* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download How DNA Determines Traits - Liberty Union High School District
Site-specific recombinase technology wikipedia , lookup
Frameshift mutation wikipedia , lookup
SNP genotyping wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Genetic engineering wikipedia , lookup
Messenger RNA wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Human genome wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Metagenomics wikipedia , lookup
DNA vaccination wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Epigenomics wikipedia , lookup
Quantitative trait locus wikipedia , lookup
Genomic library wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Epitranscriptome wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Molecular cloning wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Non-coding DNA wikipedia , lookup
Microsatellite wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
DNA supercoil wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Transfer RNA wikipedia , lookup
Microevolution wikipedia , lookup
Genome editing wikipedia , lookup
Primary transcript wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Designer baby wikipedia , lookup
Deoxyribozyme wikipedia , lookup
History of genetic engineering wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Point mutation wikipedia , lookup
Genetic code wikipedia , lookup
Helitron (biology) wikipedia , lookup
How Does DNA Determine the Traits of an Organism Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism: the Snork. Snorks were discovered on the planet Dee Enae in a distant solar system. Snorks only have one chromosome with 6 genes on it. You job is to analyze the genes of its DNA and determine what traits the organism has. SNORK DNA AND TRAITS mRNA triplet Amino Acid Number UGG 20 Amino Acid Sequence Trait UCG 16 20-11-13 hairless GCU 2 20-12-13 hairy UUG 4 16-2 - 5 4 legged GCG 3 16-4 - 5 2 legged CCC 5 12-7-8 round head UCC 7 5-7-8 block head UUU 8 AAA 9 9-8 - 8 no tail CCA 12 9-4 - 8 tail AUA 13 11-3-2 slanted eyes GGG 1 11-3-3 wide round eyes UAG 6 6-6-10 Male (blue) GAU 10 6-6-14 Female (pink) CCU 11 Observations and Analysis of Snork DNA: You are given a chromosome from a Snork with the following sequence. Each gene has only 3 amino acids. Your job is to determine the sequence of amino acids for your specimen. Write the complimentary mRNA, tRNA, the Amino acid it codes for and the related trait in the chart below. DNA ACCGGTTATAGCCGAGGGTTTAACAAAGGACGCCGAGGGAGGAAAATCATCCTA mRNA tRNA (AA) Trait Draw your Snork in the space below. Be creative!