Download Protein synthesis

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

RNA wikipedia , lookup

DNA polymerase wikipedia , lookup

Genealogical DNA test wikipedia , lookup

Frameshift mutation wikipedia , lookup

Nucleosome wikipedia , lookup

United Kingdom National DNA Database wikipedia , lookup

DNA damage theory of aging wikipedia , lookup

History of RNA biology wikipedia , lookup

Genomics wikipedia , lookup

Gene wikipedia , lookup

Gel electrophoresis of nucleic acids wikipedia , lookup

Non-coding DNA wikipedia , lookup

Molecular cloning wikipedia , lookup

Epigenomics wikipedia , lookup

Replisome wikipedia , lookup

History of genetic engineering wikipedia , lookup

Non-coding RNA wikipedia , lookup

DNA supercoil wikipedia , lookup

Cell-free fetal DNA wikipedia , lookup

DNA vaccination wikipedia , lookup

NEDD9 wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Nucleic acid double helix wikipedia , lookup

Extrachromosomal DNA wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

Helitron (biology) wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

Point mutation wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Genetic code wikipedia , lookup

Deoxyribozyme wikipedia , lookup

Messenger RNA wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Primary transcript wikipedia , lookup

Transfer RNA wikipedia , lookup

Expanded genetic code wikipedia , lookup

Epitranscriptome wikipedia , lookup

Transcript
Name ______________________________
Protein Synthesis
DNA directly controls the manufacture of proteins within in a cell through a process called protein
synthesis. In this activity your guidance is needed to help this along. You will construct a protein by first
reading the DNA creating a strand of mRNA. Next you will follow the mRNA to the ribosome where
tRNA reads the mRNA producing amino acids. Finally, a protein will be synthesized from the string of
amino acids.
1. Go to the following website: http://www.pbs.org/wgbh/aso/tryit/dna/index.html# .
2. Click on DNA Workshop Activity.
3. This point of the activity starts in the _________________ of a cell.
4. Click on Protein Synthesis at the top right.
5. Click on Unzip.
6. What is being unzipped? __________
7. How does this molecule unzip in a real cell (explain)?
8. What do the letters that you are matching up represent?
9. How long would an actual RNA molecule be? _______________________________
10. Where does the mRNA molecule go after it transcribes the DNA?
11. What happens during translation?
12. What part of a cell is responsible for translation ? ________________
13. The tRNA has an _________________ that an amino acid is attached which matches up with
the mRNA ___________, and both are ________ bases long.
14. What happens to the tRNA after it delivers the amino acid?
15. What is a polypeptide chain?
16. What is the possible length of a polypeptide chain? _____________________________
17. What ends the polypeptide chain formation? ________________________________
18. The three amino acids are ______________, ________________, and ________________.
19. Make a mRNA and a tRNA chain from the following DNA:
DNA
mRNA
tRNA
ATGATACGCAATGGCCCAATTTAG