* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download DNA Technology Notes
Epigenetics wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Genome evolution wikipedia , lookup
Biology and consumer behaviour wikipedia , lookup
Human genome wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Metagenomics wikipedia , lookup
DNA profiling wikipedia , lookup
Synthetic biology wikipedia , lookup
DNA polymerase wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Primary transcript wikipedia , lookup
Cancer epigenetics wikipedia , lookup
SNP genotyping wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Point mutation wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Genealogical DNA test wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Genetic engineering wikipedia , lookup
Designer baby wikipedia , lookup
Microsatellite wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
DNA vaccination wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Non-coding DNA wikipedia , lookup
Epigenomics wikipedia , lookup
Genomic library wikipedia , lookup
DNA supercoil wikipedia , lookup
Genome editing wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Molecular cloning wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Microevolution wikipedia , lookup
Helitron (biology) wikipedia , lookup
Biotechnology AP Biology 2007-2008 TACGCACATTTACGTACGCGGATGCCGCGACTATGATC ACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACT human genome CGACTAGCATGATCGATCAGCTACATGCTAGCACACYC GTACATCGATCCTGACATCGACCTGCTCGTACATGCTA 3.2 billion bases CTAGCTACTGACTCATGATCCAGATCACTGAAACCCTA GATCGGGTACCTATTACAGTACGATCATCCGATCAGAT CATGCTAGTACATCGATCGATACTGCTACTGATCTAGC TCAATCAAACTCTTTTTGCATCATGATACTAGACTAGC TGACTGATCATGACTCTGATCCCGTAGATCGGGTACCT ATTACAGTACGATCATCCGATCAGATCATGCTAGTACA TCGATCGATACTGCTACTGATCTAGCTCAATCAAACTC TTTTTGCATCATGATACTAGACTAGCTGACTGATCATG AC AP Biology Biotechnology Today: Genetic Engineering Manipulation of DNA If you are going to engineer DNA and genes, then you need a set of tools to work with. This unit is a survey of those tools… AP Biology Our tool kit… Bacteria Review One-celled prokaryotes. Reproduce by mitosis (binary fission). Rapid Growth Generation every ~20 min. 108 (100 million) colony overnight! Dominant form of life on Earth. Incredibly diverse AP Biology Bacterial Genome Single circular chromosome. Haploid: one set of chromosomes. Naked DNA (no histones) ~4 million base pairs ~4300 genes 1/1000 DNA in eukaryote How have these little guys gotten to be so diverse?? AP Biology Transformation promiscuous!? ***Bacteria are opportunists Pick up naked foreign DNA. mix heat-killed Have surface transport proteins that are pathogenic & non-pathogenic specialized for the uptake of naked bacteria DNA. Import bits of chromosomes from other bacteria. Incorporate the DNA bits into their own chromosome. Express new genes. Transformation. mice die Form of recombination. AP Biology Plasmids Small supplemental circles of DNA. 5000 - 20,000 base pairs. Self-replicating. Carry extra genes. 2-30 genes. Example: genes for antibiotic resistance Can be exchanged between bacteria. Rapid evolution. Can be imported from environment. AP Biology How can plasmids help us? Answer: A way to get genes into bacteria easily. Insert new gene into plasmid. Insert plasmid into bacteria = vector. Bacteria now expresses new gene and make new protein. transformed gene from other organism cut DNA plasmid AP Biology recombinant plasmid + vector glue DNA bacteria Biotechnology Plasmids used to insert new genes into bacteria cut DNA gene we want like what? …insulin …HGH …lactase cut plasmid DNA Cut DNA? DNA scissors? ligase recombinant APplasmid Biology insert “gene we want” into plasmid... “glue” together How do we cut DNA? Answer: Restriction enzymes Restriction endonucleases. Discovered in 1960s. Evolved in bacteria to cut up foreign DNA. AP Biology Protection against viruses and other bacteria. Bacteria protect their own DNA by methylation and by not using the base sequences recognized by the enzymes in their own DNA. What do you notice about these phrases? radar palindromes racecar Madam I’m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was it a bar or a bat I saw? go hang a salami I’m a lasagna hog AP Biology Cut DNA at specific sequences. CTGAATTCCG restriction site Symmetrical “palindrome.” Produces protruding ends GACTTAAGGC Restriction Enzymes Action of enzyme. Madam I’m Adam Sticky ends. CTG|AATTCCG GACTTAA|GGC Will bind to any complementary DNA. Many different enzymes. Named after organism they are found in. EcoRI, HindIII, BamHI, SmaI. AP Biology 1960s | 1978 Discovery of restriction enzymes Werner Arber Daniel Nathans Restriction enzymes are named for the organism they come from: EcoRI = 1st restriction enzyme found in E. coli. AP Biology Hamilton O. Smith Restriction enzymes Cut DNA at specific sites Leave “sticky ends.” restriction enzyme cut site GTAACGAATTCACGCTT CATTGCTTAAGTGCGAA restriction enzyme cut site GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA AP Biology Sticky Ends Cut other DNA with same enzymes. leave “sticky ends” on both. can glue DNA together at “sticky ends.” Help glue genes together. GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA AP Biology gene you want GGACCTG AATTCCGGATA CCTGGACTTAA GGCCTAT chromosome want to add gene to GGACCTG AATTCACGCTT CCTGGACTTAA GTGCGAA combined DNA Why mix genes together? How can bacteria read human DNA? Gene produces protein in different organism or different individual. This works because all organisms use the same genetic code read genes the same way. Insert human insulin gene into bacteria. “new” protein from organism ex: human insulin from bacteria aa aa aa aa aa aa aa aa aa aa bacteria AP Biology human insulin Grow bacteria…make more gene from other organism recombinant plasmid + vector plasmid grow bacteria harvest (purify) protein AP Biology transformed bacteria Uses of Genetic Engineering Genetically Modified Organisms (GMO) Protect crops from insects: BT corn Corn produces a bacterial toxin that kills corn borer (caterpillar pest of corn). Extend growing season: fishberries Strawberries with an anti-freezing gene from flounder. Improve quality of food: golden rice Rice producing vitamin A improves nutritional value. AP Biology Green with envy?? Green fluorescent protein AP Biology Jelly fish “GFP” inserted in vertebrates. Many uses of restriction enzymes… Now that we can cut DNA with restriction enzymes… We can cut up DNA from different people… or different organisms… and compare it. Why? Forensics Medical Diagnostics Paternity Evolutionary Relationships and more… AP Biology Comparing cut up DNA How do we compare DNA fragments? Separate fragments by size. How do we separate DNA fragments? Run it through a gelatin Agarose Made from algae Gel electrophoresis DNA jello?? Can’t we just add those little marshmallows? AP Biology Gel Electrophoresis A method of separating DNA in a gelatin-like material using an electrical field. DNA is negatively charged When it’s in an electrical field it moves toward the positive side. DNA – AP Biology “swimming through Jello” + Gel electrophoresis Q: DNA moves in an electrical field… so how does that help you compare DNA fragments? A: size of DNA fragment affects how far it travels. Small pieces travel farther. Large pieces travel slower and lag behind. DNA – AP Biology “swimming through Jello” + Gel Electrophoresis DNA & restriction enzyme longer fragments wells power source gel shorter fragments AP Biology + completed gel fragments of DNA separate out based on size Running a Gel cut DNA with restriction enzymes 1 2 Stain DNA AP Biology Ethidium bromide binds to DNA. Fluoresces under UV light 3 Uses: Evolutionary relationships Comparing DNA samples from different organisms to measure evolutionary relationships turtle snake rat squirrel fruitfly – DNA + AP Biology 1 2 3 4 5 1 2 3 4 5 Uses: Medical Diagnostic Comparing normal allele to disease allele. chromosome with normal allele 1 chromosome with disease-causing allele 2 – DNA Example: test for Huntington’s disease + AP Biology Uses: Forensics Comparing DNA sample from crime scene with suspects and victim. suspects S1 S2 S3 crime scene V sample – DNA AP Biology + DNA Fingerprints Comparing DNA banding pattern between different individuals. Restriction fragment length polymorphisms (RFLPs). Differences accumulate in junk DNA (does not code for protein). Differences change restriction enzyme cutting sites. Unique banding pattern created. Example: comparing blood samples on defendant’s clothing to determine if it belongs to victim. AP Biology Making lots of copies of DNA But it would be so much easier if we didn’t have to use bacteria every time… AP Biology 2007-2008 Copy DNA without plasmids? Polymerase Chain Reaction (PCR) Method for making many, many copies of a specific segment of DNA. Only need 1 cell of DNA to start. AP Biology No more bacteria, No more plasmids, No more E. coli smelly looks! PCR process It’s copying DNA in a test tube! What do you need? AP Biology Template Strand DNA Polymerase Enzyme Nucleotides: ATP, GTP, CTP, TTP Primer Thermocycler PCR Primers The primers are critical! Need to know a bit of sequence to make proper primers. Primers define section of DNA to be cloned AP Biology 20-30 cycles 3 steps/cycle 30 sec/step PCR Process What do you need to do? In tube: DNA, DNA polymerase enzyme, primer, nucleotides . Denature DNA: heat (90°C) DNA to separate strands. Anneal DNA: cool to hybridize with primers & build DNA (extension). What does 90°C do to our DNA polymerase? AP Biology The polymerase problem Heat DNA to denature (unwind) it. PCR 20-30 cycles 3 steps/cycle 30 sec/step 90°C destroys DNA polymerase. Have to add new enzyme every cycle, which is impractical. Need enzyme that can withstand 90°C… AP Biology Taq polymerase: from hot springs bacteria A Little More Advanced Biotechnology Tools Better Plasmids AP Biology 2007-2008 Engineered Plasmids Building custom plasmids Restriction enzyme sites Antibiotic resistance genes as a selectable marker EcoRI BamHI HindIII restriction sites Selectable marker antibiotic resistance gene on plasmid ampicillin resistance selecting for successful transformation successful uptake of recombinant plasmid AP Biology plasmid ori amp resistance Selection for Plasmid Uptake Antibiotic becomes a selecting agent. Only bacteria with the plasmid will grow on antibiotic (ampicillin) plate. all bacteria grow only transformed bacteria grow a a a a a a LB plate AP Biology a a a a a a a a a a a LB/amp plate cloning Finding your “Gene of Interest” AP Biology 2007-2008 Finding Your Gene of Interest DNA hybridization Find sequence of DNA using a labeled probe. Short, single stranded DNA molecule. Complementary to part of gene of interest. Labeled with radioactive P32 or fluorescent dye. Heat treat DNA in gel to unwind strands. Wash gel with probe, and probe hybridizes with denatured DNA. labeled probe genomic DNA AP Biology G A T C A G T A G C T A G T C A T C Southern Blotting restriction digest gel electrophoresis wash filter with labeled probe AP Biology blot DNA off of gel onto filter paper expose filter paper to X-ray film Edwin Southern Southern blotting gel of genomic DNA AP Biology Southern blot IDing one gene Southern blot illustration DNA Libraries Cut up all of nuclear DNA from many cells of an organism (use a restriction enzyme). Clone all fragments into many plasmids at same time Create a stored collection of DNA fragments. AP Biology Petri dish has a collection of all DNA fragments from the organism. 1 Making a DNA Library 2 all DNA from many cells of an organism is cut with restriction enzymes engineered plasmid with selectable marker & screening system gene of interest 4 recombinant plasmids inserted into bacteria AP Biology 3 all DNA fragments inserted into many plasmids But how do we find colony with our gene of interest in it? DNA library recombinant plasmids inserted into bacteria and bacteria reproduce gene of interest DNA Library plate of bacterial colonies storing & copying all genes from an organism (ex. human) AP Biology ? Find Your Gene in DNA Library Locate Gene of Interest to find your gene you need some of gene’s sequence if you know sequence of protein… can “guess” part of DNA sequence “back translate” protein to DNA if you have sequence of similar gene from another organism… use part of this sequence AP Biology Which bacterial colony has our gene? Like a needle in a haystack! ? Locating Gene of Interest: Colony Locate Blots 4 - expose film - locate colony on plate from film 1 Cloning - plate with bacterial colonies carrying recombinant plasmids plate plate + filter film 3 2 Replicate plate - press filter paper onto plate to take sample of cells from every colony AP Biology filter Hybridization - heat filter paper to denature DNA - wash filter paper with radioactive probe which will only attach to gene of interest Problems… Human Genome library Are there only genes in there? Nope! a lot of junk! Human genomic library has more “junk” than genes in it. Clean up the junk! AP Biology If you want to clone a human gene into bacteria, you can’t have… introns cDNA (copy DNA) libraries Collection of only the coding sequences of expressed genes. Extract mRNA from cells. Reverse transcriptase RNA DNA Rrom retroviruses AP Biology Clone into plasmid. I may be very selective… But still Ask Questions! EcoRI BamHI HindIII restriction sites plasmid ori AP Biology amp resistance 2007-2008