Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Arabidopsis Gene Project Slides
Document related concepts
Epigenetics in learning and memory wikipedia , lookup
X-inactivation wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Non-coding DNA wikipedia , lookup
Metagenomics wikipedia , lookup
Genomic library wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Protein moonlighting wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Human genome wikipedia , lookup
Transposable element wikipedia , lookup
Public health genomics wikipedia , lookup
Pathogenomics wikipedia , lookup
History of genetic engineering wikipedia , lookup
Point mutation wikipedia , lookup
Epigenetics of diabetes Type 2 wikipedia , lookup
Copy-number variation wikipedia , lookup
Genetic engineering wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Saethre–Chotzen syndrome wikipedia , lookup
Neuronal ceroid lipofuscinosis wikipedia , lookup
Gene expression profiling wikipedia , lookup
The Selfish Gene wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Genome (book) wikipedia , lookup
Gene therapy of the human retina wikipedia , lookup
Gene therapy wikipedia , lookup
Gene expression programming wikipedia , lookup
Gene desert wikipedia , lookup
Genome evolution wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Gene nomenclature wikipedia , lookup
Microevolution wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Genome editing wikipedia , lookup
Designer baby wikipedia , lookup
Transcript
Arabidopsis Gene Project GK-12 April Workshop Karolyn Giang and Dr. Mulligan Reverse genetics An approach used to determine the function of a gene from known DNA sequence BLAST: Basic Local Alignment Search Tool Gene project You are working on an Arabidopsis gene discovery project, and your job is to sequence cDNAs and then learn all you can about the genes from all types of databases: DNA sequence, genome, and publication databases. Query sequence: TCCTGCATTCAATGTGATCAATGGAGGCAGTCATGCTGGGAATAGTTT GGCTATGCAAGAGTTTATGATACTACCTGTAGGAGCTACCTCATTCTC GGAGGCCTTCCAGATGGGAAGTGAAGTTTATCATACATTGAAGGGGA TAATCAAAACTAAGTATGGTCAAGATGCTTGTAATGTCGGAGATGAAG GAGGGTTTG NCBI homepage 1. What is the name of the gene that the unknown cDNA sequence is derived from? 1. What is the name of the gene that the unknown cDNA sequence is derived from? 1. What is the name of the gene that the unknown cDNA sequence is derived from? 2. Identify this gene bythe 1. What is the the location name ofof the gene that Arabidopsis thaliana chromosome and unknown cDNA sequence is derived from? genome locus. 2. Identify the location of this gene by Arabidopsis thaliana chromosome and genome locus. 3. What is the function of this gene? 4. How many nucleotides are in the coding sequence of this gene? 4. How many nucleotides are in the coding sequence of this gene? 1434 nucleotides 5. What sequence of amino acids is encoded by your unknown cDNA sequence? 6.In the Arabidopsis genome, what other gene has the most similar protein sequence to your gene? 6.In the Arabidopsis genome, what other gene has the most similar protein sequence to your gene? 6.In the Arabidopsis genome, what other gene has the most similar protein sequence to your gene? 7. In the human genome, what is the most closely related gene to your Arabidopsis gene? 7. In the human genome, what is the most closely related gene to your Arabidopsis gene? 8. What T-DNA insertion for this gene would be likely to knock out gene function? 8. What T-DNA insertion for this gene would be likely to knock out gene function? 8. What T-DNA insertion for this gene would be likely to knock out gene function? 8. What T-DNA insertion for this gene would be likely to knock out gene function? 9.Give a literature citation to a research article that studied a knock out of this gene in Arabidopsis. 9.Give a literature citation to a research article that studied a knock out of this gene in Arabidopsis.
