* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download 3.4: Transcription and Translation
Maurice Wilkins wikipedia , lookup
Community fingerprinting wikipedia , lookup
RNA interference wikipedia , lookup
Transcription factor wikipedia , lookup
Bottromycin wikipedia , lookup
Molecular cloning wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Molecular evolution wikipedia , lookup
Biochemistry wikipedia , lookup
Polyadenylation wikipedia , lookup
RNA silencing wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Non-coding DNA wikipedia , lookup
Point mutation wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Silencer (genetics) wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Messenger RNA wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Gene expression wikipedia , lookup
Expanded genetic code wikipedia , lookup
Non-coding RNA wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
3.4: Transcription and Translation 3.5.1: Compare the structure of RNA and DNA. 3.5.1: Compare the structure of RNA and DNA. IB Question: Compare the structure and composition of DNA with RNA. [4] both are polymers of nucleotides / both nucleic acids; sugar is deoxyribose in DNA and ribose in RNA; DNA is double stranded and RNA is single stranded; DNA has a (double) helix; DNA has thymine while RNA has uracil; (require full names written out) both contain four nitrogenous bases / A, G, C, T for DNA and A, G, C, U for RNA; [4 max] 3.5.2: Outline DNA transcription in terms of the formation of an RNA strand complementary to the DNA strand by RNA polymerase. 3.5.3: Describe the genetic code in terms of codons composed of triplets of bases. Genetic code 3.5.4:Explain the process of translation,leading to polypeptide formation. Translation What will be the sequence of amino acids from the following mRNA transcript? UAUGGAGCGCUAUCGAUCGUUAGA IB Question: Explain the process of translation. [8] messenger / mRNA attaches to ribosome (small unit); many ribosome/polyribosomes bind to same mRNA; carries codons / triplet of bases each coding for one amino acid; transfer / tRNA each have specific anticodon; triplet of bases for specific amino acid; tRNA carries specific amino acid; tRNA binds to ribosomes; to corresponding triplet base / codon; a second tRNA binds to next codon; two amino acids bind together; in a peptide linkage; first tRNA detaches; ribosome moves along mRNA; another tRNA binds to next codon; continues until polypeptide / protein formed to stop codon; stop codon has no corresponding tRNA/amino acid / causes release of polypeptide; [8 max] IB Question: Compare DNA transcription with translation. [4] both require ATP; DNA is transcribed and mRNA is translated; transcription produces RNA and translation produces polypeptides/protein; RNA polymerase for transcription and ribosomes for translation / ribosomes in translation only; transcription in the nucleus (of eukaryotes) and translation in the cytoplasm/at ER; tRNA needed for translation but not transcription; [4 max] 3.5.5: Discuss the relationship between one gene and one polypeptide. One gene may code for multiple polypeptides due to alternative splicing