Download Gene Regulation

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Community fingerprinting wikipedia , lookup

Deoxyribozyme wikipedia , lookup

Genomic imprinting wikipedia , lookup

Gene desert wikipedia , lookup

Protein moonlighting wikipedia , lookup

Ridge (biology) wikipedia , lookup

List of types of proteins wikipedia , lookup

Transcription factor wikipedia , lookup

Secreted frizzled-related protein 1 wikipedia , lookup

Histone acetylation and deacetylation wikipedia , lookup

Genome evolution wikipedia , lookup

Non-coding DNA wikipedia , lookup

Polyadenylation wikipedia , lookup

RNA silencing wikipedia , lookup

Molecular evolution wikipedia , lookup

RNA interference wikipedia , lookup

Point mutation wikipedia , lookup

Two-hybrid screening wikipedia , lookup

Eukaryotic transcription wikipedia , lookup

RNA polymerase II holoenzyme wikipedia , lookup

Gene expression profiling wikipedia , lookup

Messenger RNA wikipedia , lookup

Gene wikipedia , lookup

Non-coding RNA wikipedia , lookup

Endogenous retrovirus wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Promoter (genetics) wikipedia , lookup

RNA-Seq wikipedia , lookup

Epitranscriptome wikipedia , lookup

Gene regulatory network wikipedia , lookup

Lac operon wikipedia , lookup

Gene expression wikipedia , lookup

Transcriptional regulation wikipedia , lookup

Silencer (genetics) wikipedia , lookup

Transcript
Gene Regulation
Both prokaryotic genes and eukaryotic genes
are under some form of regulation controlling
expression of the gene.
Differences between prokaryotes and
eukaryotes lead to differences in gene
regulation.
Regulation can occur before and after both
transcription and translation.
Best time to control gene expression is at
transcription, before a mRNA is produced.
Regulation in Prokaryotes
Two types of regulation in prokaryotes:
1. Inducible - Turn on production of a protein
only when it is needed.
2. Repressible - turn off production of a
protein when it is no longer needed.
13
Inducible system
Example is from bacteria (E. coli), the lactose
operon.
operon - a unit of genes all under the control
of a common regulatory (operator) gene.
The lactose (lac) operon involves three
enzymes needed for the utilization of lactose
as an energy source.
Lac operon genes
 -  galactosidase
 - permease
 - acetylase
14
In this system:
In the presence of lactose and absence of
glucose the enzymes are present
In the absence of lactose or the presence of
glucose the enzymes are absent or expressed
at a very low level.
Modified lactose (allolactose) acts as an
inducer, i.e. it turns on or induces gene
expression.
without lactose, transcription is blocked by a
regulatory protein called a repressor.
I
promoter operator
regulatory region
region
gene

 
15
regulatory gene - codes for the repressor
protein
operator - site where the repressor protein
attaches
The binding site for the repressor protein is
an example of two-fold rotational symmetry
5’TGTGTGGAATTGTGAGCGGATAACAATTTCACACA3’
3’ACACACCTTAACACTCGCC TATTGTTAAAGTGTGT5’
The DNA sequence reads the same 5’ to 3’ on
the complementary strands
16
Catabolite Repression
How glucose affects expression of the lac
operon.
 affects the activation of transcription
CAP site
RNA polymerase site
promoter
CAP - Catabolite activator protein
The function of the CAP protein is to aid in
the opening of the DNA so RNA polymerase
can bind and start transcription.
The CAP protein can only bind to the CAP
site when it is combined with cyclic AMP
(cAMP).
17
Glucose level in the cell affects the availability
of cAMP.
Glucose high - cAMP low
Glucose low - cAMP high
Binding site of CAP-cAMP complex
5’GTGAGTTAGCTCAC3’
3’CACTCAATCGAGTG5’
another example of two-fold rotational
symmetry
18
Repressible enzymes
Repressible - turn off production of a
protein when it is no longer needed.
Example - Tryptophan synthesis
promoter
regulatory
gene
operator

inactive
repressor
repressor = active
+ trp
repressor
Tryptophan is called the corepressor because
it is needed for the repressor to be active
(bind to the DNA)
19
Attenuation - restriction of transcription past
the leader sequence. This form of secondary
regulation is found in several amino acid
synthesis operons.
In attenuation the leader region actually
codes for a small polypeptide that contains
the amino acid synthesized by the enzymes
coded for by the genes in the operon.
The rate of translation will be affected by the
availability of this amino acid and in turn will
affect the secondary structure formed by the
leader mRNA which will affect transcription
of the genes in the operon.
mRNA attenuator region
four regions
1
2
3
4
20
The regions will pair differently depending on
the availability of the amino acid (in this case
tryptophan).
If tryptophan is in adequate supply - pairing
will occur between regions 1 & 2 and 3 & 4.
This will cause the RNA polymerase to come
off the DNA and stop transcription.
An alternative is the ribosome makes the 2
region unavailable for pairing allowing
regions 3 & 4 to pair, again causing the RNA
polymerase to come off the DNA and stop
transcription.
If tryptophan supply is low - pairing will
occur between regions 2 & 3 allowing
transcription to continue.
21
Gene Regulation in Eukaryotes
Transcriptional control
regulatory proteins
methylation
Post-transcription control
- small interfering (si) RNA
- mRNA processing control
- addition of poly-adenine tail
- removal of introns
- combine different exons
- mRNA transport control
 translation control
rate of translation
mRNA degradation
22
Transcriptional Control
1. regulatory proteins
 can activate, repress or enhance
 various combinations of enhancer
sequences and activator proteins may
be needed to start transcription.
 combination system reduces the
number of activator proteins needed
and allows for the regulation of groups
of genes (no examples of operons in
eukaryotes)
 proteins recognize base sequences in the
DNA through the major groove (may
require elements such as zinc to read
the sequences)
23
How can an operon system be imitated in
eukaryotes?
Suppose you have:
- 3 biochemical pathways each controlled by 3
genes.
- 3 enhancer sequences
- 3 activator proteins
How could you design a regulatory system
that would turn on all the genes in a pathway
at one time using 2 enhancer sequences and 2
activator proteins but does not turn on more
than one pathway at a time?
 specific combinations of transcription
factors could be used to regulate a group of
genes for a given pathway. Using
combinations of activators and enhancers you
could reduce the total number of activators
and enhancers needed to relate all the genes
in a cell.
24
Example: There are five enhancer sequences
(1, 2, 3, 4, 5) that correspond to five
transcription activators (1, 2, 3, 4, 5). These
are involved in regulation of 3 biochemical
pathways (A, B, C)
 biochem pathway A genes require
activators 1, 3, 5
 biochem. pathway B genes require
activators 1, 2, 4
 biochem. pathway C genes require
activators 2, 3,5 factors
By having all the genes involved in a specific
biochemical pathway requiring the same
activators (i.e. have the same enhancer
sequences), when the required activators are
present all the genes for the pathway would
be turned on. In their absence, all the genes
would be turned off.
This mimics a prokaryotic operon system.
25
2. Methylation
 modification of specific cytosines with a
methyl group
 appears to have a negative correlation
with transcription
 may also serve as ‘native’ recognition
sites for defensive endonucleases
 can be a problem for genetic engineers
Post-transcriptional control
A system has been discovered that uses small
pieces of RNA to recognize transcripts that
may be in too much abundance in the cell and
the transcripts need to be removed before
they are translated.
The RNA is called small interfering RNA
(siRNA) and may be a system for cells to
protect itself from virus.
26
The siRNA actually comes from double
stranded RNA which is common in certain
RNA virus. The double stranded RNA is cut
up by dsRNA nucleases and the pieces are
then taken up by enzymes.
These enzymes use the siRNA to recognize
mRNA with complementary base sequences,
bind to them, and then cut them up before
they can be translated.
The siRNA concept is now being used to try
to turn off expression of genes in plant and
animal cells.
This is done by artificially producing dsRNA
for a target gene so siRNA are produced for
the mRNA for that specific gene. The
presence of the siRNA will not stop
transcription of the gene but it will prevent
translation of the gene so expression does not
occur.
Why would it be of interest in preventing
expression of a plant or animal gene?
27
mRNA Processing Control
1. Adding the poly adenine tail  site of
addition of the adenine tail can influence
the function of the protein.
2. mRNA splicing  site of intron removal
can make an active or inactive mRNA.
3. Differences in splicing of the exons can
result in different transcripts.
Example: variation in polypeptide sequence
of a protein in muscle tissue depending on the
type of muscle tissue. Same gene but slightly
different protein product depending of the
exons that are spliced together.
mRNA transport control
1. Delay of transport or prevention of
transport of the mRNA out of the nucleus
will determine if and/or when translation
will occur
28
Translation control
1. The availability of ribosomes will affect the
rate of translation.
2. Rate of mRNA degradation will determine
the amount of protein that is translated.
29