Download Chapter 13

Chapter 13
The Central Dogma of Biology:
RNA Structure:
1. It is a nucleic acid.
2. It is made of monomers called nucleotides
3. There are two differences between a DNA & an
RNA nucleotide:
- RNA has ribose instead of deoxyribose
- RNA has the base Uracil instead of
Thymine
- Adenine will pair with Uracil (Uracil is
a pyrimidine)
Types of RNA:
1.
Messenger RNA (mRNA)
- carries the info from DNA to the ribosome
- contains “codons” that code for individual
amino acids
2. Ribosomal RNA (rRNA)
- a component of the ribosome
3. Transfer RNA (tRNA)
- “Transfers” the info on the mRNA to an amino
acid sequence (protein).
- contains “anticodons” that complement the
codons on mRNA.
What is transcription?
It is the process of making an RNA copy from a
DNA template.
- All forms of RNA are made using this process.
- The process is similar to replication.
The Steps of Transcription:
1. Initiation:
RNA polymerase binds to a location on the DNA
called a promoter.
- Promoters signal the beginning of a gene.
- RNA polymerase has the ability to unzip
the DNA.
The Steps of Transcription:
2. Elongation:
RNA polymerase makes a complementary RNA
strand from one of the exposed DNA strands.
- This DNA strand is called the “template
strand.” (sense strand)
The Steps of Replication:
3. Termination:
RNA polymerase comes
across a DNA sequence
called a “terminator”
and stops the
transcription process.
1.
2.
3.
Eukaryotic mRNA Transcripts must be edited.
The original mRNA contains sequences known as
introns & exons.
Introns = sequences that do not code for
anything.
Exons = sequences that actually code for a
protein.
The introns are cut out and the exons are spliced
together.
A cap sequence & a tail sequence are added and the
mRNA is ready to go.
The Genetic Code:
1.
The sequence of the DNA bases “codes” for the
individual amino acids in a protein.
2.
This code is copied on to an mRNA strand.
3.
The mRNA code:
- 3 mRNA bases in a row are called a codon & each
codes for a particular amino acid.
4.
Because there are 4 RNA bases, there are 64 different
3-base combinations (104 = 64).
- One combination is known as the “start codon”
(AUG). This marks the beginning of the protein.
- Three of them are “stop codons” (UAA, UAG,
UGA). These codons do not code for any amino
acids, thus signaling the end of the protein.
What is the amino acid sequence from the
following mRNA sequence?
AUGGUCGAUAAACCACGCCUGUGA
Met-Val-Asp-Lys-Pro-Arg-Leu
What is Translation?
Process in which a ribosome reads the mRNA &
makes a protein (polypeptide).
Ribosome Structure:
1. Has two subunits: small & large
2. Large subunit has two sites:
p site (polypeptide site)
a site (amino acid site)
Translation Animation
What is a mutation?
Any kind of change to the base sequence of either
DNA or RNA.
- Mutations cause the amino acid sequence to be
incorrect.
- An incorrect amino acid sequence usually causes
the protein to be nonfunctional or it gives the
protein new functions.
1.
Gene Mutations (a.k.a. point mutations)
These affect a particular gene only.
A. Substitution – replace one base with another.
- affects only one amino acid in the
protein.
- May not even cause a problem
(silent mutation).
B. Insertion – a new base is placed in the sequence;
this alters the reading frame & every amino
acid after the mutation is altered.
C. Deletion – a base is removed & every amino acid
after this mutation is altered.
Insertions & deletions are called frameshift mutations.
2.
Chromosomal Mutations –
affect whole chromosomes
A. Deletion – part of the
chromosome disappears
B. Duplication – part of the
chromosome is copied.
C. Inversion – the sequence of
genes on the
chromosome is partially
flipped.
D. Insertion – part of one
chromosome is removed
an placed onto a
different chromosome
E. Translocation – parts of two
chromosomes are
clipped off and they
switch places.