* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download transcription_ translation and protein synthesis REGULAR
Gel electrophoresis of nucleic acids wikipedia , lookup
Peptide synthesis wikipedia , lookup
Molecular cloning wikipedia , lookup
Promoter (genetics) wikipedia , lookup
RNA interference wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
DNA supercoil wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Metalloprotein wikipedia , lookup
Proteolysis wikipedia , lookup
Non-coding DNA wikipedia , lookup
RNA silencing wikipedia , lookup
Polyadenylation wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Silencer (genetics) wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Point mutation wikipedia , lookup
Biochemistry wikipedia , lookup
Messenger RNA wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Gene expression wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Genetic code wikipedia , lookup
Transcription, Translation & Protein Synthesis Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message contained within its DNA. However: DNA is only found in the nucleus Proteins are only made outside the nucleus – in the cytoplasm. Protein Synthesis How do the many different messages within the DNA molecule get to the many ribosomes outside the nucleus? A molecular cousin of DNA – RNA – is used to carry these messages. Ribonucleic Acids (RNA) There are three types of RNA: 1. 2. 3. mRNA – carries a message from the DNA to the ribosome tRNA – transports amino acids to the mRNA to make a protein rRNA – make up ribosomes, which make protein. Ribonucleic Acids (RNA) RNA is almost exactly like DNA, except: 1. RNA has a sugar ribose DNA has a sugar deoxyribose 2. RNA contains uracil (U) DNA has thymine (T) 3. RNA molecule is single-stranded DNA is double-stranded Ribonucleic Acids (RNA) Protein Synthesis Occurs in TWO steps: Transcription – the genetic information from a strand of DNA is copied into a strand of mRNA 2. Translation – the mRNA, with the help of the ribosome, forms a chain of amino acids (eventually forming a protein) 1. The Central Dogma This order of events is called the central dogma of molecular biology: DNA RNA P R O T E I N Step One: Transcription 1. 2. 3. DNA unzips Bases pair up: Free nucleotides in the cell find their complementary bases along the new strands. What will be different?? New backbone formed: What will be different?? Step One: Transcription Watch this simplified animation: Transcription animation Step One: Transcription Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT AUGCGUACUGAUCGUUCAGAUUGA Step One: Transcription Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT AUGCGUACUGAUCGUUCAGAUUGA Step 1½: RNA Editing An mRNA molecule has to be “edited” because there’s a lot of unnecessary information that needs to be removed. An mRNA sequence that does NOT code for protein is called an intron. A sequence that is useful in making a protein is called an exon. Step 1½: RNA Editing DNA transcription pre-RNA (in nucleus) exon 1 interon RNA editing exon 2 interon interon interon RNA (in cytoplasm) exon 1 exon 2 exon 3 exon 3 Step Two: Translation 1. 2. 3. So how do you exactly go about determining what protein your cells are going to make? FIRST, Divide the mRNA sequence into codons. Codons are three-base sections of mRNA: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA 3. Translation Three parts: 1. initiation: start codon (AUG) 2. elongation: 3. termination: stop codon (UAG) Step Two: Translation Watch this simplified animation: Translation Animation Step Two: Translation Problem: There are 20 different amino acids. There are 4 RNA bases. A T C G phe ile leu val met pro ser ala thr his tyr asn gln asp lys cys glu arg trp gly Step Two: Translation You need to figure out what amino acid matches up with each codon: 2. AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA ? tRNA A go-getter. Gets the right amino acids to make the right protein according to mRNA instructions It contains anti-codons EX: UAC – mRNA AUG – tRNA Transfer RNA (tRNA) amino acid attachment site methionine U A C anticodon amino acid The Genetic Code Step Two: Translation 2. Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA met ? The Genetic Code Step Two: Translation 2. Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA met arg thr asp arg ser asp ??? Step Two: Translation 2. Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA met met thr asp arg ser asp STOP RECAP: 1. 2. 3. DNA is transcribed into mRNA in the nucleus. The mRNA leaves the nucleus and enters the cytoplasm. The protein is translated from the mRNA sequence using tRNA and amino acids.