon CAC Find the third letter of the codon CAC CAC codes for the amino acid histidine (his). What does the mRNA codon UAC code for? Tyr or tyrosine Notice there is one start codon AUG. Transcription begins at that codon! Notice there are three stop codons. Transcription stops when these codons are encountered. Although we do have proofreading mechanisms in place, sometimes mutations occur and a protein is not translated properly. Are there possible consequences to such errors in transcription? Well, errors in transcription will lead to the wrong codon and incorrect translation of amino acid and erroneous protein SO……. One disease we see as and example on this is……. The Genetic Code Which codons code for which amino acids? Genetic code- inventory of linkages between nucleotide triplets and the amino acids they code for A gene is a segment of RNA that brings about transcription of a segment of RNA Transcription vs. Translation Review Transcription Process by which genetic information encoded in DNA is copied onto messenger RNA Occurs in the nucleus DNA mRNA Translation Process by which information encoded in mRNA is used to assemble a protein at a ribosome Occurs on a Ribosome mRNA protein Chapter 14: Gene Technology Biotechnology Genetic engineering is the use of technology to alter the genomes of organisms. Biotechnology includes genetic engineering and other techniques to make use of natural biological systems to achieve an end desired by humans. 65 The Cloning of a Gene Recombinant DNA Technology. Uses at least two different DNA sources. Vector used to introduce foreign DNA into a host cell. Plasmid. Enzymes. Restriction enzymes cleave DNA. DNA ligase seals DNA into an opening created by the restriction enzyme. 66 67 Polymerase Chain Reaction Polymerase Chain Reaction (PCR) can create millions of copies of a DNA segment very quickly. Can be subjected to DNA fingerprinting using restriction enzymes to cleave the DNA sample, and gel electrophoresis to separate DNA fragments. 68 69 Biotechnology Products Products Effects and Uses Anticoagulants Involved in dissolving blood clots; used to treat heart attack patients Colony-stimulating factors Stimulate white blood cell production, used to treat infections and immune system deficiencies (e.g.; lupus) Growth factors Stimulate differentiation and growth of various cell types; used to aid wound healing (e.g.; burn victims) Human Growth Hormone (HGH) Used to treat dwarfism Insulin Involved in controlling blood sugar levels; used in treating diabetes Interferons Disrupt the reproduction of viruses; used to treat some cancers Interleukins Activate and stimulate white blood cells; used to treat wounds, HIV infections, cancer, immune deficiencies 70 Biotechnology Products New prostate cancer vaccine (FDA app. Apr 2010) Treats patients advanced form of prostate cancer. Provenge : The series of three shots using a patient's own cells, and are designed to train the immune system to recognize and kill malignant cells. Does NOT cure cancer, just make patients live longer (avg: 4 months) $50-75K price range Still in testing stage Biotechnology Products Transgenic Bacteria. Insulin. Human Growth Hormone. Transgenic Plants. Pest resistance. Higher yields. 72 Genetic Engineering of Farm Animals Transgenic Animals. The use of transgenic farm animals to produce pharmaceuticals is currently being pursued. Cloning transgenic animals. Dolly (1997). 73 Genetic Engineering of Farm Animals Production of bovine somatotropin (BST) 1994 Became commercially available for dairy farmers to increase animals’ milk production More money Although BST is functional, harmless, and sanctioned by the FDA, much controversy exists over whether it is actually desirable. 74 Genetic Engineering of Crop Plants Manipulation of the genes of crop plants to make them more resistant to disease from insects and improve crop yield. Cotton: Over 40% of the chemical insecticides used for these crops Bacillus thuringiensis (Bt) Harmful to caterpillars/tomato hornworms but not harmful to humans 81% of U.S acreage is Bt cotton Genetic Engineering of Crop Plants 60-70% of processed foods in the U.S. grocery shelves have genetically modified ingredients. Table 14.2 (pg. 265) List of Genetically Modified Crops Is eating genetically modified food dangerous? EPA, FDA, and USDA approve food regulations in the U.S. EPA approved EPSP enzyme (change in protein sequence) for human consumption Bt (inhibits pests on cotton/corn crops) protein is approved for human consumption by the EPA Benefits vs Risk Benefits: Increased pest and disease resistance Drought tolerance Increased food supply Farmers make more money and keep food cost down for consumers Benefits vs Risk Risk: Introducing allergens and toxins in foods Antibiotic resistance Adversely changing the nutrient content of a crop Creation of “super” weeds and other environmental risk Unknown long-term health effects So, do you think that it is safe to eat genetically modified foods? This is for you to decide…