Download Mitochondria tutorial

Mining Genomes: Designing Biotechnology Experiments.
Introduction
You have studied a number of modern genetics techniques, including cloning and the
polymerase chain reaction (PCR). In this tutorial you will be introduced to a variety of
sites that researchers use in planning and carrying out experiments that use these
techniques. You will plan two different experiments that allow you to clone a new
thermostable DNA polymerase from an organism whose genome has recently been
sequenced. First, you'll identify restriction enzymes that would allow you to isolate and
clone the polymerase. Next, you'll learn how to design and evaluate PCR primers that
would allow you to amplify the desired gene.
Objectives
- to further introduce widely used techniques such as plasmid cloning and the polymerase
chain reaction
- to introduce some of the features of Web sites managed by some of the major suppliers
of biotechnology reagents
- to introduce the principles and some of the programs that are used for PCR primer
design and restriction enzyme mapping
Tutorial
PCR reactions are frequently carried out using a DNA polymerase from a thermophilic
(high-temperature-loving) bacterium named Thermus aquaticus. T. aquaticus was
originally isolated from a hot spring in Yellowstone National Park, and has subsequently
been shown to be widely distributed -- for example, you could probably isolate this
organism from your hot water heater. The DNA polymerase from this organism (Taq
DNA polymerase) is used because it can withstand the temperature fluctuations that are
required for PCR reactions to proceed. The production of this enzyme is so widespread
that it now represents a billion-dollar-a year industry! However, Taq DNA polymerase
has a disadvantage for some applications of PCR in that, at a relatively high frequency, it
sometimes adds a non-complementary nucleotide to the newly synthesized strand. This
is due to the fact that Taq DNA polymerase has 5' 3' polymerase activity but does not
have a proofreading function that many DNA polymerase enzymes possess (a 3' 5'
exonuclease function).
In the first part of this project, you will use several different sites to design a cloning
project in which you clone the thermostable DNA polymerase from another thermophilic
organism whose complete genome was recently sequenced. This organism is an
Archaeon named Pyrococcus abyssi. P. abyssi was isolated from samples taken close to
a hot spring situated 3500 meters deep in the Pacific ocean. This interesting organism is
highly adapted to growth in the deep hot environment from which it was isolated, and
grows optimally at 103°C (above boiling, at sea level!) and 200 atmospheres pressure.
You will retrieve the relevant sequence of the organism and then identify restriction
enzymes that might be used to clone the DNA polymerase. In the second part of this
project, you will design PCR primers that would allow you to amplify a portion of this
gene.
Outline of first project: Cloning of DNA polymerase from Pyrococcus abyssi
To refresh your memory as to how cloning works, click here to see a figure that depicts a
simplified schematic of plasmid cloning.
http://www.ornl.gov/hgmis/publicat/primer/fig11a.html
In this figure, the gray plasmid DNA was cut with the same restriction enzyme that the
DNA to be cloned was cut with. Class II restriction enzymes cut at specific DNA
sequences, and some of these enzymes cut the DNA in a staggered fashion, thus leaving
overhanging single-stranded regions at the ends. As a result of being cut with the same
restriction enzyme, both DNA molecules have complementary single-stranded overhangs,
and therefore can be joined into a single recombinant DNA molecule.
Cloning of DNA polymerase from P. abyssi can be broken down into several steps that
would be similar for the cloning of any sequence from any organism. The steps of this
process include:
1. Retrieving the target sequence and the adjacent nucleotide sequences;
2. Identifying a restriction enzyme that cuts on either side of the target sequence, but not
in the middle of the sequence;
3. Digesting genomic DNA from Pyrococcus abyssi with the restriction enzyme
identified in #2;
4. Isolating the restriction fragment of the correct size using agarose gel electrophoresis;
5. Digesting a plasmid cloning vector with the same restriction enzyme, or a restriction
enzyme that generates identical sticky ends;
6. Ligating the isolated fragment into the plasmid; transforming Escherichia coli with the
ligation mix; and selecting colonies that are derived from bacteria transformed with the
desired recombinant plasmid.
In this project we will be focusing on the first two steps.
Retrieving the sequence of DNA polymerase from Pyrococcus abyssi
We will begin by retrieving the sequence that encodes DNA polymerase I from P. abyssi.
Although there are several different ways that we could get this sequence, we will use a
genomics resource maintained by The Institute for Genomic Research (TIGR) called the
Comprehensive Microbial Resource (CMR). The CMR is a tool that provides access to
all of the bacterial genome sequences completed to date. Let's begin by going to TIGR's
CMR homepage at
http://www.tigr.org/tigr-scripts/CMR2/CMRHomePage.spl
Scroll down the page. As you can see, there are many different programs for analyzing
genomic sequences here. We will explore some of these programs more fully in another
Mining Genomes tutorial. For now, though, we want to focus on getting the sequence of
DNA polymerase I (and the adjacent sequences on either side) from Pyrococcus abyssi.
About halfway down the page, there is a pulldown menu labeled Genome Pages. Use this
pulldown menu to select the genome that we are interested in, that of Pyrococcus abyssi
GE5. The homepage for this genome will load after you select the organism name.
There are many different ways of looking at the information contained within a genome.
One way is the circular map that is presented on the right side of the genome homepage.
In this image map, each of the genes is represented, in order, by a colored line. Genes
placed in the outer circle are transcribed on the + strand while genes in the next inner
circle are transcribed on the - strand. Functional RNAs such as tRNAs and rRNAs are
shown on the very inner circles as scattered pink and red lines. The colors of the lines
refer to the function that the gene product plays in the cell, for instance, bright yellow is
for genes involved in DNA replication, brick red for genes that are involved in protein
synthesis, etc.
We want to figure out where the gene encoding DNA polymerase I is located. At the top
of the page there are a number of links, and mousing over these links will display a
description of the programs. To find out where our gene is, select Overview. This will
take you to a page that has links to a large number of different programs that can be used
to analyze this genome. After spending a few moments looking over the available tools,
scroll down to the heading Genome Lists by Category. Under this heading, select Gene
List by Role Category.
This takes you to a page where all of the genes that are present in this organism are listed
in groups according to their function. Scroll down to the DNA metabolism group, and
then select DNA replication, recombination, and repair. This will display a table
listing all of the genes that are involved in these related processes. Scroll down the page
to the bottom of the table, and you will see the gene that we are interested in, DNA
polymerase I. You may recall that in E. coli there are at least three different DNA
polymerases, named DNA pol I, DNA pol II, and DNA pol III. These were named for the
order in which they were discovered. In E. coli, DNA pol I is primarily involved in DNA
repair, DNA pol III is involved in DNA replication, and the function of DNA pol II is
unknown.
To find out where the gene is located, select the link to the gene, labeled PAB1128.
This takes you to a page that summarizes the information known about this gene and its
encoded protein, and which has links for various analysis tools. The relevant part for us
is the box that tells us the coordinates of the gene. Specifically, we are interested in the
fact that this 2313 nucleotide-long gene is encoded by nucleotides 1695183 to 1697495
of the genome (the entire genome is 1765118 nucleotides long).
Now we are going to retrieve that nucleotide sequence, along with a region of nucleotides
on either side of the sequence. Remember, our goal is to identify a restriction enzyme
that will cut on either side of the gene, but not in the center of the gene itself. Once we
retrieve the sequence that we are interested in, we'll use it as the input for a program that
searches for restriction enzyme sites. There are a few different ways that we could get
the sequence data; we'll do it by going to the Pyrococcus abyssi site managed by
Genoscope, the French Government group that sequenced the genome of this organism.
To get to their site, go to the top of the page and select Overview. From the Genome
Overview page, scroll to the bottom of the page and select the (misspelled) link The
Genscope P. abyssi Home Page.
Several different kinds of information could be retrieved from this page; to get the
information that we want, scroll down the page to the area labeled
Sequence retrieval
Retrieve nucleic sequence
We know that we want nucleotides 1695183 to 1697495 of the genome, along with a
region on each side of the gene. 3000 bp on either side of the gene will probably be
sufficient for our purposes, so therefore we want to retrieve nucleotides 1692183 1700495. Enter those two values into the search boxes. The search box should be set
to retrieve From: 1692183 To: 1700495. Then select the Retrieve sequence button.
This will return a very large block of sequence data (As, Cs, Gs and Ts) to you. Looking
at the sequence for a moment will remind you why it is that computers are so useful for
this type of analysis.
Now that we have the sequence we are interested in, we are going to examine it for
restriction enzyme sites. Use your mouse to highlight the nucleotide sequence data,
and then use your browser controls to copy the selected sequence data. We will
paste the copied sequence data into a program designed to search for restriction enzyme
sites.
Identifying the location of restriction enzyme cut sites in the retrieved sequence
There are a variety of programs that we might use to analyze for the presence of
restriction enzyme sites. Many of these programs could be found easily by carrying out
an internet search for 'restriction enzyme mapping' or 'program to find restriction sites' or
something similar. All of these programs do pretty much the same thing, but the types of
output are slightly different from program to program. We'll use one that has a couple of
nice features, which can be found here.
http://arbl.cvmbs.colostate.edu/molkit/mapper/
Scroll down the page to get to the tiny thin white text-entry box, located just above the
three buttons labeled create map, clear DNA, and get demo DNA. Now, paste the
sequence that you retrieved into the white box. Don't worry about changing the spaces
and returns; the program deals with them just fine. Select the Create Map button.
Beneath the white box, on the left-hand side, is a small pull-down menu that is set to the
default 'all restriction enzymes'. There are a lot of different enzymes, and some of them
are pretty difficult (and expensive) to buy, so we will change the setting to Core set of
enzymes. This way the program will only search enzymes that are common, usually
inexpensive, and frequently found on the multiple cloning sites of popular plasmid
cloning vectors.
The program will rapidly analyze the input sequence and return an output of the sequence
(in the white box at the top) and the restriction enzymes present in that sequence (in the
black box below). Remember, our goal is to identify a restriction enzyme that will cut on
either side of the gene, but not in the center of the gene itself. That means that we want a
restriction enzyme that cuts once in between nucleotides 1 and 3000 of our input
sequence, and once between nucleotides 5314 and 8313, but doesn't cut between
nucleotides 3001 and 5313. If you've done everything right so far, then you should be
looking at a figure with the numbers 1 to 8001 across the top.
Let's look at the first three restriction enzymes that are listed: BamHI, BglII, and ClaI.
Let's Restriction enzymes are named for the organism that they were isolated from, for
example, the enzyme Bam H I was isolated from Bacillus amyloliquefaciens strain H, Bgl
II was isolated from Bacillus globigii, and EcoR I was isolated from the organism E. coli
strain R. The number following the three letter code designates the order that the
enzymes were discovered in, i.e, Acc I was the first restriction enzyme isolated from
Acinetobacter calcoaceticus and Acc II was the second.
The positions (numbers) of the nucleotides are shown at the top of the figure in the black
box. The long vertical white lines mark off 1000-base increments, whereas the short
vertical yellow bars show where each restriction enzyme cuts.
Examining the figure, we see that we didn't get lucky with the first three restriction
enzymes. None of these enzymes meet our requirements. The enzyme BamHI cuts the
sequence three times, and though none of these cut sites are in the middle of gene, they
all occur on the right-hand side of the gene sequence. We want one cut site on the lefthand side as well, somewhere between nucleotides 1 -3000. BglII and ClaI only cut
within nucleotides 1-3000, and don't meet our requirement of also cutting between 5314
and 8313.
However, if we scroll down the list, we see that the enzyme EcoRI fulfills all of our
needs --it cuts on either side of the gene sequence but not within the gene sequence itself.
Also, the enzyme XbaI might fulfill our requirements, although it looks like the righthand cut site is very close to the end of the gene sequence, and might even be within that
sequence. Furthermore, the enzyme HincII could also be used to clone our DNA
polymerase gene. Although this restriction enzyme cuts the input sequence multiple
times, it does cut on either side of the gene sequence without cutting within the gene
sequence.
Although it might seem simply that we were lucky in identifying these restriction
enzymes, it should be pointed out that the odds were in our favor. For one thing, modern
cloning vectors contain many unique restriction sites within their polylinkers, or multiple
cloning sites. Also, we are trying to clone a fragment that is about 2000 basepairs long.
Restriction enzymes that recognize six-basepair sequences will cut random DNA
sequences on average once every 4096 basepairs. And of course, if we didn't find a
suitable restriction enzyme within this core group of enzymes, we could have repeated
the analysis using a larger group of enzymes.
Now, let's change the way that the output information is displayed, by selecting the Text
display button above the black box. This changes the output so that it displays the same
information in a different format. Examining this output, we see that EcoRI will cut our
output sequence at positions 781 and 7548, thus creating a 6767-basepair fragment
containing our gene. The enzyme XbaI cuts at positions 2612 and 5312. Position 5312 is
just within our gene sequence, so we probably don't want to use that enzyme after all.
The enzyme HincII will cut at positions 1895 and 5404, thus creating a 3509-basepair
fragment that contains the gene for DNA polymerase I from P. abyssi. It appears that the
enzyme HincII will be the most useful for our purposes.
Cloning - odds and ends
So far, we accomplished our first objective -- we identified a restriction enzyme that
would allow us to isolate and clone the gene for DNA polymerase I from P. abyssi. In the
next part of this tutorial we will design PCR primers that would allow us to amplify a
region of the gene using the polymerase chain reaction. Assuming that you are the
curious sort, however, you no doubt have some questions about the cloning project that
we've been working on. Let's address some of the obvious questions briefly, before
moving on.
Obvious question 1. Where can we get the restriction enzyme HincII?
Obvious question 2. How do we find a cloning vector that has a single HincII site in it?
Obvious question 3. How can we get genomic DNA from Pyrococcus abyssi?
The answers to the first two questions can be found by searching the websites of some of
the companies that supply biotechnology reagents to researchers. These sites are
keyword-searchable and will contain lots of information on available cloning vectors and
restriction enzymes. Some of these companies are listed in the table below (there are
many others, several of which provide excellent products and service).
Company
Amersham Life Science
Ambion
Bio-Rad Laboratories
Clontech laboratories
Invitrogen
New England Biolabs
Promega
Quiagen
Website
http://www.amersham.com
http://www.ambion.com
http://www.biorad.com
http://www.clontech.com
http://www.invitrogen.com
http://www.neb.com
http://www.promega.com
http://www.qiagen.com
To give you a feel for this, we'll go to the Promega site's technical services page here.
http://www.promega.com/techserv/Default.htm
On this page you can see links to many of the different products available from Promega,
including restriction enzymes and cloning vectors. Select the link to Vectors. From the
list of vectors available, select Cloning vectors. Because we are interested in finding a
cloning vector that we can clone a 3509-basepair HincII fragment into, we want to scroll
down to the middle of the list to the cloning vectors such as pGEM 1 and pGEM 2, etc.
On the right-hand side of the table we see the MCS enzymes listed (MCS = multiple
cloning site). HincII can be used to clone into any of these pGEM plasmids. With a little
searching you will see that both the cloning vector and the restriction enzyme can be
ordered from this company for ~$100.
So that gets us to the third question, where can you get a sample of Pyrococcus abyssi? It
turns out that this might take some effort. Most microorganisms have been deposited in
one of two international collections, The American Type Culture Collection or its
German counterpart, the Deutsche Sammlung von Mikroorganismen und Zellkulturen.
However, as of this writing, neither of these collections had a sample of P. abyssi
available for purchase. This means that you would probably have to directly contact one
of the researchers working with this organism, and ask them to send you a sample of the
organism or its DNA. This type of free exchange of materials and organisms is standard,
and a hallmark of contemporary scientific inquiry.
Project 2 - Designing PCR primers
The polymerase chain reaction (PCR) is a rapid means of making numerous copies of a
specific target DNA sequence. It has a wide variety of uses, from diagnostic (i.e., is a
particular pathogen present in a given biopsy/hamburger/mayonnaise sample?) to
forensic (i.e., whose sperm is on the blue dress? are Sally Hemming's descendants
genetically related to Thomas Jefferson's descendants?) to a variety of research
applications, including DNA sequencing, cloning, and site-specific mutation. The
diversity of applications derive from the ability of PCR to: a) distinguish a specific target
sequence from a large excess of background, non-target sequences, and b) produce a
large number of copies of a specific sequence from a very small initial amount (as low as
a single molecule of the target sequence). The extreme specificity and sensitivity of PCR
have allowed it to be used to amplify and clone DNA from such sources as mummified
human tissues and samples of extinct plants and animals.
The specificity of a PCR reaction results from the use of specific primers. Primers are
short (20-30 bases), single-stranded, synthetically-made polynucleotides that are
complementary to the sequences flanking the target sequence.
In a PCR reaction, a target DNA sample is mixed with two different primers. This
mixture is heated to denature the double-stranded target DNA. When the mixture is then
cooled, the primers can ‘anneal’ to the sequences that they are complementary to, that is,
they can form a double-stranded DNA molecule consisting of the primer hydrogenbonded to a complementary target DNA sequence. The primer thus provides a 3’-OH
group for the DNA polymerase, and a copy of the region adjacent to the primer-bindingsite can be synthesized.
Characteristics of good PCR primers
In general, useful PCR primers should have the following characteristics.
Specific - will bind only to the target sequence. Thus, you want primers that are perfectly
complementary to your target but not complementary to any other sites on the template
DNA. It is also important that the primers don't have regions that are self-complementary
(which will form secondary structures) or where one primer is complementary to the
other primer (which will cause primer-dimers).
Proper length - length will affect the probability that they will bind to other sites on the
template, and it will affect the Tm (see below). Usually primers between 17 and 26
nucleotides are used.
Proper melting temperature. (Tm). The Tm of the two primers should be about the same.
Also, the Tm should be 55 °C or above to provide an annealing temperature of 50°C or
more. Note: you may be wondering what the heck Tm means -- click Next for details.
The Tm of a DNA molecule is a value that reflects the stability of that molecule. For
example, if you were to slowly increase the temperature of a solution containing a
double-stranded DNA molecule, then a more stable molecule would retain its doublestranded form at a higher temperature than would a less stable molecule. Specifically, Tm
is defined as the temperature at which 50% of a given oligonucleotide is in doublestranded form. The stability is a result of many features of the DNA molecule, such as
length (long molecules are more stable) and percent G + C nucleotides (high G+C
molecules are more stable, because G-C pairs are held together by three hydrogen bonds
while A-T pairs are held together by only two). The Tm is also affected by the salt
concentration of the reaction solution, because DNA duplexes are more stable at higher
cation concentrations.
The Tm of DNA molecules is a very important concept in many biotechnology
procedures, including PCR reactions, in situ hybridizations, and Southern and Northern
hybridizations. It can be calculated from the sequence of the oligonucleotide, and in fact
most PCR primer-design software and probe-design software will calculate the value for
you. For our purposes just remember 55°C or above, and about the same value for each
of the two primers.
If you are interested, more information on the theory of primer design can be found at:
http://www.brinkmann.com/PCR_appl_primer.asp
Designing PCR primers to amplify DNA polymerase I from P. abyssi
There are a variety of programs that we might use to design PCR primers. Many of these
programs could be found easily by carrying out an internet search for 'PCR primer design'
or something similar. All of these programs do pretty much the same thing, but the
sophistication of the analysis and the types of output are slightly different from program
to program. A list of these programs can also be found at:
http://www.cbi.pku.edu.cn/help/pd.html
We'll use one that has a couple of nice features, called Web Primer, at Stanford
University. Go to this site by clicking here.
http://genome-www2.stanford.edu/cgi-bin/SGD/web-primer
When we were looking for restriction enzymes to use in cloning the DNA polymerase I
from P. abyssi, we used the gene sequence and 3000 bp of the sequence flanking either
side of the gene. For our purposes, we won't target an area that big for our PCR
reactions. In fact, let's simply use the gene sequence itself. For most applications, we
won't need to amplify the whole gene, anyway. You could retrieve the gene sequence
from the Genoscope site that we visited earlier, or you could simply copy it from here.
ATGATAATCGATGCTGATTACATAACGGAAGATGGCAAGCCGATAATAAG
GATATTCAAAAAGGAAAAGGGAGAGTTTAAGGTAGAATACGATAGGACGT
TTAGACCCTACATTTATGCTCTTTTAAAGGATGATTCGGCCATAGATGAG
GTTAAGAAGATAACCGCCGAGAGGCACGGAAAGATAGTCAGGATAACCGA
GGTTGAGAAAGTCCAGAAGAAATTCCTAGGAAGGCCAATAGAAGTCTGGA
AGCTCTATCTTGAGCATCCCCAGGATGTTCCAGCCATAAGAGAGAAGATA
AGGGAACATCCAGCTGTAGTTGATATATTTGAATACGACATACCCTTTGC
GAAGCGCTACCTCATAGACAAGGGATTGACTCCAATGGAGGGGAACGAGG
AGCTAACGTTTCTAGCCGTTGATATAGAAACATTGTACCATGAAGGAGAG
GAGTTCGGGAAAGGGCCAATAATAATGATCAGCTACGCCGACGAGGAAGG
GGCCAAGGTGATAACTTGGAAGAGCATAGACTTACCTTACGTTGAAGTGG
TTTCGAGCGAGAGGGAGATGATAAAGAGGCTCGTGAAGGTAATTAGAGAG
AAAGATCCCGACGTGATAATAACGTACAATGGTGATAATTTCGACTTTCC
GTACCTCTTAAAGAGGGCTGAAAAGCTCGGAATAAAGCTCCCCCTTGGAA
GGGACAATAGCGAGCCGAAAATGCAGAGGATGGGGGATTCATTAGCCGTA
GAGATAAAGGGCAGAATACACTTCGATTTATTCCCCGTCATAAGAAGAAC
GATCAACCTTCCAACATACACCCTCGAAGCGGTTTATGAGGCTATATTTG
GAAAGTCTAAGGAGAAAGTCTATGCCCATGAGATAGCTGAGGCCTGGGAA
ACCGGGAAAGGGCTAGAGAGGGTAGCTAAGTATTCAATGGAAGATGCGAA
GGTAACCTTTGAGCTCGGAAAGGAGTTCTTCCCGATGGAAGCCCAGCTAG
CTAGGCTCGTTGGCCAGCCAGTTTGGGACGTTTCAAGGTCGAGCACCGGA
AACCTCGTTGAGTGGTTTCTCCTTAGGAAGGCCTACGAGAGAAATGAGCT
CGCGCCCAATAAACCGGACGAGAGGGAATACGAGAGAAGGCTAAGAGAGA
GCTATGAAGGGGGTTACGTTAAGGAGCCAGAGAAGGGATTGTGGGAAGGG
ATAGTCAGCTTAGACTTTAGGTCCCTATATCCCTCTATAATTATAACTCA
CAACGTCTCACCAGACACTTTGAATAGAGAAAATTGCAAGGAATATGACG
TTGCCCCCCAAGTGGGGCACAGATTCTGCAAGGATTTCCCAGGATTCATA
CCAAGCTTACTGGGTAACCTACTGGAGGAGAGACAAAAGATAAAAAAGAG
AATGAAAGAAAGTAAAGATCCCGTCGAGAAGAAACTCCTTGATTACAGAC
AGAGAGCTATAAAAATACTTGCAAACAGCTATTATGGCTATTATGGATAT
GCAAAGGCCAGATGGTACTGTAAAGAGTGTGCAGAGAGCGTAACCGCATG
GGGAAGGCAGTACATAGACCTGGTTAGGAGGGAACTTGAGAGCAGAGGAT
TTAAAGTTCTCTACATAGACACAGATGGCCTCTACGCAACGATTCCTGGA
GCCAAGCATGAGGAAATAAAAGAGAAGGCATTGAAGTTCGTCGAGTACAT
AAACTCCAAGTTACCTGGGCTTCTTGAATTGGAATACGAAGGTTTCTACG
CGAGAGGGTTCTTCGTGACGAAGAAAAAGTACGCACTAATCGACGAGGAA
GGAAAGATAGTTACGAGGGGGCTCGAAATAGTAAGGAGAGATTGGAGTGA
AATAGCAAAGGAGACCCAGGCCAAGGTTCTCGAGGCAATACTCAAGCACG
GTAACGTTGATGAGGCCGTAAAAATAGTAAAGGAGGTTACAGAAAAACTC
AGTAAATATGAAATACCACCCGAAAAGCTTGTAATTTATGAGCAGATAAC
GAGGCCTCTGAGCGAGTATAAAGCGATAGGCCCTCACGTTGCAGTAGCTA
AAAGGCTCGCAGCGAAGGGAGTAAAAGTTAAGCCAGGGATGGTTATCGGT
TACATAGTTTTGAGGGGAGACGGGCCAATAAGCAAGAGGGCCATAGCTAT
AGAGGAGTTCGATCCCAAAAAGCATAAGTACGATGCCGAATACTACATAG
AGAACCAAGTTCTGCCAGCGGTGGAGAGGATATTGAGAGCATTTGGTTAT
CGCAAGGAGGATTTGAAGTATCAAAAAACTAAACAAGTGGGCCTTGGAGC
ATGGCTTAAGTTC
Enter this sequence into the query text box at the Web Primer site. Then, select the
Submit button.
This will take you to a default page for the parameters of PCR primers. As you can see,
most of the default values are very similar to the ones that we discussed above. If you
wish, you can change some of these default values to more closely mimic the parameters
that we described. Then, select the Submit button.
This will return you to a page that, unless the conditions you picked were too stringent,
should describe the 'Best' pair of PCR primers and list a number of different possible
PCR primer sets. Select the Best pair of primer. How does it meet with the criteria that
we described? Is it within the length and Tm range that we described, and are the Tm
values of the two primers about the same? Are there primer pairs within the 'Valid' list
that better meet those criteria? How is the output affected by changing the primer design
parameters?
Ultimately, how 'good' a primer pair is has to do with how well it allows you to amplify
your target sequence from the template DNA that you are using. Because there are many
different factors that affect the ability of primers to produce large amounts of a specific
product, you ultimately need to empirically determine whether or not a particular primer
pair will work or not. That is -- you need to try it and see how well it works. Also, the
thermalcycler program that you use and the reaction conditions dramatically affect the
results of a PCR reaction, and these frequently need to be optimized as well. Sometimes
you need to try out several primer pairs, and several programs, before finding a
combination that works well for a particular application.
As with the reagents for cloning, PCR primers and PCR reagents can be purchased from a
number of different retailers. A pair of PCR primers can usually be purchased for ~ $20
or less.
Also - a meta-site for info related to PCR is at
http://highveld.com/f/findex.html
That brings this tutorial to a close. In this tutorial, you learned about designing and
planning commonplace biotechnology experiments, including plasmid cloning and PCR
primer design. You also learned how to find and retrieve specific sequences from
completed bacterial genomes. Hopefully, you feel a little more comfortable designing
your own experiments now. Also, hopefully this tutorial has helped you to better
visualize both how these experiments work and how researchers go about performing
these techniques. The following questions will help to reinforce and further your
understanding of these principles.
Questions - Review.
1. When discussing restriction enzymes, it was stated that a restriction enzyme with a six
basepair recognition site will cut a random DNA sequence every 4096 basepairs, on
average. Why is that?
2. Primers A and B are each twenty bases long. In primer A, 6 of the bases are A or T
and 14 of the bases are G or C. In Primer B, 10 of the bases are A or T, and ten of the
bases are G or C. Which of the primers has a higher Tm? Why?
Questions - Thought and Application.
1. How many BglII sites are there within the DNA polymerase (Family X) gene of
Thermoplasma volcanium strain GSS1? How many AccI sites?
2. Let's say that you have designed a set of PCR primers to amplify a portion of a human
gene. What bioinformatics programs would you use to test whether or not these primers
were specific for the targeted gene? That is, how could you use in silico approaches to
find out whether or not your primers are complementary to other sites in the human
genome?
Also - a meta-site for info related to PCR is at
http://highveld.com/f/findex.html