Download Agrobacterium tumefaciens

Genomes
Definition
Complete set of instructions for making an organism
• master blueprints for all enzymes, cellular structures &
activities
An organism‘s complete set of DNA
All the DNA contained in the cell of an organism
The collection of DNA that comprises an organism.
Total genetic information carried by a single set of
chromosomes in a haploid nucleus
Genome sequencing chronology
Genome size Number of
(bp)
genes
Year
Organism
Significance
1977
Bacteriophage
fX174
First genome
ever!
5,386
11
1981
Human
mitochondria
First organelle
16,500
37
1995
Haemophilus influenzae First free-living
Rd
organism
1,830,137
~3,500
1996
Saccharomyces cerevisiae First eukaryote
12,086,000
~6,000
Genome sequencing chronology
Genome size (bp)
Number of
genes
First multicellular organism
97,000,000
~19,000
Human
chromosome 22
First human
chromosome
49,000,000
673
2000
Drosophila
melanogaster
First insect
150,000,000
~14,000
2000
Arabidopsis
thaliana
First plant
genome
150,000,000
~25,000
Year
Organism
Significance
1998
Caenorhab-ditis
elegans
1999
Viral genomes
Small, infectious obligate intracellular parasites
depend on host cell for replication
Viral genomes: ssRNA, dsRNA, ssDNA, dsDNA, linear or circular
Viruses with RNA genomes:
• Almost all plant viruses, some bacterial and animal viruses
• Genomes are rather small (a few thousand nucleotides)
Viruses with DNA genomes (e.g. lambda = 48,502 bp):
• Often a circular genome.
Replicative form of viral genomes
• all ssRNA viruses produce dsRNA molecules
• many linear DNA molecules become circular
Procaryotic genomes




Generally 1 circular chromosome (dsDNA)
Usually without introns
Relatively high gene density (~2500 genes per mm of E. coli
DNA)
Often indigenous plasmids are present
1. Eschericia coli
2. Agrobacterium tumefaciens
E. coli






It is a free living, gram negative bacterium
It is a normal resident of the large
intestine in healthy people
It grows best with incubation at 37°C in a
culture medium that approximates the
nutrient available in the human digestive
tract
It is a type of probiotic organism because
it crowds out disease causing bacteria.
It also makes vitamin K which humans
require to be healthy.
Some strains make people sick. The toxic
strains are responsible for about half of
all cases of traveler's diarrhea.
E. coli



It replicates once every 22
minutes, giving rise to 30
generations and more than 1
billion cells in 11 hours
Its growth falls into several
distinct phases (lag, logaritmic,
stationary and death)
The individual cells are invisible to
the naked eye, after plating onto
solid medium, each cell divides to
form a visible colony of identical
daughter cells in 12-24 hours
E. coli




It provides a relatively simple and well
understood genetic improvement in
which to isolate foreign DNA
Its primary genetic complement is
contained on a single chromosome
which locations and sequences of a
large number of its genes are known
The genetic code is nearly universal
Under the best circumstances, the
uptake of a specific foreign gene is a
relatively rare occurrence and is thus
most easily accomplished in a large
populations that are reproducing rapidly
Coli genome





Single chromosome of approximately 5
million base pairs
4288 protein coding genes:
• Average ORF 317 amino acids
• Average gene size 1000 bp
• Very compact: average distance
between genes 118bp
Contour length of genome: 1.7 mm
It can accept foreign DNA derived from
any organism
Some genes are arranged in the plasmid
Plasmids
-lactamase
ori
Extra chromosomal circular DNAs










Found in bacteria, yeast and other fungi
Size varies form ~ 3,000 to 250,000 bp.
Replicate autonomously (origin of replication)
May contain resistance genes
May be transferred from one bacterium to another
May be transferred across kingdoms
Multipcopy plasmids (~ up to 400 plasmids/per cell)
Low copy plasmids (1 –2 copies per cell)
Plasmids may be incompatible with each other
used as vectors that could carry a foreign gene of interest
foreign gene
Agrobacterium tumefaciens
Agrobacterium tumefaciens



Agrobacterium tumefaciens is a Gramnegative soil phytopathogennonsporing, motile, rod-shaped bacterium,
closely related to Rhizobium which
forms nitrogen-fixing nodules on
clover and other leguminous plants.
Agrobacterium affect most
dicotyledonous plants in nature,
resulting in crown gall tumors at the
soil-air junction upon tissue wounding
Agrobacterium has the broadest host
range of any plant pathogenic
bacterium
Agrobacterium tumefaciens


Most of the genes involved in crown gall
disease are not borne on the
chromosome of A. tumefaciens but on a
large plasmid, termed the Ti (tumourinducing) plasmid.
It is important to note that only a small
part of the plasmid (the T-DNA) enters
the plant; the rest of the plasmid remains
in the bacterium to serve further roles.
When integrated into the plant genome,
the genes on the T-DNA code for:
production of cytokinins
production of indoleacetic acid
synthesis and release of novel plant
metabolites - the opines and
agrocinopines.
Agrobacteria that causes
neoplastic diseases in plants




Agrobacterium rhizogenes (hairy root disease).
Agrobacterium rubi (cane gall disease)
Agrobacterium tumefaciens (crown gall disease)
Agrobacterium vitis (crown gall of grape)
What will Agrobacterium
tumefaciens affect in plants?


Crown gall disease is not
generally fatal, but it will
reduce plant vigor and crop
yield, and crown galls will
attract other phytopathogens
or pests.
In some cases, necrosis or
apoptosis is observed after
Agrobacterium infection.
The discovery of Agrobacterium


In 1897, Fridiano Cavara identified a flagellate,
bacilloid bacterium as a casual agent of crown gall of
grape.
This organism is Agrobacterium vitis, causing the growth
of neoplastic tumors on the stem and crown of
grapevines and inducing necrotic lesions on grape
roots.
Historical discoveries about
agrobacterium




Turn of 20th century – found causes crown gall disease
1940’s – crown gall tissue cultured due to hormone
autotrophy
1970’s – pathogenicity transferred between bacteria via
conjugation – evidence of plasmid involvement
1980’s T-DNA was first engineered to carry useful
genes into plants using methods that ‘hijacked’ the
natural process
Evidence for plasmid involvement in the
virulence of agrobacterium
1.
2.
3.
4.
5.
6.
7.
Relationship between virulence and specific plasmids in different
agrobacterium strains
Loss of virulence with loss of plasmids when grown at high temp (plus
restoration of virulence when same plasmids replaced)
Virulence transferred when plasmids transferred between virulent and
non-virulent strains
Stable nature of hormone autotrophy in infected host plant tissues
indicated that this was genetically determined and could result from
genetic transfers between agrobacterium and its host
Fragments of agrobacterium plasmids (T-DNA) were found in the DNA
of diseased tissues
Plants regenerated from diseased tissues were bred to produce offspring
which inherited the T-DNA in a Mendelian manner.
This indicated that the T-DNA was integrated into nuclear DNA
Autoradiogram of a Southern blot of DNA
extracted from cured crown gall cells probed
with T-DNA showing the presence of T-DNA
within the plant genome.
Lanes 1 & 2: T-DNA extracted from agrobacterium Ti plasmid
Lanes 3, 5 & 6: DNA extracted from gall cells
Lane 4: DNA from non-infected plant tissue
Lives in intercellular spaces of the plant
Steps of Agrobacterium-plant
cell interaction
1.
2.
3.
4.
5.
6.
Cell-cell recognition
Signal transduction and transcriptional activation of
vir genes
Conjugal DNA metabolism
Intercellular transport
Nuclear import
T-DNA integration
Agrobacterium tumefaciens
• Encodes a large (~250kbp) plasmid called Tumor-inducing (Ti)
plasmid)
• Plasmid contains genes responsible for the disease
• Portion of the Ti plasmid is transferred between bacterial cells and
plant cells  T-DNA (Transfer DNA)
• T-DNA integrates stably into plant genome
• Single stranded T-DNA fragment is converted to dsDNA
fragment by plant cell


Then integrated into plant genome
2 x 23bp direct repeats play an important role in the excision
and integration process
Agrobacterium tumefaciens

What is naturally encoded in T-DNA?
• Enzymes for auxin and cytokinin synthesis


Causing hormone imbalance  tumor
formation/undifferentiated callus
Mutants in enzymes have been characterized
• Opine synthesis genes (e.g. octopine or nopaline)


Carbon and nitrogen source for A. tumefaciens growth
Insertion genes
• Virulence (vir) genes
• Allow excision and integration into plant genome
Genetic structure of the Ti plasmid
Oncogenes
TL
Aux
Cyt
Opines
TR
Left Border and Right Border
transfer
(Tumor-inducing)
Ti plasmid of A. tumefaciens
1. Auxin, cytokinin,
opine synthetic genes
transferred to plant
2. Plant makes all 3
compounds
3. Auxins and cytokines
cause gall formation
4. Opines provide unique
carbon/nitrogen
source only A.
tumefaciens can use!
Saccharomyces cerevisiae







Nonpathogenic
Rapid growth (generation time ca.
80 min)
Dispersed cells
Ease of replica plating and mutant
isolation
Can be grown on defined media
giving the investigator complete
control over environmental
parameters
Well-defined genetic system
Highly versatile DNA
transformation system
Saccharomyces cerevisiae




Strains have both a stable haploid
and diploid state
Viable with a large number of
markers
Recessive mutations are
conveniently manifested in haploid
strains and complementation tests
can be carried out with diploid
strains
The ease of gene disruptions and
single step gene replacements
offers an outstanding advantage for
experimentation
Saccharomyces cerevisiae



Yeast genes can functionally be expressed
when fused to the green fluorescent protein
(GFP) thus allowing to localize gene products
in the living cell by fluorescence microscopy
The yeast system has also proven an
invaluable tool to clone and to maintain large
segments of foreign DNA in yeast artificial
chromosomes (YACs) being extremely useful
for other genome projects and to search for
protein-protein interactions using the twohybrid approach
Transformation can be carried out directly
with short single-stranded synthetic
oligonucleotides, permitting the convenient
productions of numerous altered forms of
proteins
The yeast genome







S. cerevisiae contains a haploid set of 16 well-characterized chromosomes,
ranging in size from 200 to 2,200 kb
Total sequence of chromosomal DNA is 12,8 Mb
6,183 ORFs over 100 amino acids long
First completely sequenced eukaryote genome
Very compact genome:
• Short intergenic regions
• Scarcity of introns
• Lack of repetitive sequences
Strong evidence of duplication:
• Chromosome segments
• Single genes
Redundancy: non-essential genes provide selective advantage
Eucaryotic genomes
Located on several chromosomes
Relatively low gene density (50 genes per mm of DNA in
humans)
Carry organellar genome
Plant genomes
 Plant contains three genomes
 Genetic information is divided in the chromosome.
 The size of genomes is species dependent
 The difference in the size of genome is mainly due to a different
number of identical sequence of various size arranged in sequence
 The gene for ribosomal RNAs occur as repetitive sequence and
together with the genes for some transfer RNAs in several thousand
of copies
 Structural genes are present in only a few copies, sometimes just
single copy. Structural genes encoding for structurally and
functionally related proteins often form a gene family
 The DNA in the genome is replicated during the interphase of
mitosis
Arabidopsis thaliana
 A weed growing at the roadside of central
Europe
 It has only 2 x 5 chromosomes
 It is just 70 Mbp
 It has a life cycle of only 6 weeks
 It contains 25,498 structural genes from
11,000 families
 The structural genes are present in only few
copies sometimes just one protein
 Structural genes encoding for structurally
and functionally related proteins often form
a gene family
Peculiarities of plant genomes
 Huge genomes reaching tens of billions of base pairs
 Numerous polyploid forms
 Abundant (up to 99%) non coding DNA which seriously hinders
sequencing, gene mapping and design of gene
 Poor morphological, genetics, and physical mapping of
chromosomes
 A large number of “small-chromosome” in which the
chromosome length does not exceed 3 μm
 The number of chromosomes and DNA content in many species
is still unknown
Size of the genome in plants and human
Genome
Zea mays
Vicia faba
Human
Nucleus
Arabidopsis
thaliana
70 Millions
3900 Millions
14500 Millions
2800 Millions
Plastid
0.156 Millions
0.136 Millions
0.120 Millions
Mitochondrion 0.370 Millions
.570 Millions
.290 Millions
.017 Millions
Organisation of the genome into
chromosome
 The nuclear genome is organized into chromosome
 Chromosomes consist of essentially one long DNA helix
wound around nucleosome
 At metaphase, when the genome is relatively inactive, the
chromosome are most condensed and therefore most easily
observed cytologically, counted or separated
 Chromosomes provide the means by which the plant genome
constituents are replicated and segregated regularly in mitosis
and meiosis
 Large genome segments are defined by their conserved order
of constituent genes
Genome composition
1. Heterochromatin
 Darkly staining portions of chromosomes,
believed due to high degree of coiling
 Non-genic DNA
a. Centromere
~ “middle” of Chromosomes
spindle attachment sites
b. Telomeres
1. ends of chromosome
2. important for the stability of chromosomes
tips.
2. Euchromatin
 Lightly staining portion of chromosomes
 It represents most of the genomes
 It contains most of genes.
Ploidy and chromosome number
Organism
Ploidy
Chromosome number
Corn
Diploid (2X)
20
Tomato
Diploid (2X)
24
Arabidopsis
Diploid (2X)
10
Potato
Tetraploid (4X)
48
Wheat
Hexaploid (6X)
42
Organization of Plant Genome
Most plants contain quantities of DNA that greatly exceed their needs
for coding and regulatory functions
Very small percentage of the genome may encode for genes involved in protein
production
 Low-copy-number DNA
Portion of genome which encodes for most of the transcribed genes (Protein
coding genes)
 Tandemly repeated DNA
1. Medium-copy-number DNA
DNA sequences that encode ribosomal RNA (Tandemly repeated expressed
DNA)
2. High-copy-number DNA
It is composed of highly repetitive sequences (Repetitious DNA)
Protein Coding Genes
Segment of DNA which can be transcribed and translated to amino acid
Protein Coding Genes

Transcribed region ≈ Open Reading Frame (ORF)
• long (usually >100 aa)
• “known” proteins  likely

Basal signals
• Transcription, translation

Regulatory signals
Protein Coding Genes
 Plant contains about 10 000 – 30 000 structural genes
 They are present in only a few copies, sometimes just one (single copy
gene)
 They often form a gene family
 The transcription of most structural genes is subject to very complex and
specific regulation
 The gene for enzymes of metabolism or protein biosynthesis which
proceed in all cells are transcribed more often
 Most of the genes are switched off and are activated only in certain
organ and then often only in certain cells
 Many genes are only switched on at specific times
House keeping gene:
The genes which every cell needs for such basic functions independent of its
specialization
Pseudogenes
 Nonfunctional copies of genes
 Formed by duplication of ancestral gene, or reverse
transcription (and integration)
 Not expressed due to mutations that produce a stop
codon (nonsense or frame-shift) or prevent mRNA
processing, or due to lack of regulatory sequences
Tandemly Repeated DNA
 A large number of identical repeated DNA sequences
 It spread over the entirely chromosome
 There is variation within species for the number of copies in
allelic arrays
 Variations in the lengths of tandemly repeat units have been
used as a sources of molecular marker
 It is divided into:
1. Tandemly repeated expressed DNA
2. Tandemly repeated non expressed DNA (Repetitious DNA)
Tandemly Repeated Expressed
Genes
Genes which are duplicated and clustered at many
location of the genome
Ribosomal 18S, 58S, 25S and 5S RNA genes are highly
reiterated in clusters and form at sites called nucleolus
organizers (NOR)
They are also observed for tDNA and histones
Tandemly Repeat non expressed
DNA
Repetitive sequences which are unable to be
expressed but found in huge amount in the
genome
Simple-sequence DNA
Moderately repeated DNA (mobile DNA)
Simple Sequence DNA
 Very sort sequences repeated many times in tandem in large
clusters
 It is also called as satellite DNA
 It often lies in heterochromatin especially in centromeres and
telomeres
 It is divided into 2 groups:
Mini satellite : Variable number tandem repeat (VNTR)
Micro satellite : Simple sequence repeat (SSR)
 It is used in DNA fingerprinting to identify individuals
Tandemly repeated DNA
Microsatellite (SSR: Simple sequence repeat)
• Unit size: at most 5 bp
• ATATATATATATATATATATATAT
Minisatellite
• Unit size: up to 25 bp
• ATTGCTGTATTGCTGTATTGCTGT
Mobile DNA
Units of DNA which are predisposed to move to another
location, sometimes involving replication of the unit, with the
help of products of genes on the elements or on related
element
 Move within genomes
 Most of moderately repeated DNA sequences found throughout
higher eukaryotic genomes
 Some encode enzymes that catalyze movement
 2 types:
a. Transposon
b. Retrotransposon
Transposon DNA
Involves copying of mobile DNA element and
insertion into new site in genome
 Molecular parasite: “selfish DNA”
 They probably have significant effect on evolution by
facilitating gene duplication, which provides the fuel for
evolution, and exon shuffling
Retrotransposon (retroelement)
 Transposon like segment of DNA
 Retroviruses lacking the sequence encoding the structural
envelope protein
 Major component of plant genome
 Size ranges from 1 to 13 kb in length
 Widely distributed over the chromosomes of many plant
species gene
Retrovirus
A virus of higher organism whose genome is RNA, but which can insert
a DNA copy its genome into host chromosome
Eukaryotic cells
Peter J. Russell, iGenetics: Copyright © Pearson Education, Inc., publishing as Benjamin Cummings.
Mitochondrial genome (mtDNA)
 Number of mitochondria in plants can be between 50-2000
 One mitochondria consists of 1 – 100 genomes (multiple identical
circular chromosomes).
 They are one large and several smaller
 Size ~ 200 kb to 2,500 kb in plants
 Mt DNA is replicated before or during mitosis
 Transcription of mtDNA yielded an mRNA which did not contain the
correct information for the protein to be synthesized.
 RNA editing is existed in plant mitochondria
 Over 95% of mitochondrial proteins are encoded in the nuclear
genome.
 Often A+T rich genomes
Chloroplast genome (ctDNA)
 Multiple circular molecules, similar to procaryotic cyanobacteria,
although much smaller (0.001-0.1%of the size of nuclear genomes)
 Cells contain many copies of plastids and each plastid contains many
genome copies
 Size ranges from 120 kb to 160 kb
 Plastid genome has changed very little during evolution. Though two
plants are very distantly related, their genomes are rather similar in
gene composition and arrangement
 Some of plastid genomes contain introns
 Many chloroplast proteins are encoded in the nucleus (separate signal
sequence)
DNA for chloroplast proteins can be come
from the nucleus or chloroplast genome
Buchannan et al. Fig. 4.4