* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download PSI Genes- Homework
Agarose gel electrophoresis wikipedia , lookup
Polyadenylation wikipedia , lookup
Maurice Wilkins wikipedia , lookup
Holliday junction wikipedia , lookup
RNA silencing wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Community fingerprinting wikipedia , lookup
Biochemistry wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Messenger RNA wikipedia , lookup
Molecular cloning wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Molecular evolution wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Point mutation wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Non-coding DNA wikipedia , lookup
Expanded genetic code wikipedia , lookup
DNA supercoil wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Non-coding RNA wikipedia , lookup
Gene expression wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Epitranscriptome wikipedia , lookup
Genetic code wikipedia , lookup
Genes Class Work 1. Name the four nucleotide bases found in DNA. 2. What shape does a DNA molecule form? 3. What kind of bond is found between complementary bases on two separate strands of DNA? 4. What is another name for the new strand of DNA? 5. Name the process that allows for more DNA copies to be made. 6. What kind of molecule is found at the 5’ end of DNA? 7. In which direction is the template strand read during DNA replication? 8. For each parent strand of DNA below, write the complementary daughter strand and indicate the direction in which replication was performed. a. 5’ CTTAGCATA 3’ b. 5’ AAACCTGTT 3’ c. 3’ CGATTGGCC 5’ d. 3’ TGTGCGATC 5’ Homework 9. Name the two sets of complementary base pairs in DNA. 10. What kind of bond holds a single strand of DNA together? 11. What is another name for the template strand of DNA? 12. Name the enzyme that adds each new nucleotide to the growing strand of DNA. 13. What kind of molecule is found at the 3’ end of DNA? 14. In which direction are the new DNA strand synthesized? 15. Explain why DNA replication is known as a semi-conservative process. 16. For each daughter strand below, write the complementary parent strand of DNA and indicate the direction in which replication was performed. a. 3’ GGCTTAACG 5’ b. 5’ CCTATGGCC 3’ c. 3’ AACTATTCC 5’ d. 3’ TTAAGCTTA 5’ Class Work 17. List the four nucleotide bases found in RNA. 18. What is another name for the portion of DNA that contains the code for making protein? 19. Which DNA strand contains the genes, the template or the non-template strand? 20. In which direction is the RNA strand synthesized? 21. In which direction is the DNA template strand read? 22. Compare and contrast DNA replication with transcription. 23. List the three steps of transcription. 24. What is the function of RNA polymerase in transcription? 25. For each DNA strand below, write the bases of the transcribed RNA strand. Also, indicate the direction of transcription. a. 5’ TTTACCGGA 3’ b. 5’ AACCGTCAG 3’ c. 3’ ACGATTAAC 3’ Homework 26. Name the two sets of complementary base pairs in RNA. 27. What is transcription? 28. Which DNA strand is used in transcription? 29. What kind of molecule is found at the 5’ end of RNA? 30. What kind of molecule is found at the 3’ end of RNA? 31. What occurs during initiation? 32. What occurs during elongation? 33. What occurs during termination? 34. For each DNA strand below, write the bases of the transcribed RNA strand. Also, indicate the direction of transcription. a. 3’ AACGATTTC 5’ b. 3’ TATACCGAT 5’ c. 5’ CCGACCGTA 3’ Class Work 35. What is a gene? 36. How many pieces of information can codons specify? 37. What is the difference between the codons on DNA and those on RNA? 38. How many codons code for an amino acid? 39. Using the Universal Genetic Code from the notebook presentation, tell what each codon below codes for. a. UGA b. GAU c. GUU d. CCU e. ACG 40. What two processes are needed to make the information contained in DNA usable by a cell? 41. Name the two scientists that discovered the structure of DNA. Homework 42. Define gene expression. 43. What is the name of the three-letter code on DNA or mRNA that specifies an amino acid? 44. Why is the list of 64 codons referred to as “The Universal Genetic Code”? 45. Three of the sixty-four codons do not code for an amino acid, but do what? 46. The codon that codes for the amino acid methionine is also what special codon? 47. Using the Universal Genetic Code from the notebook presentation, tell what each codon below codes for. a. UUA b. UUC c. AUG d. AAA e. CCA 48. What is the “Central Dogma” of biology? Class Work 49. List the three different types of RNA and their abbreviations. 50. Where is rRNA found? 51. Describe the function of a ribosome. 52. What is the shape of a tRNA? 53. Explain the significance of the wobble position on tRNA. 54. All proteins are created from combinations of how many different amino acids? Homework 55. What is the specific type of RNA that carries the code for proteins? 56. True or False: The central dogma is a circular process. Explain. 57. Describe the structure of a ribosome. 58. Describe the function of tRNA? 59. Identify and describe two significant places on tRNA. Class Work 60. List the three steps of translation. 61. What happens at the P site and A site of the ribosome? 62. What is always the first codon on mRNA? 63. What is always the first anti-codon on the tRNA? 64. What kind of bond does the ribosome catalyze between amino acids? 65. When does termination occur? Homework 66. Define translation. 67. List the four essential pieces needed for translation to occur. 68. During initiation, what occurs between the ribosome and mRNA? 69. On which end of the mRNA strand does translation start? 70. What is always the first amino acid in translation? 71. What happens to the first tRNA after it delivers methionine into the ribosome? 72. What occurs during elongation? 73. What occurs in termination? 74. What is the end product of translation? Free Response 1. DNA and RNA are both important nucleic acids responsible for the storage and transfer of genetic information. a. Identify three differences between the structure of DNA and RNA. b. Compare and contrast DNA replication and transcription. 2. DNA replication is essential for the ability of cells to replicate while still containing all of the necessary genetic information. 5’ ACGTAGATTACG 3’ a. For the parent strand of DNA above, write the daughter strand that DNA replication would create and indicate the direction of synthesis. b. What enzyme is responsible for bringing nucleotides to the growing strand? c. Why is DNA replication known as a “semi-conservative” process? 3. The steps that lead to gene expression are also known as the Central Dogma of biology and provide the basis of life. a. Explain what gene expression is. b. Explain why changes in RNA or protein do not affect DNA. c. How would a change in DNA affect protein synthesis? Be specific. 4. Transcription and translation are the main processes of the Central Dogma of biology. a. List and briefly explain the steps of transcription. b. Identify the end product of transcription. c. List and briefly explain the steps of translation. d. Identify the end product of translation. 5. Although the three main types of RNA are made through transcription, only one contains the codons for protein synthesis. a. Identify the three main types of RNA by their whole names. b. Identify and describe the two significant parts of tRNA. c. Describe the function of mRNA, ribosomes, and tRNA during translation. 6. Use the two strands of DNA below to answer the questions. 5’ ATGTTCCAGGATCCCTGATAA 3’ 3’ TACAAGGTCCTAGGGACTATT 5’ a. If the top strand of DNA contains the genes, write the expected product of transcription. Label the 5’ and 3’ ends and the direction of synthesis. b. Draw a box around each codon. Then, using your synthesized strand of mRNA and the Universal Genetic Code, write the expected product of translation. Genes-Answers 1. 2. 3. 4. 5. 6. 7. 8. Adenine, Guanine, Thymine, Cytosine Double helix Hydrogen Bonds Daughter strand DNA replication Phosphate group 3’ to 5’ direction a. 3’ GAATCGTAT 5’ made right to left b. 3’ TTTGGACAA 5’ made right to left c. 5’ GCTAACCGG 3’ made left to right d. 5’ ACACGCTAG 3’ made left to right 9. adenine to thymine; guanine to cytosine 10. covalent bonds 11. parent strand 12. DNA polymerase 13. Sugar group 14. 5’ to 3’ direction 15. Each new DNA double helix contains one “old” strand from the original DNA molecule and one “new” synthesized strand. So each new helix has a parent strand and a daughter strand. 16. a. 5’ CCGAATTGC 3’ made right to left b. 3’ GGATACCGG 5’ made left to right c. 5’ TTGATAAGG 3’ made right to left d. 5’ AATTCGAAT 3’ made right to left 17. Guanine, Cytosine, Adenine, Uracil 18. Gene 19. Non-template strand 20. 5’ to 3’ 21. 3’ to 5’ 22. DNA replication results in two new daughter strands, and transcription only results in one new RNA strand. DNA replication synthesizes the whole DNA strand, transcription makes RNA only from the DNA strand with the genes. In DNA replication adenine pairs with thymine, in transcription the adenine on DNA pairs with uracil on RNA. Both processes synthesis DNA and RNA respectively in the 5’ to 3’ direction. 23. Initiation, Elongation, Termination 24. Attaches to the promoter sequence on DNA, brings the RNA nucleotides to the DNA, unwinds the DNA double helix, and recognizes the stop sequence on DNA 25. a. 3’ AAAUGGCCU 5’ made right to left b. 3’ UUGGCAGUC 5’ made right to left c. 5’ UGCUAAUUG 3’ made left to right 26. Adenine to Uracil; Guanine to Cytosine 27. The process by with RNA is synthesized from DNA 28. Template strand 29. Phosphate group 30. Sugar group 31. RNA polymerase attaches at the promoter sequence on DNA 32. RNA polymerase moves down the DNA while unwinding it and reads the bases of DNA and brings in the new complementary RNA bases 33. RNA polymerase reaches a stop sequence and falls off the DNA. The new RNA strand separates from DNA. The DNA strands reform their double helix. 34. a. 5’ UUGCUAAAG 3’ made left to right b. 5’ AUAUGGCUA 3’ made left to right 35. The sequence of DNA that codes for protein 36. 64 37. Codons on DNA contain Thymine and condons on RNA contain Uracil 38. 61 39. a. stop b. aspartic acid c. valine d. proline e. threonine 40. transcription and translation 41. Watson and Crick 42. The process of taking the code of nucleic acids and making the product for it in amino acids, leading to proteins 43. Codon 44. Every organism uses the same 64 codons. The codes is the same for everything, it is the results that are different. 45. They are STOP codons, they signal the end of translation 46. It is a START codon, it signals the start of translation 47. a. Leucine b. Phenylalanine c. Methionine- START d. Lysine e. Proline 48. The idea that DNA is transcribed to make RNA, which is then translated to make protein. 49. Messenger RNA or mRNA, transfer RNA or tRNA, ribosomal RNA or rRNA 50. In ribosomes 51. It helps make covalent bonds between the amino acids 52. T-shaped 53. The wobble position is the third position on the tRNA’s anticodon site and can violate the complementary base pairing rules. It is typically the first two letters that specify the amino acid 54. 20 55. mRNA 56. False, changes in mRNA or in protein do not affect the DNA. The central dogma proceeds from DNA to RNA to protein and does not circle back to DNA. 57. The ribosome has a small subunit and a large subunit and is made of rRNA and protein 58. To transfer amino acids from the surrounding area to the ribosome 59. The amino acid attachment site is where the specified amino acid will attach to the tRNA. The anticodon loop is the three base sequence that is complementary to the codon on the mRNA 60. Initiation, elongation, termination 61. The P site is where the new protein emerges from and the A site is where the amino acids are delivered to 62. AUG 63. UAC 64. Covalent bonds 65. When the ribosome reaches a STOP codon 66. Translation is the process by which the mRNA code is used to create protein 67. Amino acids, tRNA, mRNA, rRNA 68. The mRNA becomes sandwiched between the large and small subunits of the ribosome at the start codon. 69. 5’ 70. methionine 71. The first tRNA leaves the ribosome so the next tRNA can enter. 72. The ribosome moves the mRNA using energy and new amino acids are continually added by new tRNA molecules. Each new tRNA moves from the A site to the P site and then leaves the ribosome. 73. Termination occurs when the ribosome reaches a stop codon. The ribosome subunits separate from the mRNA and the protein is released. 74. A protein in its primary sequence Free Response Answers 1. a. DNA is made of the sugar deoxyribose, contains the base thymine, is double stranded, is helix shaped. RNA is made of the sugar ribose, contains the base uracil, is single stranded, can be many different shapes. b. In both DNA replication and transcription the new DNA strands and the new RNA strand respectively are synthesized in the 5’ to 3’ direction. In DNA replication both DNA strands are replicated, in transcription only the template strand is transcribed. DNA replication pairs adenine from one DNA strand with thymine on the new DNA strand, and in transcription adenine from the template DNA strand is paired with uracil on the new RNA strand. In DNA replication two new DNA molecules containing one parent and one daughter strand each are produced. In transcription only one new RNA strand is produced. 2. 3. 4. a. 3’ TGCATCTAATGC 5’ synthesized from right to left b. DNA polymerase c. It is semi-conservative because each new DNA molecule contains one parent strand and one daughter strand. a. Gene expression is the process of taking the code from DNA and transcribing it into mRNA, and then into the amino acids or proteins. b. Changes in RNA and protein do not affect DNA because the process of gene expression is not circular and is unidirectional. c. A change in DNA would result in a changed code for protein, so that the codons in mRNA would be altered, and therefore the amino acids coded for would be different. A change in the sequence of amino acids results in a change of the primary structure of protein, which would result in changes to the secondary and tertiary structure, and therefore the function of the protein. a. The steps of transcription are initiation, elongation, and termination. In initiation, the RNA polymerase attaches to the DNA template strand at the promoter sequence. In elongation, the RNA polymerase moves down the DNA while uncoiling it and brining in the new RNA nucleotide bases. In termination, the RNA polymerase reaches a termination sequence and detaches from the DNA, the DNA recoils, and the RNA strand is released. b. The end product is a single strand of RNA. c. The steps of translation are initiation, elongation, and termination. In initiation, that small and large ribosomal subunits attach to the start codon on the mRNA strand near the 5’ end, the tRNAs with the appropriate amino acids attach surround the ribosome, and the tRNA with the anticodon for AUG enters the A site and delivers the amino acid methionine. In elongation the tRNAs carrying the anticodons for the codons on mRNA continue to enter at the A site and deliver the appropriate amino acids which covalently bond together. In termination, a stop codon is reached, the ribosomal subunits detach releasing the mRNA strand and a chain of amino acids. d. A protein in its primary sequence. 5. 6. AUG a. Messenger RNA, transfer RNA, ribosomal RNA b. One significant part of tRNA is the anticodon loop, which is a three base sequence on the tip of the tRNA molecule that is complementary to a specific codon on the mRNA. The other significant part of tRNA is the amino acid attachment site, which is where the amino acid, specified by the codon complementary to the tRNA anticodon, is attached to the tRNA so that it can be transferred to the ribosome. c. During translation, mRNA carries the codons that specify the chain of amino acids. rRNA is found in the ribosomes and the ribosomes are responsible for covalently bonding the amino acids together, while separating the amino acids from their tRNAs. tRNA brings the specified amino acids to the ribosome during translation. a. 5’ AUGUUCCAGGAUCCCUGAUAA 3’ synthesized from left to right b. UUC CAG GAU CCC Methionine- Serine- Glutamine- Aspartic Acid- Proline- Tyrosine UGA UAA