* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Chapter 13
Extrachromosomal DNA wikipedia , lookup
X-inactivation wikipedia , lookup
DNA supercoil wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Human genome wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Short interspersed nuclear elements (SINEs) wikipedia , lookup
Epigenetics of human development wikipedia , lookup
RNA interference wikipedia , lookup
Microevolution wikipedia , lookup
Non-coding DNA wikipedia , lookup
Transfer RNA wikipedia , lookup
RNA silencing wikipedia , lookup
Polyadenylation wikipedia , lookup
Helitron (biology) wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
Frameshift mutation wikipedia , lookup
Expanded genetic code wikipedia , lookup
Messenger RNA wikipedia , lookup
History of RNA biology wikipedia , lookup
RNA-binding protein wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Non-coding RNA wikipedia , lookup
Point mutation wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Primary transcript wikipedia , lookup
Chapter 13 The Central Dogma of Biology: RNA Structure: 1. It is a nucleic acid. 2. It is made of monomers called nucleotides 3. There are two differences between a DNA & an RNA nucleotide: - RNA has ribose instead of deoxyribose - RNA has the base Uracil instead of Thymine - Adenine will pair with Uracil (Uracil is a pyrimidine) Types of RNA: 1. Messenger RNA (mRNA) - carries the info from DNA to the ribosome - contains “codons” that code for individual amino acids 2. Ribosomal RNA (rRNA) - a component of the ribosome 3. Transfer RNA (tRNA) - “Transfers” the info on the mRNA to an amino acid sequence (protein). - contains “anticodons” that complement the codons on mRNA. What is transcription? It is the process of making an RNA copy from a DNA template. - All forms of RNA are made using this process. - The process is similar to replication. The Steps of Transcription: 1. Initiation: RNA polymerase binds to a location on the DNA called a promoter. - Promoters signal the beginning of a gene. - RNA polymerase has the ability to unzip the DNA. The Steps of Transcription: 2. Elongation: RNA polymerase makes a complementary RNA strand from one of the exposed DNA strands. - This DNA strand is called the “template strand.” (sense strand) The Steps of Replication: 3. Termination: RNA polymerase comes across a DNA sequence called a “terminator” and stops the transcription process. 1. 2. 3. Eukaryotic mRNA Transcripts must be edited. The original mRNA contains sequences known as introns & exons. Introns = sequences that do not code for anything. Exons = sequences that actually code for a protein. The introns are cut out and the exons are spliced together. A cap sequence & a tail sequence are added and the mRNA is ready to go. The Genetic Code: 1. The sequence of the DNA bases “codes” for the individual amino acids in a protein. 2. This code is copied on to an mRNA strand. 3. The mRNA code: - 3 mRNA bases in a row are called a codon & each codes for a particular amino acid. 4. Because there are 4 RNA bases, there are 64 different 3-base combinations (104 = 64). - One combination is known as the “start codon” (AUG). This marks the beginning of the protein. - Three of them are “stop codons” (UAA, UAG, UGA). These codons do not code for any amino acids, thus signaling the end of the protein. What is the amino acid sequence from the following mRNA sequence? AUGGUCGAUAAACCACGCCUGUGA Met-Val-Asp-Lys-Pro-Arg-Leu What is Translation? Process in which a ribosome reads the mRNA & makes a protein (polypeptide). Ribosome Structure: 1. Has two subunits: small & large 2. Large subunit has two sites: p site (polypeptide site) a site (amino acid site) Translation Animation What is a mutation? Any kind of change to the base sequence of either DNA or RNA. - Mutations cause the amino acid sequence to be incorrect. - An incorrect amino acid sequence usually causes the protein to be nonfunctional or it gives the protein new functions. 1. Gene Mutations (a.k.a. point mutations) These affect a particular gene only. A. Substitution – replace one base with another. - affects only one amino acid in the protein. - May not even cause a problem (silent mutation). B. Insertion – a new base is placed in the sequence; this alters the reading frame & every amino acid after the mutation is altered. C. Deletion – a base is removed & every amino acid after this mutation is altered. Insertions & deletions are called frameshift mutations. 2. Chromosomal Mutations – affect whole chromosomes A. Deletion – part of the chromosome disappears B. Duplication – part of the chromosome is copied. C. Inversion – the sequence of genes on the chromosome is partially flipped. D. Insertion – part of one chromosome is removed an placed onto a different chromosome E. Translocation – parts of two chromosomes are clipped off and they switch places.