* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Protein synthesis
DNA polymerase wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Frameshift mutation wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
History of RNA biology wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Non-coding DNA wikipedia , lookup
Molecular cloning wikipedia , lookup
Epigenomics wikipedia , lookup
History of genetic engineering wikipedia , lookup
Non-coding RNA wikipedia , lookup
DNA supercoil wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
DNA vaccination wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Helitron (biology) wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Point mutation wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Genetic code wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Messenger RNA wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Primary transcript wikipedia , lookup
Transfer RNA wikipedia , lookup
Name ______________________________ Protein Synthesis DNA directly controls the manufacture of proteins within in a cell through a process called protein synthesis. In this activity your guidance is needed to help this along. You will construct a protein by first reading the DNA creating a strand of mRNA. Next you will follow the mRNA to the ribosome where tRNA reads the mRNA producing amino acids. Finally, a protein will be synthesized from the string of amino acids. 1. Go to the following website: http://www.pbs.org/wgbh/aso/tryit/dna/index.html# . 2. Click on DNA Workshop Activity. 3. This point of the activity starts in the _________________ of a cell. 4. Click on Protein Synthesis at the top right. 5. Click on Unzip. 6. What is being unzipped? __________ 7. How does this molecule unzip in a real cell (explain)? 8. What do the letters that you are matching up represent? 9. How long would an actual RNA molecule be? _______________________________ 10. Where does the mRNA molecule go after it transcribes the DNA? 11. What happens during translation? 12. What part of a cell is responsible for translation ? ________________ 13. The tRNA has an _________________ that an amino acid is attached which matches up with the mRNA ___________, and both are ________ bases long. 14. What happens to the tRNA after it delivers the amino acid? 15. What is a polypeptide chain? 16. What is the possible length of a polypeptide chain? _____________________________ 17. What ends the polypeptide chain formation? ________________________________ 18. The three amino acids are ______________, ________________, and ________________. 19. Make a mRNA and a tRNA chain from the following DNA: DNA mRNA tRNA ATGATACGCAATGGCCCAATTTAG