* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Chromosomes Key - Iowa State University
Epigenetic clock wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Genome (book) wikipedia , lookup
Epigenetics in learning and memory wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Transposable element wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Epigenetics of human development wikipedia , lookup
DNA profiling wikipedia , lookup
Epigenetics wikipedia , lookup
DNA polymerase wikipedia , lookup
SNP genotyping wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Genome evolution wikipedia , lookup
X-inactivation wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Nutriepigenomics wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Primary transcript wikipedia , lookup
Human genome wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Designer baby wikipedia , lookup
DNA vaccination wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Point mutation wikipedia , lookup
Cancer epigenetics wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Molecular cloning wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Genomic library wikipedia , lookup
Genome editing wikipedia , lookup
Microevolution wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Microsatellite wikipedia , lookup
Epigenomics wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Non-coding DNA wikipedia , lookup
Neocentromere wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Deoxyribozyme wikipedia , lookup
History of genetic engineering wikipedia , lookup
DNA supercoil wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Helitron (biology) wikipedia , lookup
DNA & Chromosomes Supplemental Instruction Iowa State University Leader: Course: Instructor: Date: Lilli Howard BIOL/GEN 313 Dr. Myers 01/23/14 1. If a specie's genome consists of 6,300,000 base pairs, how many genes does it contain? a) 6,300,000 b) < 6,300,000 c) > 6,300,000 d) 0 2. About how many base pairs does a human genome contain? a) 3.1 billion b) 3.1 million c) 3.1 trillion d) 3.1 thousand 3. When relaxed DNA (10.4 bp/turn) becomes either under or over-coiled it is called what? a) mega-coiled b) coiled-coils c) super-coiled d) ultra-coiled The coiling in question 3 is caused by what type of protein? _topoisomerase___ 4. Prokaryotic chromosomes are different than Eukaryotic chromosomes because: a) they are single stranded b) they are located in the nucleus c) they are circular 5. Explain the difference between a nucleosome and a chromatosome. a) What are three other orders of condensation in chromatin? Nucleosome: DNA + 8 core histones (two each of H2A, H2B, H3 & H4) Chromatosome: DNA + 8 core histones + H1 histone -30 nm fiber, 250 nm fiber, chromosome 6. During cell division spindle fibers attach to the chromosome at the _centromere__. __kinetochore__ proteins also assemble at this point. 7. The DNA sequence at the end of chromosomes that consists of -CCC(A/T)- repeats is called what? Why are these important? Telomere – stabilize chromosome; play role in aging 8. Single copy sequences HFD 9. Gene families HB 10. Moderately repetitive GA 11. Highly repetitive EC a) 100 – several thousand copies b) 2 – 4 copies c) 10,000 – 1,000,000 copies d) present only once e) < 10 bp f) 1,000 – 10,000 bp g) 150 – 350 bp h) < 5% of genome 12. In epigenetic modification, alteration of the chromosome structure effects (genotype/phenotype) and the DNA base sequence (is/is not) changed. 13. What is the meaning of the phrase, “chromatin structure is dynamic”? -must dissociate for gene activity -bases must be accessible -different genes are active at different times and tissues -DNase sensitivity 1060 Hixson-Lied Student Success Center 515-294-6624 [email protected] http://www.si.iastate.edu Assigned Problems p. 318-320 3. Describe the composition and structure of the nucleosome. How do core particles differ from chromatosomes? -Core particle + ~145 bp -Chromatosome + H1 + ~145 bp 4. Describe in steps how the double helix of DNA, which is 2 nm in width, gives rise to a chromosome that is 700 nm in width. 1. 2. 3. 4. linear DNA Nucleosomes Chromatosomes 30 nm fiber 5. 250 nm Fiber 6. 700 nm Fiber 7. Chromosome 26. Suppose you examined polytene chromosomes from the salivary glands of fruit fly larvae and counted the number of chromosomal puffs observed in different regions of DNA. 1. Would you expect to observe more puffs from euchromatin or from heterochromatin?Why? Euchromatin is less condensed and capable of being transcribed Heterochromatin is highly condensed and rarely transcribed Chromosomal puffs are sites of active transcription 2. Would you expect to observe more puffs in unique-sequence DNA, moderately repetitive DNA, or in repetitive DNA? Why? Highly repetitive DNA is simple tandem repeats and is rarely transcribed Moderately repetitive DNA is transposons and also rarely transcribed Most actively transcribed genes occur in single unique-sequence DNA 31. Which of the following two molecules of DNA has the lower melting temperature. Why? AGTTACTAAAGCAATACATC TCAATGAT TTCGTTATGTAG because more AT bonds AGGCGGGTAGGCACCCTTA TCCGCCC ATCCG TGGGAAT 1060 Hixson-Lied Student Success Center 515-294-6624 [email protected] http://www.si.iastate.edu