* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Camp 1 - UCSC Directory of individual web sites
Restriction enzyme wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
DNA repair protein XRCC4 wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Genetic engineering wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Polyadenylation wikipedia , lookup
Gene regulatory network wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Metalloprotein wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Molecular cloning wikipedia , lookup
DNA supercoil wikipedia , lookup
Non-coding DNA wikipedia , lookup
Proteolysis wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Biochemistry wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Community fingerprinting wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Messenger RNA wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Gene expression wikipedia , lookup
Transfer RNA wikipedia , lookup
Point mutation wikipedia , lookup
Genetic code wikipedia , lookup
Epitranscriptome wikipedia , lookup
Chapter 25 Gene Expression and Protein Synthesis Introduction • The central dogma of molecular biology • Information contained in DNA molecules is expressed in the structure of proteins. • Gene expression is the turning on or activation of a gene. DNA replication RNA replication DNA Transcription mRNA Revers e transcriptase eukaryotes (humans) In Nucleus of cell Translation protein Eukaryotes (humans) In cytoplasm Bacteria (transcriptn + translatn) Transcription • -the process by which information encoded in a DNA molecule is copied into an mRNA molecule. • 1. Transcription starts when the DNA double helix begins to unwind near the gene to be transcribed. • 2. Only one strand of the DNA is transcribed. • 3. Ribonucleotides assemble along the unwound DNA strand in a complementary sequence. • Enzymes called polymerases (poly) catalyze transcription: • poly I: formation of rRNA formation, • poly II: formation of mRNA formation • poly III: formation of tRNA formation. 1. 2. 3. 4. Transcription • A eukaryotic gene has two RNA; the parts: 1. 2. 3. 4. 5. A structural gene that is transcribed into structural gene is made of exons and introns. A regulatory gene that controls transcription; the regulatory gene is not transcribed but has control elements, one of which is the promoter. A promoter is unique to each gene. There is always a sequence of bases on the DNA strand called an initiation signal. Promoters also contain consensus sequences, such as the TATA box, in which the two nucleotides T and A are repeated many times. 3. 5. 4. Figure 25.2 2. 1. RNA in Translation • • • • mRNA, rRNA, and tRNA all participate in translation. Protein synthesis takes place on ribosomes (e.g. rRNA). A ribosome dissociates into larger (60S) and a smaller body (40S). The 5’ end of the mature mRNA is bonded to the 40S ribosome and this unit then joined to the 60S ribosome. • Triplets of bases on mRNA are called codons. e.g. AUG • The 20 amino acids are then brought to the mRNA-ribosome complex, each amino acid by its own particular tRNA (e.g. w/ Met). rRNA-40S mRNA rRNA-60S Note: anticodon for AUG: UAC “Met” see table 25.1 tRNA tRNA • • • Each tRNA is specific for only one amino acid (e.g. UAC Met). Cell carries at least 20 specific enzymes (e.g. AARS) each specific for one amino acid. (i.e. links Amino acids with spec. tRNA) • NOTE: 20 amino acids always/usually present in cytoplasm to make proteins (usually) otherwise-bad hair day? Poor nutrition. . . Limited amino acid(s) in diet • • Challenge Question? What is the only food with all 20 amino acids in one serving? • Most important segments of tRNA • 1. site where enzymes attach amino acids (3’ end) • 2. recognition site. (three basses anticodon: UAC bondS AUG) (e.g. Met) 1. Expanded tRNA (e.g. Met) (AARS) 2. anticodon UAC mRNA tRNA Confirming your Knowledge If a codon is CGU (mRNA) what is it’s anticodon? What amino acid does the code for? Hint see table 25.1 mRNA The Genetic Code • Assignments of triplets is based on several types of experiments. • One of these used synthetic mRNA. • If mRNA is polyU, polyPhe is formed; the triplet UUU, therefore, must code for Phe. • If mRNA is poly ---ACACAC---, poly(Thr-His) is formed; ACA must code for Thr, and CAC for His. • By 1967, the genetic code was broken. The Genetic Code: Table 25.1 5' U C U UUU UUC UUA UUG CUU CUC CUA CUG AU U AU C A AU A AU G GU U G GU C GU A GU G Phe Phe Leu Leu Leu Leu Leu Leu Ile Ile Ile Met* Val Val Val Val C UCU UCC UCA UCG Ser Ser Ser Ser A U AU U AC U AA U AG CAU CAC CAA CAG Tyr Tyr Stop Stop His His Gln Gln G U GU U GC U GA U GG CGU CGC CGA CGG Cys Cys S top Trp Arg Arg Arg Arg CCU CCC CCA CCG Pro Pro Pro Pro ACU ACC ACA ACG GCU GCC GCA GCG Thr Thr Thr Thr Ala Ala Ala Ala AAU AAC AAA AAG GAU GAC GAA GAG As n As n Lys Lys A sp A sp Glu Glu A GU A GC A GA A GG GGU GGC GGA GGG Ser Ser Arg Arg Gly Gly Gly Gly 3' U C A G U C A G U C A G U C A G *AUG s ign als tran slation initiation as w ell as codin g for Met NOTE: Features of the Code • All 64 codons have been assigned. • 61 code for amino acids. (What about the others 3?) • 3 (UAA, UAG, and UGA) serve as termination signals. • AUG, universal start signal. • Only Trp and Met have one codon each. • More than one triplet can code for the same amino acid; Leu, Ser, and Arg, for example, are each coded for by six triplets. 5' U AUG CGUAGUAAUGGUAGUAUAUAA C AU U AU C AU A AU G GU U G GU C GU A GU G A Start codon Stop codon U UUU UUC UUA UUG CUU CUC CUA CUG Phe Phe Leu Leu Leu Leu Leu Leu Ile Ile Ile Met* Val Val Val Val C UCU UCC UCA UCG Ser Ser Ser Ser A U AU U AC U AA U AG CAU CAC CAA CAG Tyr Tyr Stop Stop His His Gln Gln G U GU U GC U GA U GG CGU CGC CGA CGG Cys Cys S top Trp Arg Arg Arg Arg CCU CCC CCA CCG Pro Pro Pro Pro ACU ACC ACA ACG GCU GCC GCA GCG Thr Thr Thr Thr Ala Ala Ala Ala AAU AAC AAA AAG GAU GAC GAA GAG As n As n Lys Lys A sp A sp Glu Glu A GU A GC A GA A GG GGU GGC GGA GGG Ser Ser Arg Arg Gly Gly Gly Gly 3' U C A G U C A G U C A G U C A G *AUG s ign als tran slation initiation as w ell as codin g for Met Features of the Code • For the 15 amino acids coded for by 2, 3, or 4 triplets, it is only the third letter of the codon that varies. Gly, for example, is coded for by GGA, GGG, GGC, and GGU. • The code is almost universal: it the same in viruses, prokaryotes, and eukaryotes; the only exceptions are some codons in mitochondria. • Supports Darwins theory of evolution Confirming your Knowledge If you had 750 DNA segment, (assume Met (AUG) and stop codon UUG are stripped off ) How many Amino acids appear in the protein the DNA codes for? Translation • the process whereby a base sequence of mRNA is used to create a protein. • There are four major stages in protein synthesis: • • • • 1. Activation 2. Initiation 3. Elongation 4. Termination DNA replication RNA replication DNA Transcription mRNA Revers e transcriptase Translation protein Protein Synthesis 1. Hydrolize ATP AMP 2. Link adenosine to Amino acid • Activation 1. 2. Amino Acid Activation • 1. Activated amino acid is bound to spec. tRNA • 2. w/ ester carboxyl group of the amino acid and the 3’-OH of the tRNA. (e.g. Cys) 2. 1. (e.g. Cys) (AARS) Chain Initiation • 40S Figure 25.4 Formation of an initiation complex. 1. mRNA 1. 40S rRNA binds with mRNA 40S 3. 2. 2. tRNA binds with 40S rRNA/mRNA 3. 60S rRNA binds with 40S rRNA/mRNA 60S P site A site E site 60S Acceptor (A) Site Protein (P) Site Exit (E) Site (tRNA) Elongation: Figure 25.6 Show Videos 26.6 E site Process: Hydrolyzes GTP GDP A site P site Forms peptide bond (b/w Ala-Met) Peptide Bond Formation • Peptide bond formation in protein synthesis. X-ray model of Ribosome w/ rRNA tRNA mRNA Fig. 25-7, p. 629 UAA (terminate me (‘.’) Termination • Chain termination requires: • Termination codons (UAA, UAG, or UGA) of mRNA. • Releasing factors that cleave the polypeptide chain from the last tRNA and release the tRNA from the ribosome. Gene Regulation • the various methods used by organisms to control which genes will be expressed and when. • 1. Regulations operate at the transcriptional level (DNA RNA) • 2. Others operate at the translational level (mRNA protein). 1. Transcriptional Level In eukaryotes, transcription regulated by 3 elements: promoters, enhancers, and response elements. 2. Translational Level • a number of mechanisms that ensure quality control. • A. aminoacyl-tRNA synthase (AARS) control Each amino acid must bond to the proper tRNA. B. Termination control stop codons must be recognized by release factors. C. Post-translational control • In most proteins, the Met at the N-terminal end is removed by Met-aminopeptidase. • Certain proteins called chaperones help newly synthesized proteins to fold properly. Mutations and Mutagens • Mutation: a heritable change in the base sequence of DNA. • It is estimated that, on average, there is one copying error for every 1010 bases. • Mutations can occur during replication. • Base errors can also occur during transcription in protein synthesis (a nonheritable error). • Other errors in replication may lead to a change in protein structure and be very harmful. Mutations and Mutagens • • Chemical(s) that causes a base change in DNA. What are common mutagens we are all exposed to? • Cells have repair mechanisms called nucleotide excision repair (NER) units prevents mutations. • NER can prevent mutations by cutting out damaged areas and resynthesizing them. • Not all mutations are harmful. • Certain ones may be beneficial because they enhance the survival rate of the species. Recombinant DNA • DNA from two sources that have been combined into one molecule. • One example of the technique begins with plasmids found in the cells of Escherichia coli. • plasmid: a small, circular, double-stranded DNA molecule of bacterial origin. • A class of enzymes called restriction endonucleases cleave DNA at specific locations. • One, for example, may be specific for cleavage of the bond between A-G in the sequence -CTTAAAG-. Restriction enzyme cleaves here . . . Recombinant DNA • In this example “B ” stands for bacterial gene, and “H Sticky ends for human gene. B B GAATTC CTTAAG restriction B endonucleas e B B B G + AATTC CTTAA G B B • The DNA is now double-stranded with two “sticky ends”, each with free bases that can pair with a complementary section of DNA. • Next, we cut a human gene with the same restriction endonuclease; for example, the gene for human insulin. H H GAATTC CTTAAG restriction H endon ucleas e H H H G + AATTC CTTAA G H H Recombinant DNA • The human gene is now spliced into the plasmid by the enzyme DNA ligase. B B G AATTC + CTTAA G H DNA ligase H B B GAATTC CTTAAG H H • Splicing takes place at both ends of the human gene and the plasmid is once again circular. • The modified plasmid is then put back into the bacterial cell where it replicates naturally every time the cell divides. • These cells now manufacture the human protein, in our example human insulin, by transcription and translation. Recombinant DNA • Figure 25.11 The recombinant DNA technique. 1st human insulin produced by fermentation 1972 In 1972, University of California, San Francisco, biochemist Herbert Boyer met Stanford University geneticist Stanley Norman Cohen. Cohen founded Genentech 1976 Cloning DNA • Figure 26.17 The cloning of human DNA fragments with a viral vector. Gene Therapy • Figure 26.18 Gene therapy via retroviruses. Protein Synthesis Gene Expression and Protein Synthesis End Chapter 26