Download Chromosomes Key - Iowa State University

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Epigenetic clock wikipedia , lookup

Zinc finger nuclease wikipedia , lookup

DNA repair wikipedia , lookup

Genome (book) wikipedia , lookup

DNA wikipedia , lookup

Epigenetics in learning and memory wikipedia , lookup

Polycomb Group Proteins and Cancer wikipedia , lookup

Transposable element wikipedia , lookup

Mitochondrial DNA wikipedia , lookup

Epigenetics of human development wikipedia , lookup

DNA profiling wikipedia , lookup

Epigenetics wikipedia , lookup

DNA polymerase wikipedia , lookup

SNP genotyping wikipedia , lookup

Mutagen wikipedia , lookup

Site-specific recombinase technology wikipedia , lookup

Genome evolution wikipedia , lookup

X-inactivation wikipedia , lookup

Replisome wikipedia , lookup

Comparative genomic hybridization wikipedia , lookup

Nutriepigenomics wikipedia , lookup

No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup

Bisulfite sequencing wikipedia , lookup

Gene wikipedia , lookup

Primary transcript wikipedia , lookup

Human genome wikipedia , lookup

DNA damage theory of aging wikipedia , lookup

Designer baby wikipedia , lookup

DNA vaccination wikipedia , lookup

Gel electrophoresis of nucleic acids wikipedia , lookup

Point mutation wikipedia , lookup

Cancer epigenetics wikipedia , lookup

Polyploid wikipedia , lookup

United Kingdom National DNA Database wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

Karyotype wikipedia , lookup

Molecular cloning wikipedia , lookup

Genealogical DNA test wikipedia , lookup

Genomic library wikipedia , lookup

Genome editing wikipedia , lookup

Microevolution wikipedia , lookup

Cell-free fetal DNA wikipedia , lookup

Genomics wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Microsatellite wikipedia , lookup

Epigenomics wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

Non-coding DNA wikipedia , lookup

Neocentromere wikipedia , lookup

Nucleic acid double helix wikipedia , lookup

Deoxyribozyme wikipedia , lookup

History of genetic engineering wikipedia , lookup

Chromosome wikipedia , lookup

DNA supercoil wikipedia , lookup

Extrachromosomal DNA wikipedia , lookup

Helitron (biology) wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Nucleosome wikipedia , lookup

Transcript
DNA & Chromosomes
Supplemental Instruction
Iowa State University
Leader:
Course:
Instructor:
Date:
Lilli Howard
BIOL/GEN 313
Dr. Myers
01/23/14
1. If a specie's genome consists of 6,300,000 base pairs, how many genes does it contain?
a) 6,300,000
b) < 6,300,000
c) > 6,300,000
d) 0
2. About how many base pairs does a human genome contain?
a) 3.1 billion
b) 3.1 million
c) 3.1 trillion
d) 3.1 thousand
3. When relaxed DNA (10.4 bp/turn) becomes either under or over-coiled it is called what?
a) mega-coiled
b) coiled-coils
c) super-coiled
d) ultra-coiled
The coiling in question 3 is caused by what type of protein? _topoisomerase___
4. Prokaryotic chromosomes are different than Eukaryotic chromosomes because:
a) they are single stranded
b) they are located in the nucleus
c) they are circular
5. Explain the difference between a nucleosome and a chromatosome.
a) What are three other orders of condensation in chromatin?
Nucleosome: DNA + 8 core histones (two each of H2A, H2B, H3 & H4)
Chromatosome: DNA + 8 core histones + H1 histone
-30 nm fiber, 250 nm fiber, chromosome
6. During cell division spindle fibers attach to the chromosome at the _centromere__.
__kinetochore__ proteins also assemble at this point.
7. The DNA sequence at the end of chromosomes that consists of -CCC(A/T)- repeats is
called what? Why are these important?
Telomere – stabilize chromosome; play role in aging
8. Single copy sequences HFD
9. Gene families HB
10. Moderately repetitive GA
11. Highly repetitive EC
a) 100 – several thousand copies
b) 2 – 4 copies
c) 10,000 – 1,000,000 copies
d) present only once
e) < 10 bp
f) 1,000 – 10,000 bp
g) 150 – 350 bp
h) < 5% of genome
12. In epigenetic modification, alteration of the chromosome structure effects
(genotype/phenotype) and the DNA base sequence (is/is not) changed.
13. What is the meaning of the phrase, “chromatin structure is dynamic”?
-must dissociate for gene activity
-bases must be accessible
-different genes are active at different times and tissues
-DNase sensitivity
1060 Hixson-Lied Student Success Center  515-294-6624  [email protected]  http://www.si.iastate.edu
Assigned Problems p. 318-320
3. Describe the composition and structure of the nucleosome. How do core particles differ
from chromatosomes?
-Core particle + ~145 bp
-Chromatosome + H1 + ~145 bp
4. Describe in steps how the double helix of DNA, which is 2 nm in width, gives rise to a
chromosome that is 700 nm in width.
1.
2.
3.
4.
linear DNA
Nucleosomes
Chromatosomes
30 nm fiber
5. 250 nm Fiber
6. 700 nm Fiber
7. Chromosome
26. Suppose you examined polytene chromosomes from the salivary glands of fruit fly larvae
and counted the number of chromosomal puffs observed in different regions of DNA.
1. Would you expect to observe more puffs from euchromatin or from
heterochromatin?Why?
Euchromatin is less condensed and capable of being transcribed
Heterochromatin is highly condensed and rarely transcribed
Chromosomal puffs are sites of active transcription
2. Would you expect to observe more puffs in unique-sequence DNA, moderately
repetitive DNA, or in repetitive DNA? Why?
Highly repetitive DNA is simple tandem repeats and is rarely transcribed
Moderately repetitive DNA is transposons and also rarely transcribed
Most actively transcribed genes occur in single unique-sequence DNA
31. Which of the following two molecules of DNA has the lower melting temperature. Why?
AGTTACTAAAGCAATACATC
TCAATGAT TTCGTTATGTAG
because more AT bonds
AGGCGGGTAGGCACCCTTA
TCCGCCC ATCCG TGGGAAT
1060 Hixson-Lied Student Success Center  515-294-6624  [email protected]  http://www.si.iastate.edu