Download Test 2 from 2012

GENETICS TEST 2 - FALL 2012
This test has two parts. In Part 1, answer 5 of the 6 questions (15 pts each). Please
indicate the questions you want me to grade. If there is any uncertainty I will grade the
first five. All students must complete Part 2 (25 pts). Part 3 will be team-based, and will
be completed in class on Monday. Parts 1 and 2 together will make up 85% of your test
grade, Part 3 will be worth 15%.
NAME:
PART 1: Short Answer. Answer 5 of the following 6 questions.
Question 1: Glucose-6-phosphate isomerase is an enzyme that is critical to glycolysis.
Part of the amino acid sequence for the wild type glucose-6-phosphate isomerase
enzyme is shown below, along with the same part of the protein as produced by four
mutants, each of which contains a single, different point mutation. For each of the
mutants, give a single DNA base change that could account for the observed change,
and tell whether that change is a missense, nonsense, silent or frameshift mutation. A
codon table can be found at the end of this test.
Wild Type: Met-Glu-Lys-Ser-Ala
Mutant 1: Met-Glu
Mutant 2: Met-Lys-Lys-Ser-Ala
Mutant 3: Met-Glu-Lys-Ser-Ala
Mutant 4: Met-Arg-Glu-Ile-Gly
Question 2: The following DNA sequence is the template/noncoding sequence from a
portion of a eukaryotic gene that codes for amino acids. Introns are underlined and
exons are designated by plain text.
3' ATGAGGACTTAAGGACCTGAGGGGCTGATAAAA 5'
A) Give the sequence of the mRNA that would be produced by this gene
B) If the splice site for the first exon was mutated so that it was no longer functional,
what would you expect the specific impact to be on the resulting mRNA?
C) Do you think this mutation will impact protein function? Explain.
Question 3: The following DNA sequence is that of the coding strand of a gene.
Transcription starts at base 10 in this sequence.
5' ACGTACATACCATATAACCGCTAGATGCACGAAGATCCCGGGTCAACATTTGCATAA 3'
A). Give the first ten bases of the RNA produced by this gene.
B). Give the first 5 amino acids translated from this gene.
C). If a T was inserted at base number 11, what would be the impact on the protein
product? Explain your answer.
Question 5: The biochemical pathway for the synthesis of the color purple in flowers is
shown below:
Colorless
Gene R
Red
Blue
Gene B
Purple
Colorless
What phenotype (color) would you expect flowers to have if they were homozygous for
the following mutations? Explain each answer
1) A down promoter mutation in gene R
2) An up promoter mutation in gene B
3) A frameshift mutation early in gene R
Question 6: Very briefly describe how three different types of point mutations could
impact a phenotype. You do not need to know the names of the different point
mutations, nor the names of specific genetic traits involved. Rather, tell hypothetically
how different types of point mutations could influence phenotypes.
PART TWO: All students must answer this question.
The diagram below is of a Western Blot that shows, in lane 1, Sox9 protein expression
in a normal human male and, in lane 2, Sox9 protein expression in a normal human
female.
1
2
3
4
1). Based on this data, what can you conclude about the expression of Sox9 in normal
human males versus females?
2) SRY is a Y-linked gene that codes for a transcription factor that is required for SOX9
transcription. In Lane 3, draw the Sox9 protein product, if any, that you would expect to
see in a human male who has a nonsense mutation early in their SRY gene. Based on
your conclusions in 1), what sex would you expect this individual to be?
3). Explain your answer to #2
4) In Lane 4, draw the Sox9 protein product, if any, that you would expect to see in a
female who has a Gain of Function mutation that causes male levels of SOX9
expression.
5). Based on your conclusions in 1), what sex would you expect this individual to be?
Explain.