Download Arabidopsis Gene Project Slides

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Epigenetics in learning and memory wikipedia , lookup

Epistasis wikipedia , lookup

X-inactivation wikipedia , lookup

Epigenetics of human development wikipedia , lookup

Non-coding DNA wikipedia , lookup

Metagenomics wikipedia , lookup

Genomic library wikipedia , lookup

Epigenetics of neurodegenerative diseases wikipedia , lookup

Zinc finger nuclease wikipedia , lookup

Protein moonlighting wikipedia , lookup

No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup

NEDD9 wikipedia , lookup

Human genome wikipedia , lookup

Transposable element wikipedia , lookup

Public health genomics wikipedia , lookup

Pathogenomics wikipedia , lookup

History of genetic engineering wikipedia , lookup

Point mutation wikipedia , lookup

Epigenetics of diabetes Type 2 wikipedia , lookup

Copy-number variation wikipedia , lookup

Genetic engineering wikipedia , lookup

Nutriepigenomics wikipedia , lookup

Saethre–Chotzen syndrome wikipedia , lookup

Neuronal ceroid lipofuscinosis wikipedia , lookup

Genomics wikipedia , lookup

Gene wikipedia , lookup

Gene expression profiling wikipedia , lookup

The Selfish Gene wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

Genome (book) wikipedia , lookup

RNA-Seq wikipedia , lookup

Gene therapy of the human retina wikipedia , lookup

Gene therapy wikipedia , lookup

Gene expression programming wikipedia , lookup

Gene desert wikipedia , lookup

Genome evolution wikipedia , lookup

Site-specific recombinase technology wikipedia , lookup

Gene nomenclature wikipedia , lookup

Microevolution wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

Genome editing wikipedia , lookup

Designer baby wikipedia , lookup

Helitron (biology) wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Transcript
Arabidopsis Gene
Project
GK-12 April Workshop
Karolyn Giang and Dr. Mulligan
Reverse genetics

An approach used to determine the
function of a gene from known DNA
sequence
BLAST: Basic Local Alignment Search Tool
Gene project
You are working on an Arabidopsis gene discovery project,
and your job is to sequence cDNAs and then learn all you
can about the genes from all types of databases: DNA
sequence, genome, and publication databases.
Query sequence:
TCCTGCATTCAATGTGATCAATGGAGGCAGTCATGCTGGGAATAGTTT
GGCTATGCAAGAGTTTATGATACTACCTGTAGGAGCTACCTCATTCTC
GGAGGCCTTCCAGATGGGAAGTGAAGTTTATCATACATTGAAGGGGA
TAATCAAAACTAAGTATGGTCAAGATGCTTGTAATGTCGGAGATGAAG
GAGGGTTTG
NCBI homepage
1. What is the name of the gene that the
unknown cDNA sequence is derived from?
1. What is the name of the gene that the
unknown cDNA sequence is derived from?
1. What is the name of the gene that the
unknown cDNA sequence is derived from?
2.
Identify
this
gene
bythe
1. What
is the
the location
name ofof
the
gene
that
Arabidopsis thaliana chromosome and
unknown cDNA sequence is derived from?
genome locus.
2. Identify the location of this gene by
Arabidopsis thaliana chromosome and
genome locus.
3. What is the function
of this gene?
4. How many nucleotides are in the
coding sequence of this gene?
4. How many nucleotides are in the
coding sequence of this gene?
1434 nucleotides
5. What sequence of amino acids is
encoded by your unknown cDNA sequence?
6.In the Arabidopsis genome, what other gene has
the most similar protein sequence to your gene?
6.In the Arabidopsis genome, what other gene has
the most similar protein sequence to your gene?
6.In the Arabidopsis genome, what other gene has
the most similar protein sequence to your gene?
7. In the human genome, what is the most
closely related gene to your Arabidopsis gene?
7. In the human genome, what is the most closely
related gene to your Arabidopsis gene?
8. What T-DNA insertion for this gene
would be likely to knock out gene function?
8. What T-DNA insertion for this gene
would be likely to knock out gene function?
8. What T-DNA insertion for this gene
would be likely to knock out gene function?
8. What T-DNA insertion for this gene
would be likely to knock out gene function?
9.Give a literature citation to a research article that
studied a knock out of this gene in Arabidopsis.
9.Give a literature citation to a research article that
studied a knock out of this gene in Arabidopsis.