* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Slide 1
DNA sequencing wikipedia , lookup
Human genetic variation wikipedia , lookup
DNA barcoding wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Genome (book) wikipedia , lookup
DNA polymerase wikipedia , lookup
Genome evolution wikipedia , lookup
DNA profiling wikipedia , lookup
Human genome wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Primary transcript wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Metagenomics wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Point mutation wikipedia , lookup
DNA vaccination wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Genetic engineering wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
DNA supercoil wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Epigenomics wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Non-coding DNA wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Genomic library wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
SNP genotyping wikipedia , lookup
Molecular cloning wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Genome editing wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Designer baby wikipedia , lookup
Microsatellite wikipedia , lookup
History of genetic engineering wikipedia , lookup
Helitron (biology) wikipedia , lookup
Microevolution wikipedia , lookup
GENETIC MARKERS IN PLANT BREEDING MARKERS IN BIOLOGY 1. Phenotypic markers = Naked eye markers Flower colors, shape of pods, etc.. P = E+G Karl Von Linne (1707-1778) 2. Genotypic (molecular) markers Readily detectable sequence of protein or DNA whose inheritance can be monitored and associated with the trait inheritance independently from the environment: a) protein polymorphisms b) DNA polymorphisms Molecular markers Sequencing (SNPs) Microsatellites (SSRs) Multi-locus fingerprints AFLP (Amplified Fragment Length Polymorphism) RAPD (random amplified polymorphic DNA) chloroplastDNA PCR-RFLP allozymes (protein-electrophoresis) Proteins Polymorphisms Seed storage proteins Isozymes Isozyme Isozyme Starch gel of the isozyme malate dehydrogenase (MDH). The numbers indicate first the MDH locus, and next the allele present (ie. 3-18 is locus 3 allele 18). Some bands are heterodimers (intralocus or interlocus). Molecular Marker 1 ccacgcgtcc gtgaggactt gcaagcgccg cggatggtgg gctctgtggc tgggaacatg 61 ctgctgcgag ccgcttggag gcgggcgtcg ttggcggcta cctccttggc cctgggaagg 121 tcctcggtgc ccacccgggg actgcgcctg cgcgtgtaga tcatggcccc cattcgcctg 181 ttcactcaga ggcagaggca gtgctgcgac ctctctacat ggacgtacag gccaccactc 241 ctctggatcc cagagtgctt gatgccatgc tcccatacct tgtcaactac tatgggaacc 301 ctcattctcg gactcatgca tatggctggg agagcgaggc agccatggaa cgtgctcgcc 361 agcaagtagc atctctgatt ggagctgatc ctcgggagat cattttcact agtggagcta 421 ctgagtccaa caacatagca attaaggtag gaggagggat ggggatgttg tgtggccgac 481 agttgtgagg ggttgtggga agatggaagc cagaagcaaa aaagagggaa cctgacacta 541 tttctggctt cttgggttta gcgattagtg cccctctctc atttgaactc aactacccat 601 gtctccctag ttctttctct gcctttaaaa aaaaatgtgt ggaggacagc tttgtggag DNA M1 Gene A M2 MFG Gene B MFG AACCTGAAAAGTTACCCTTTAAAGGCTTAAGGAAAAAGGGTTTAACCAAGGAATTCCATCGGGAATTCCG readily detectable sequence of DNA whose inheritance can be monitored and associated with the trait inheritance Image from UV light table Image from computer screen Molecular Marker 1. Hybridization molecular based markers 2. PCR molecular based markers Hybridization based markers Examine differences in size of specific DNA restriction fragments Require pure, high molecular weight DNA Usually performed on total cellular genome DNA/DNA Hybridization Denaturation Elevated temperature Restriction Fragment Length Polymorphism Known DNA sequence Endonucleases and restriction sequences Name of the enzyme Number of cutting sites Taq I MboI Alu I Dde I Rsa I Scrf I Msp I Hae III Ssp I 639 623 341 309 286 239 214 196 137 AG CT C TNAG GT AC CC NGG CC GG GG CC AAT ATT Cutting sites TCGA GATC Note: N represent any base : A, T, C or G AAATCGGGACCTAATGGGCC Ind 1 YFG ATTTAGGGCAATTCCAAGGA Ind 2 RFLP techniques RFLP Polymorphisms interpretation MFG 1 2 3 4 5 6 1 2 3 4 5 6 Advantages and disadvantages of RFLP • Advantages – Reproducible – Co-dominant – Simple • Disadvantages – Time consuming – Expensive – Use of radioactive probes Polymerase Chain Reaction Powerful technique for amplifying DNA Amplified DNA are then separated by gel electrophoresis PCR based methods 1. Reactions conditions *Target DNA ( or template) *Reaction buffer containing the co-factor MgCl2 *One or more primers *Four nucleotides (dATP, dCTP, dGTP, dTTP) *Thermostable DNA polymerase 2. Use of DNA polymerase = an enzyme that can synthesize DNA at elevated temperature Example: Taq = enzyme purified from hot spring bacterium ( Thermus aquaticus) 3. Thermal cycle *Denaturing step - one to several min at 94-96 º C *Annealing step - one to several min at 50-65 º C *Elongation step - one to several min at 72 º C 4. Repetition –typically 20 to 50 times average 35 times PCR Based markers Sequencing (SNPs) Microsatellites (SSR) AFLP (Amplified Fragment Length Polymorphism) RAPD (random amplified polymorphic DNA) RAPD Markers Molecular markers which developed by amplifying random sequence of specific markers through the used of random primers  There are other problems with RAPD markers associated with reliability  Because small changes in any variable can change the result, they are unstable as markers  RAPD markers need to be converted to stable PCR markers  The polymorphic RAPD marker band is isolated from the gel  It is used a template and re-PCRed  The new PCR product is cloned and sequenced  Once the sequence is determined, new longer and specific primers can be designed  . RAPD  Amplifies anonymous stretches of DNA using arbitrary primers  Fast and easy method for detecting polymorphisms Disadvantages:  Domimant markers  Reproducibility problems RAPD Polymorphisms among landraces of sorghum Sequences of 10-mer RAPD primers RAPD gel configuration Name Sequence OP A08 OP A15 M OP A 17 OP A19 OP D02 5’ –GTGACGTAGG- 3’ 5’ –TTCCGAACCC- 3’ 5’ –GACCGCTTGT- 3’ 5’ –CAAACGTCGG- 3’ 5’ –GGACCCAACC- 3’ AFLP Markers  Most complex of marker technologies  Involves cleavage of DNA with two different enzymes  Involves ligation of specific linker pairs to the digested DNA  Subsets of the DNA are then amplified by PCR  The PCR products are then separated on acrylamide gel  128 linker combinations are readily available  Therefore 128 subsets can be amplified  Patented technology AFLP Markers Technically demanding Reliable and stable Moderate cost Need to use different kits adapted to the size of the genome being analyzed. Like RAPD markers need to be converted to quick and easy PCR based marker SSR repeats and primers Molecular markers which developed by amplifying microsatellite in the genome Repeat GGT(5) Sequence GCGCCGAGTTCTAGGGTTTCGGAATTTGAACCGTC GAGGGCTGATGAGGTGGATA ATTGGGCGTCGGTGAAGAAGTCGCTTCCGTCGTTTGATTCCGGTCGTCA GAATCAGAATCAGAATCGATATGGTGGCAGTGGTGGTGGTGGTGGTGGT TTTGGTGGTGGTGAATCTAAGGCGGATGGAGTGGATAATTGGGCGGTTG GTAAGAAACCTCTTCCTGTTAG ATCTTATGGCGGTTCTCGTG ATTCTGGAATGGAACCAGATCGCTGGTCTAGAGGTTCTGCTGTGGAACC A….. SSR polymorphisms P1 AATCCGGACTAGCTTCTTCTTCTTCTTCTTTAGCGAATTAGG P2 AAGGTTATTTCTTCTTCTTCTTCTTCTTCTTCTTAGGCTAGGCG P1 Gel configuration P2 SSR scoring for F 5:6 pop from the cross Anand x N97-3708-13 M SNPs (Single Nucleotide Polymorphisms) Molecular markers which their polymorphism can be determined by single nucleotide difference SNPs on a DNA strand Hybridization using fluorescent dyes Any two unrelated individuals differ by one base pair every 1,000 or so, referred to as SNPs. Many SNPs have no effect on cell function and therefore can be used as molecular markers. DNA sequencing Sequencer Sequencing gel Sequencing graph Dominant versus Co-dominant Dominant No distinction between homo- and heterozygotes possible No allele frequencies available AFLP, RAPD Co-dominant homozygotes can be distinguished from heterozygotes allele frequencies can be calculated microsatellites, SNP, RFLPs Co-dominant marker Gel configuration P1 P2 O1 O2 Dominant marker P2 O1 Polymorphism Parent 1 : one band Gel configuration P1 Polymorphism -Parent 1 : one band -Parent 2 : a smaller band -Offspring 1 : heterozygote = both bands -Offspring 2 : homozygote parent 1 O2 -Parent 2 : no band -Offspring 1 : homozygote parent 1 -Offspring 2 : ???? Desirable properties for a good molecular marker * Polymorphic * Co-dominant inheritance * Occurs throughout the genome * Reproducible * Easy, fast and cheap to detect * Selectivity neutral * High resolution with large number of samples Use of Molecular Markers Clonal identity Parental analysis Family structure Population structure Gene flow Phylogeography Hybridisation Phylogeny USES OF MOLECULAR MARKER  Measure genetic diversity  Mapping  Tagging Genetic Diversity  Define appropriate geographical scales for monitoring and management (epidemology)  Establish gene flow mechanism  identify the origin of individual (mutation detection)  Monitor the effect of management practices  manage small number of individual in ex situ collection  Establish of identity in cultivar and clones (fingerprint)  paternity analysis and forensic Genetic Diversity Gotcha! fingerprints seeds, plantlets early selection of the good allele Mapping The determination of the position and relative distances of gene on chromosome by means of their linkage  Genetic map A linear arrangement of genes or genetic markers obtained based on recombination  Physical map A linear order of genes or DNA fragments Physical Mapping It contains ordered overlapping cloned DNA fragment The cloned DNA fragments are usually obtained using restriction enzyme digestion   Molecular Maps Molecular markers (especially RFLPs and SSRs) can be used to produce genetic maps because they represent an almost unlimited number of alleles that can be followed in progeny of crosses. Chromosomes with morphological marker alleles Chromosomes with molecular marker alleles RFLP1b RFLP2b SSR1b T t r R or RFLP1a RFLP2a SSR1a RFLP3b RFLP3a SSR2b SSR2a RFLP4b RFLP4a QTL Mapping A set of procedures for detecting genes controlling quantitative traits (QTL) and estimating their genetics effects and location  To assist selection Types of traits Single gene trait: seed shape Multigenic trait; ex: plant growth =Quantitative Trait Loci MFG MFG Making A Linkage Map R642 RZ141 G320 G44 RG2 C189 G1465 Rice chromosome 11 Genotype G320 RG2 C189 A A A A A B A B A A B B B A A B B A B A B B B B Total No. of Individuals 47 8 5 15 19 24 3 42 . 163 Recombinants between G320 and RG2 = 5 + 15 + 19 + 3 = 42 = 26% Recombinants between RG2 and C189 = 8 + 5 + 24 + 3 = 40 = 25% Recombinants between G320 and C189 = 8 + 15 + 19 + 24 = 66 = 40% Making a Linkage Map A A A G320 RG2 C189 A A A B B A Frequency of Genotype B B A 47 8 5 15 19 24 3 42 Making a Lingkage Map Trait M. 1 M. 2 M. 3 P.1 P.2 I.1 I.2 I.3 I.4 2.5 8.4 7.1 2.5 4.5 2.3 1 3 3 2 2 1 1 3 1 1 3 1 1 3 1 1 2 3 Statistical programs used in molecular marker studies * SAS * ANOVA * Mapmaker * Cartographer Types of population used for molecular markers studies: F2, RILs, Backcrosses (MILs), DH. QTL Mapping Linkage groups Marker Assisted Selection  Breeding for specific traits in plants and animals is expensive and time consuming  The progeny often need to reach maturity before a determination of the success of the cross can be made  The greater the complexity of the trait, the more time and effort needed to achieve a desirable result  The goal to MAS is to reduce the time needed to determine if the progeny have trait  The second goal is to reduce costs associated with screening for traits  If you can detect the distinguishing trait at the DNA level you can identify positive selection very early. Marker Assisted Selection Useful when the gene(s) of interest is difficult to select 1. Recessive Genes 2. Multiple Genes for Disease Resistance 3. Quantitative traits 4. Large genotype x environment interaction Marker Assisted Selection MAS allows for gene pyramiding - incorporation of multiple genes for a trait Prevents development of biological resistance to a gene Reduces space requirements - dispose of unwanted plants and animal early Developing a Marker    Best marker is DNA sequence responsible for phenotype i.e. gene If you know the gene responsible and has been isolated, compare sequence of wild-type and mutant DNA Develop specific primers to gene that will distinguish the two forms Developing a Marker    If gene is unknown, screen contrasting populations Use populations rather than individuals Need to “blend” genetic differences between individual other than trait of interest Developing Markers     Cross individual differing in trait you wish to develop a marker Collect progeny and self or polycross the progeny Collect and select the F2 generation for the trait you are interested in Select 5 - 10 individuals in the F2 showing each trait Developing Markers     Extract DNA from selected F2s Pool equal amounts of DNA from each individual into two samples - one for each trait Screen pooled or “bulked” DNA with what method of marker method you wish to use Method is called “Bulked Segregant Analysis” Marker Development    Other methods to develop population for markers exist but are more expensive and slower to develop Near Isogenic Lines, Recombinant Inbreeds, Single Seed Decent What is the advantage to markers in breeding?
 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                            