Download Genetics and Recombinant DNA

Genetics and Recombinant
DNA
BIT 120
Mitosis
• 46 chromosomes
• 23 pairs
• 22 pairs autosomes (Chromosomes
other than the X or Y sex
chromosomes)
• 1 pair sex chromosomes: XX and XY
• Mitosis is the process that facilitates the
equal partitioning of replicated
chromosomes into two identical groups.
Stages of Mitosis
• Prophase: The chromatin, diffuse in interphase, condenses into
chromosomes. Each chromosome has duplicated and now consists
of two sister chromatids. At the end of prophase, the nuclear
envelope breaks down into vesicles.
• Metaphase: The chromosomes align at the equitorial plate and are
held in place by microtubules attached to the mitotic spindle and to
part of the centromere.
• Anaphase: The centromeres divide. Sister chromatids separate and
move toward the corresponding poles.
• Telophase: Daughter chromosomes arrive at the poles and the
microtubules disappear. The condensed chromatin expands and the
nuclear envelope reappears. The cytoplasm divides, the cell
membrane pinches inward ultimately producing two daughter cells
(phase: Cytokinesis).
Genes on Chromosomes
• Definition of Gene: The functional and
physical unit of heredity passed from
parent to offspring. Genes are pieces of
DNA, and most genes contain the
information for making a specific protein
• One gene one enzyme
• One gene one peptide
Meiosis - The Genetics of
Reproduction
• Diploid – 2 chromosomes per pair
• Haploid – set of one chromosome
• The process of meiosis essentially
involves two cycles of division, essentially
involving a gamete mother cell (diploid
cell) dividing and then dividing again to
form 4 haploid cells. These can be
subdivided into four distinct phases which
are a continuous process
Prophase I
Metaphase I
Anaphase I
Telophase I
Meiosis II
• Meiosis II is simply a mitotic division of
each of the haploid cells produced in
Meiosis I. There is no interphase between
Meiosis I and Meiosis II and the latter
begins with:
Prophase II
Metaphase II
Anaphase II
Telophase II
Summary: Meiosis Steps
• Prophase - Homologous chromosomes in the
nucleus begin to pair up with one another
and then split into chromatids (one half of a
chromosome) where crossing over can
occur. Crossing offer can increase genetic
variation explained soon.
• Metaphase - Chromosomes line up at the
equator of the cell, where the sequence of
the chromosomes lined up is at random,
increasing genetic variation via independent
assortment explained soon.
Summary: Meiosis Steps
• Anaphase - The homologous
chromosomes move to opposing poles
from the equator
• Telophase - A new nuclei forms near
each pole alongside its new
chromosome compliment.
• At this stage two haploid cells have
been created from the original diploid
cell of the parent.
Summary: Meiosis Steps
• Prophase II - The nuclear
membrane disappears and the
second meiotic division is
initiated.
• Metaphase II - Pairs of
chromatids line up at the equator
Summary: Meiosis Steps
• Anaphase II - Each of these
chromatid pairs move away from the
equator to the poles via spindle fibres
• Telophase II - Four new haploid
gametes are created that will fuse
with the gametes of the opposite sex
to create a zygote.
Summary: Meiosis Steps
• When Meiosis II is complete,
there will be a total of four
daughter cells, each with half
the total number of
chromosomes as the original
cell.
• Increases Genetic diversity
Crossing Over
• During meiosis, when homologous
chromosomes are paired together, there
are points along the chromosomes that
make contact with the other pair. This
point of contact is deemed the chiasmata,
and can allow the exchange of genetic
information between chromosomes. This
further increases genetic variation
Mendel’s Work
• Gregor Mendel, an Austrian monk is most
famous in this field for his study of the
phenotype of pea plants, including the
shape of the peas on the pea plants.
• 2 laws:
– Segregation
– Independent Assortment
Mendel cont’d
• Mendel's goal was to have a firm scientific
basis on the relationship of genetic
information passed on from parents to
offspring
• Did work with Pea plants - looked at traits
for color and texture
• For texture - showed more round than
wrinkled; for color - more green than
yellow
Mendel cont’d
• Idea of Dominant and Recessive
• Idea of alleles - alternate forms of the
same gene
• Monohybrid cross
Segregation
– Mendel's First Law
– "The alleles of a gene exist in pairs
but when gametes are formed, the
members of each pair pass into
different gametes. Thus each
gamete contains only one allele of
each gene."
Independent Assortment
• Genes affecting different traits will
separate independently from one another
during gamete formation.
• Dihybrid cross - see example next slide
• Can use to see how 2 or more genes will
sort out
Dihybrid Cross
Rr, round & wrinkled
Yy, yellow and green
New convention for naming
• See overhead
• now would be Ww and Gg
• Exceptions:
– incomplete dominance
– multiple alleles
– linked genes
Sex Determination
• XX females
• XY males - not “truly” a homologous pair
Arrows indicate genes
on the X chromosome
for which there is no
complement on the Y
chromosome
SRY gene - Sex Determining
Region Y
• Gene on Y chromosome that determines
embryo will be a male
• Produces TDF - testis determining factor
Testisdetermining
factor
Sex-linked Genes
• Some examples:
  Red-Green colour blindness
  Hemophilia - A condition which
prevents the clotting of the blood
  DMD - muscular dystrophy
  Hypertension
Inheritance - hemophiliac male
Inheritance - carrier female
Pedigree Analysis
• Charts to look at inheritance pattern of
genes in humans
• http://www.blc.arizona.edu/courses/181gh/
rick/human_genetics/pedigree.html
• http://www.ndsu.nodak.edu/instruct/mcclea
n/plsc431/mendel/mendel9.htm
Chromosomal mutations
http://www.people.virginia.edu/~rjh9u/chromdel.html
• Gene deletion
Chromosomal mutations
http://www.people.virginia.edu/~rjh9u/chromdup.html
• Gene duplication
Chromosomal mutations
http://www.people.virginia.edu/~rjh9u/chrominv.html
• Gene inversion
Chromosomal mutations
http://www.people.virginia.edu/~rjh9u/chromtran.html
• Gene translocation
DNA-level mutation
• Previous examples chromosomal level
changes
• changes can occur at DNA level
• also can have deletion, insertion, inversion
and substitution
DNA mutation
1.Deletion
Here, certain nucleotides are deleted, which affects
the coding of proteins that use this DNA sequence. If
for example, a gene coded for alanine, with a genetic
sequence of C-G-G, and the cytosine nucleotide was
deleted, then the alanine amino acid would not be
able to be created
2. Insertion
Similar to the effects of deletion, where a nucleotide
is inserted into a genetic sequence and therefore
alters the chain thereafter. This alteration of a
nucleotide sequence is known as frameshift
DNA mutation
3.Inversion
Where a particular nucleotide sequence is reversed,
and is not as serious as the above mutations. This is
because the nucleotides that have been reversed in
order only affect a small portion of the sequence at
large
4.Substitution
A certain nucleotide is replaced with another, which
will affect any amino acid to be synthesized from this
sequence due to this change. If the gene is essential,
i.e. for the coding of hemoglobin then the effects are
serious, and organisms in this instance suffer from a
condition called sickle cell anemia. - CAN BE
SILENT MUTATION. CONSERVATION
SUBSTITUTION, OR SUBSTITUTION
Change in Sickle cell anemia
gene
Other related topics
• Polyploidy
• Mutation Frequency
Recessive human genetic
disorders
• Brachydactly - first human genetic disorder
characterized - short fingers and toes
• Albinism - absence of pigmentation
• Sickle cell anemia - inefficient oxygen
transport due to abnormal shape red blood
cells
• PKU
• Tay Sachs - neurodegenerative
Dominant Human genetic
disorders
• Huntington’s disease - progressive
destruction of brain cells
• Polydactly - extra fingers and toes
Intro to Recombinant DNA
• Some unmet medical needs:

invasive fungi infections

drug resistant bacteria

hepatitis virus

new vaccines

HIV

Cancer
Recombinant DNA
– Definition : DNA molecule produced artificially and
containing sequences from unrelated organisms.
• Genetic Engineering
• Use of techniques involving recombinant DNA
technology to produce molecules and/or organisms
with new properties.
• Biotechnology
• All inclusive term for several technologies including
but not limited to recombinant DNA. Refers to the
use of technology in applications for solving
fundamental problems in biology.
Restriction endonucleases
• Also called restriction enzymes: digest
DNA at specific sequences
Sequence Recognition -R.E.
 Restriction endonucleases -- cut
double stranded DNA at specific
sequences, protection against
viruses in bacteria.
 Sequences often palindromes: a
sequence which is the same when
read in either direction. ”A man a
plan a canal: Panama”
Some common Restriction
enzymes
Restriction digests and agarose
gels - orientation
DNA ligase
 DNA ligase joins 5'-phosphate and
3'-hydroxyl ends of DNA
 Two fragments formed by EcoRI
can be rejoined by ligase.
• Similarly, Eco RI fragments from two
different pieces of DNA can be joined
Ligation
Plasmids
 Extrachromosomal, circular small (2-3
kb) DNA in a bacterial cell which can
replicate independently but which cannot
integrate into the host chromosome.
 Drug resistance plasmids are not
essential for the cell's growth, but confer
antibiotic resistance.
 Plasmids used for molecular cloning have
been artificially created by recombining
fragments of various existing plasmids.
 Plasmids contain multiple cloning sites
with several restriction endonuclease
sites.
Example of a Plasmid
Example of a plasmid + insert
(DNA of interest)
Tools of recombinant DNA cloning
Creating a Recombinant DNA
molecule
  A plasmid (vector) is digested with EcoRI at a
single site to produce two sticky ends.
  A sample of human DNA is also digested with
EcoRI to produce pieces with the same sticky ends
  Human DNA- or cDNA copied from mRNA using
reverse transcriptase from retroviruses.
  The two samples are mixed and allowed to
hybridize, some molecules will form with pieces of
human DNA inserted into the plasmid vector at the
EcoRI site.
  DNA ligase is used to covalently link the
fragments.
Recombinant DNA molecule
Inserting recombinant DNA into
Host
· Transformation
– cell made competent to take up DNA
– competent cells: electroporation – poke holes in membrane
and calcium chloride- make cells more permeable to DNA
· Transfection
– when the cloning vector used has aspects of a virus, the host
cell can be infected (transfected) to insert the recombinant
molecule
· Electroporation
– the cell is placed in an electric field such that small pores are
temporarily opened in the membrane. Added DNA can enter
through these pores.
Transformation
Selection
– Antibotic resistance
 Plasmid vector contains an
ampicillin resistance gene making
the cell resistant.
 Growth of transformed cells (cells
receiving the plasmid) can be
identified on agar medium
containing (e.g.) ampicillin.
Transformation
Further selection
  The plasmid vector contains another identifiable
gene (e.g., a second drug resistance or an enzyme
activity), with the coding sequence of this gene
containing the restriction site for insertion.
  Insertion of the foreign DNA at this site
interrupts the reading frame of the gene and
result in insertional mutagenesis.
  In the following example, the -galactosidase
gene is inactivated. The substrate "X-gal" turns
blue if the gene is intact, ie. makes active enzyme.
White colonies in X-gal imply the presence of
recombinant DNA in the plasmid.
X-gal selection
Cells ready for DNA uptake
• Competent cells: Treat the cells
with calcium chloride which
makes the cell membranes more
permeable to DNA. This
technique succeeds with species
that aren't naturally competent
e.g. E. coli.
• Electroporation - alternate method
Finding the proper orientation of
clone
• Insert can go in both directions
• How to determine correct orientation
• Perform restriction digests using enzymes
outside the cloning fragment
• Add total fragments up
• Must add up to right size
Link to Orientation
• http://homepages.strath.ac.uk/%7Edfs991
09/BB211/RDTSampleAnswers.html
Finding the right Clone
• Hybridization (see overhead as well)
Genomic library
• Source of DNA to clone
• all the cells in your body have identical
DNA
• problem with this method is introns
Genomic Library Construction
cDNA libraries: alternate source
(complimentary DNA library)
• Made from RNA by reverse transcription
(reverse transcriptase is enzyme)
• RNA made into double stranded DNA
• comes from tissue that expresses gene(s)
of interest
• no introns
• source abundant in message
• difficult to work with- RNA degrades more
rapidly than DNA
cDNA library construction - step 1
cDNA library construction - step 2
cDNA library construction - step 3
Alternate cloning tool PCR
•
•
•
•
Polymerase chain reaction
amplification of small DNA quantities
clone from genomic or cDNA source
thermostable polymerase - heat to
separate DNA strands
PCR step 1: Denaturation
PCR step 2 - Annealing
PCR step 3 - Extension
After one round of PCR
After 2 rounds of PCR
After 3 round of PCR
Required Components of PCR
•
•
•
•
DNA template DNA
thermocycler (or water baths)
pool of free dNTPs
Taq (or other heat-stable) DNA
polymerase
• Primers - annealed at appropriate
temperatures
Conditions for PCR
• Denature: 94C to 100C , 1 minute
• For anneal temperature, 2C for every A
and T, 4 C for every C and G. 1minute - 2
minutes - GO 3-5 DEGREES BELOW
THAT TEMPERATURE
• Extension: 72 C for 2 minutes
• Do this 30 cycles
• machine programmable
Problem
• What is the annealing temperature for the
following primer (a 21 mer)?:
AAGCTTGTCCAGAATTTCGGC
Solution
• 11 A/T X 2 = 22
• 10 C/G X 4 = 40
• 22 + 40 + 62
• Go a few degrees below that number, so
you would anneal at about 58C
Applications of recombinant
DNA
• Diagnosis of genes by RFLP (restriction
fragment length polymorphisms)
• Example sickle cell anemia
RFLP
restriction fragment length polymorphism
converts a GAG codon (for Glu) to a GTG codon for Val
abolishes a sequence (CTGAGG, which spans codons 5, 6,
and 7) recognized and cut by one of the restriction enzymes.
Other diseases identified by
RFLP
• Cystic fibrosis
• Huntington’s disease
• Loss (or gain) of restriction enzyme sites
when amino acid change in middle of
codon, and thus, protein
How do you know sequence of
DNA?
• Sanger sequencing - named after Fred
Sanger
• utilizes 2',3'-dideoxynucleotide
triphospates (ddNTPs), molecules that
differ from deoxynucleotides by the having
a hydrogen atom attached to the 3' carbon
rather than an OH group. (see upcoming
figure)
Sanger (dideoxysequencing)
sequencing
•
•
•
•
•
Need polymerase
dNTPs
ddNTPs
primer
DNA template
Sanger method
Product of sequencing
Cellular expression systems
• Expression systems are based on the
insertion of a gene into a host cell for its
translation and expression into protein
• types of available systems
• .
o Bacteria - e.g. Escherichia coli (E.coli), Bacil us subtilis (B. subtilis)
o Yeast
o Cultured insect cells – baculovirus or Drosophila
o Cultured mammalian cells – HEK 293 cells, CHO cells
Bacteria
• Advantages:
– short generation time
– simple physiology
– large yield of some proteins
• Disadvantages:
– no post-translational modifications glycosylation, phosphorylation
– degradation of proteins
– misfolded proteins
Yeast
• Advantages:
– can perform post-translational modifications
– secrete proteins in media- easy to isolate from
there
• Disadvantages:
– active proteases
Insect cells
• Advantages:
– high expression level
– correct folding
– correct post-translational modification
• Disadvantages:
– slow generation time
– costly- media and cells
– finicky
Mammalian cells
• Advantages:
– cellular machinery same as gene of
interest
– folding, post-trans. Correct
– amino acid bias the same
• Disadvantages:
– expresses endogenous protein, need to find
correct cell line (by trial and error)
Mammalian Expression vectors
• Transient transfection - put into cells and
protein expressed for a short period of
time- usually 24 to 48 hours
• stable tranfection - integrated into
genome- expression carried on indefinitely
(need to select)
• expression vector allows for translation as
well
Introducing DNA into cells
DEAE dextran - an inert carbohydrate polymer (dextran)
coupled to a positively charged chemical group
(diethylaminoethyl -DEAE). DNA probably sticks to DEAEdextran via its negatively charged phosphate groups.
Calcium phosphate - forms an insoluble precipitate with DNA.
It was discovered that cells efficiently take up this precipitate.
More efficient than DEAE dextran or many cell types and can
be used for both transient and stable transfection. Not
suitable for cells which grow in suspension culture.
Introducing DNA into Cells
Electroporation - Cells are concentrated, mixed with the DNA
and placed in a small chamber with electrodes connected to
a specialised power supply. A brief electric pulse is applied,
which is thought to ‘punch holes’ in the cell membrane,
enabling the cell to take up DNA.
Lipofection - (liposome-mediated gene transfer) several lipidbased methods have been developed in which DNA is
encapsulated by synthetic lipid bilayers which resemble cell
membranes. Liposomes are essentially spheres of synthetic
membrane filled with DNA. These fuse spontaneously with cell
membranes, releasing their contents into the cytoplasm.
Introducing DNA into cells
• Microinjection - The most efficient artificial means
of getting DNA into cells. DNA is injected into the
nucleus using a microelectrode needle. Very
tedious method because each and every cell has
to be injected individually. There are now
computer-based systems which will assist in the
process.
Creating a fusion protein
• Gene products are “fused” together,
produced as a single polypeptide
• can then use a tag sequence to help
isolate that protein
• can purify over a column and get rid of tag
by cleavage (cutting)
Technique of Cell Culture
•
•
•
•
•
•
Follow handout – 4 pages
How did Tissue Culture develop
What is Tissue Culture
How is T.C. performed
What can go wrong
References