* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Chapter 21: Molecular Basis of Cancer
Deoxyribozyme wikipedia , lookup
Gene therapy wikipedia , lookup
Gene nomenclature wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Non-coding DNA wikipedia , lookup
BRCA mutation wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Genome (book) wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Gene therapy of the human retina wikipedia , lookup
Koinophilia wikipedia , lookup
Population genetics wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
SNP genotyping wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Genome evolution wikipedia , lookup
Designer baby wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Molecular Inversion Probe wikipedia , lookup
Genome editing wikipedia , lookup
Neuronal ceroid lipofuscinosis wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Saethre–Chotzen syndrome wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Helitron (biology) wikipedia , lookup
Microsatellite wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Oncogenomics wikipedia , lookup
Microevolution wikipedia , lookup
Molecular diagnosis of heterogeneous genetic diseases: the example of muscular dystrophies Vincenzo Nigro Dipartimento di Patologia Generale, Seconda Università degli Studi di Napoli Telethon Institute of Genetics and Medicine (TIGEM) What is a mutation? A variation of the DNA sequence that is only found in affected individuals that is never found in non affected individuals that accounts for the pathological process/status that, when corrected in time, disease is rescued ..that is only found in affected and that is never found in non affected incomplete penetrance that is more often found in affected than in non affected... 50.000 private variants = innocuous differences belonging to one family CCCCAGCCTCCTTGCCAACGCCCCCTTTCCCTCTCCCCCTCCCGCTCGGCGCTGACC CCCCATCCCCACCCCCGTGGGAACACTGGGAGCCTGCACTCCACAGACCCTCTCCTT GCCTCTTCCCTCACCTCAGCCTCCGCTCCCCGCCCTCTTCCCGGCCCAGGGCGCCG GCCCACCCTTCCCTCCGCCGCCCCCCGGCCGCGGGGAGGACATGGCCGCGCACAG GCCGGTGGAATGGGTCCAGGCCGTGGTCAGCCGCTTCGACGAGCAGCTTCCAATAA AAACAGGACAGCAGAACACACATACCAAAGTCAGTACTGAGCACAACAAGGAATGTC TAATCAATATTTCCAAATACAAGTTTTCTTTGGTTATAAGCGGCCTCACTACTATTTTAA AGAATGTTAACAATATGAGAATATTTGGAGAAGCTGCTGAAAAAAATTTATATCTCTCT CAGTTGATTATATTGGATACACTGGAAAAATGTCTTGCTGGGCAACCAAAGGACACAA TGAGATTAGATGAAACGATGCTGGTCAAACAGTTGCTGCCAGAAATCTGCCATTTTCT TCACACCTGTCGTGAAGGAAACCAGCATGCAGCTGAACTTCGGAATTCTGCCTCTGG GGTTTTATTTTCTCTCAGCTGCAACAACTTCAATGCAGTCTTTAGTCGCATTTCTACCA GGTTACAGGAATTAACTGTTTGTTCAGAAGACAATGTTGATGTTCATGATATAGAATTG TTACAGTATATCAATGTGGATTGTGCAAAATTAAAACGACTCCTGAAGGAAACAGCAT TTAAATTTAAAGCCCTAAAGAAGGTTGCGCAGTTAGCAGTTATAAATAGCCTGGAAAA GGCATTTTGGAACTGGGTAGAAAATTATCCAGATGAATTTACAAAACTGTACCAGATC CCACAGACTGATATGGCTGAATGTGCAGAAAAGCTATTTGACTTGGTGGATGGTTTTG CTGAAAGCACCAAACGTAAAGCAGCAGTTTGGCCACTACAAATCATTCTCCTTATCTT GTGTCCAGAAATAATCCAGGATATATCCAAAGACGTGGTTGATGAAAACAACATGAAT AAGAAGTTATTTCTGGACAGTCTACGAAAAGCTCTTGCTGGCCATGGAGGAAGTAGG CAGCTGACAGAAAGTGCTGCAATTGCCTGTGTCAAACTGTGTAAAGCAAGTACTTACA TCAATTGGGAAGATAACTCTGTCATTTTCCTACTTGTTCAGTCCATGGTGGTTGATCTT AAGAACCTGCTTTTTAATCCAAGTAAGCCATTCTCAAGAGGCAGTCAGCCTGCAGATG TGGATCTAATGATTGACTGCCTTGTTTCTTGCTTTCGTATAAGCCCTCACAACAACCAA CACTTTAAGATCTGCCTGGCTCAGAATTCACCTTCTACATTTCACTATGTGCTGGTAAA TTCACTCCATCGAATCATCACCAATTCCGCATTGGATTGGTGGCCTAAGATTGATGCT GTGTATTGTCACTCGGTTGAACTTCGAAATATGTTTGGTGAAACACTTCATAAAGCAG TGCAAGGTTGTGGAGCACACCCAGCAATACGAATGGCACCGAGTCTTACATTTAAAG AAAAAGTAACAAGCCTTAAATTTAAAGAAAAACCTACAGACCTGGAGACAAGAAGCTA TAAGTATCTTCTCTTGTCCATGGTGAAACTAATTCATGCAGATCCAAAGCTCTTGCTTT GTAATCCAAGAAAACAGGGGCCCGAAACCCAAGGCAGTACAGCAGAATTAATTACAG GGCTCGTCCAACTGGTCCCTCAGTCACACATGCCAGAGATTGCTCAGGAAGCAATGG AGGCTCTGCTGGTTCTTCATCAGTTAGATAGCATTGATTTGTGGAATCCTGATGCTCC TGTAGAAACATTTTGGGAGATTAGCTCACAAATGCTTTTTTACATCTGCAAGAAATTAA CTAGTCATCAAATGCTTAGTAGCACAGAAATTCTCAAGTGGTTGCGGGAAATATTGAT CTGCAGGAATAAATTTCTTCTTAAAAATAAGCAGGCAGATAGAAGTTCCTGTCACTTTC CCCCAGCCTCCTTGCCAACGCCCCCTTTCCCTCTCCCCCTCCCGCTCGGCGCTGACC CCCCATCCCCACCCCCGTGGGAACACTGGGAGCCTGCACTCCACAGACCCTCTCCTT GCCTCTTCCCTCACCTCAGCCTCCGCTCCCCGCCCTCTTCCCGGCCCAGGGCGCCG GCCCACCCTTCCCTCCGCCGCCCCCCGGCCGCGGGGAGGACATGGCCGCGCACAG GCCGGTGGAATGGGTCCAGGCCGTGGTCAGCCGCTTCGACGAGCAGCTTCCAATAA AAACAGGACAGCAGAACACACATACCAAAGTCAGTACTGAGCACAACAAGGAATGTC TAATCAATATTTCCAAATACAAGTTTTCTTTGGTTATAAGCGGCCTCACTACTATTTTAA AGAATGTTAACTATATGAGAATATTTGGAGAAGCTGCTGAAAAAAATTTATATCTCTCT CAGTTGATTATATTGGATACACTGGAAAAATGTCTTGCTGGGCAACCAAAGGACACAA TGAGATTAGATGAAACGATGCTGGTCAAACAGTTGCTGCCAGAAATCTGCCATTTTCT TCACACCTGTCGTGAAGGAAACCAGCATGCAGCTGAACTTCGGAATTCTGCCTCTGG GGTTTTATTTTCTCTCAGCTGCAACAACTTCAATGCAGTCTTTAGTCGCATTTCTACCA GGTTACAGGAATTAACTGTTTGTTCAGAAGACAATGTTGATGTTCATGATATAGAATTG TTACAGTATATCAATGTGGATTGTGCAAAATTAAAACGACTCCTGAAGGAAACAGCAT TTAAATTTAAAGCCCTAAAGAAGGTTGCGCAGTTAGCAGTTATAAATAGCCTGGAAAA GGCATTTTGGAACTGGGTAGAAAATTATCCAGATGAATTTACAAAACTGTACCAGATC CCACAGACTGATATGGCTGAATGTGCAGAAAAGCTATTTGACTTGGTGGATGGTTTTG CTGAAAGCACCAAACGTAAAGCAGCAGTTTGGCCACTACAAATCATTCTCCTTATCTT GTGTCCAGAAATAATCCAGGATATATCCAAAGACGTGGTTGATGAAAACAACATGAAT AAGAAGTTATTTCTGGACAGTCTACGAAAAGCTCTTGCTGGCCATGGAGGAAGTAGG CAGCTGACAGAAAGTGCTGCAATTGCCTGTGTCAAACTGTGTAAAGCAAGTACTTACA TCAATTGGGAAGATAACTCTGTCATTTTCCTACTTGTTCAGTCCATGGTGGTTGATCTT AAGAACCTGCTTTTTAATCCAAGTAAGCCATTCTCAAGAGGCAGTCAGCCTGCAGATG TGGATCTAATGATTGACTGCCTTGTTTCTTGCTTTCGTATAAGCCCTCACAACAACCAA CACTTTAAGATCTGCCTGGCTCAGAATTCACCTTCTACATTTCACTATGTGCTGGTAAA TTCACTCCATCGAATCATCACCAATTCCGCATTGGATTGGTGGCCTAAGATTGATGCT GTGTATTGTCACTCGGTTGAACTTCGAAATATGTTTGGTGAAACACTTCATAAAGCAG TGCAAGGTTGTGGAGCACACCCAGCAATACGAATGGCACCGAGTCTTACATTTAAAG AAAAAGTAACAAGCCTTAAATTTAAAGAAAAACCTACAGACCTGGAGACAAGAAGCTA TAAGTATCTTCTCTTGTCCATGGTGAAACTAATTCATGCAGCTCCAAAGCTCTTGCTTT GTAATCCAAGAAAACAGGGGCCCGAAACCCAAGGCAGTACAGCAGAATTAATTACAG GGCTCGTCCAACTGGTCCCTCAGTCACACATGCCAGAGATTGCTCAGGAAGCAATGG AGGCTCTGCTGGTTCTTCATCAGTTAGATAGCATTGATTTGTGGAATCCTGATGCTCC TGTAGAAACATTTTGGGAGATTAGCTCACAAATGCTTTTTTACATCTGCAAGAAATTAA CTAGTCATCAAATGCTTAGTAGCACAGAAATTCTCAAGTGGTTGCGGGAAATATTGAT CTGCAGGAATAAATTTCTTCTTAAAAATAAGCAGGCAGATAGAAGTTCCTGTCACTTTC 1-allele diseases monoallelic mutations may be responsible for dominant or X-linked disorders new random mutations are the rule with an unpredictable pattern of distribution Gender effect in mutations For mutations other than point mutations, sex biases in the mutation rate are very variable Small deletions are more frequent in females Germline base substitution mutations occur more frequently in males than in females, especially in older males Point mutations at some loci occur almost exclusively in males, whereas others occur ten times more than in females Relative frequency of de novo achondroplasia for different paternal ages Relative frequency of de novo neurofibromatosis for different paternal ages the number of male germ-cell divisions 2-allele diseases novel mutations are rare, usually mutations have a long history (100-1000 generations) mutations have an ethnical signature with a predictable pattern of distribution and frequency biallelic mutations may be responsible for autosomal recessive disorders polymorphisms and private variants are more easily discriminated vs true mutations 2-allele diseases consanguineity is a risk factor for homozygosity high carrier frequency is a risk factor for compound heterozygosity The effect of an allele null or amorph = no product hypomorph = reduced amount / activity hypermorph = increased amount / activity neomorph = novel product / activity antimorph = antagonistic product / activity Dominant or recessive phenotype? Loss of function mutations in the PAX3 gene (Waardenburg syndrome) haploinsufficiency amorph / hypomorph (1) deletion – the entire gene – part of the gene disruption of the gene structure – by insertion, inversion, translocation promoter inactivation mRNA destabilization splicing mutation – inactivating donor/acceptor – activating criptic splice sites amorph / hypomorph (2) frame-shift in translation – by insertion of n+1 or n+2 bases into the coding sequence – by deletion of n+1 or n+2 bases into the coding sequence nonsense mutation missense mutation / aa deletion – essential / conserved amino acid – defect in post-transcriptional processing – defect in cellular localization hypermorph trisomia duplication amplification (cancer) chromatin derepression (FSH) trasposition under a strong promoter – leukemia overactivity of an abnormal protein neomorph generation of chimeric proteins duplication amplification (cancer) missense mutations inclusion of coding cryptic exons usage of alternative ORFs overactivity of an abnormal protein antimorph missense mutations inclusion of coding cryptic exons usage of alternative ORFs Mutation detection mutation scanning – or resequencing methods for identifying previously unknown mutations genotyping – methods for scoring previously known mutations or single nucleotide polymorphisms (SNPs) Key questions for mutation detection strategy expected mutations are monoallelic or biallelic? is the gene well recognized for that disease? is the mutation pattern known? (deletion, dup, small mutations, etc.) which is the complexity of the gene? how many patients must be examined? how many controls should be examined? how many mutations and how many variations have already been identified in this gene? are there more members of the same gene family (or pseudogenes) in the genome? Dimension of the mutation detection study Number of patients Gene size X Number of controls General strategy for mutation detection screening of recurrent mutations frequent mutations are known? YES mutations are identified? NO NO YES SEQUENCING mutation scanning DMD Duchenne Muscular Dystrophy - 1/3,500 boys Onset -- Early childhood - about 2 to 6 years – Laboratory -- CK (50x to 1.000x), LDH5, ALT, AST, aldolase increase Symptoms -- Generalized weakness and muscle wasting affecting proximal limb muscles first. Calves often enlarged. Heart involvement Progression -- Disease progresses slowly but will affect all voluntary muscles. Survival possible beyond late twenties BMD Becker Muscular Dystrophy - 1/10,000 boys Onset -- Adolescence or adulthood Symptoms -- Almost identical to Duchenne but often much less severe. Heart involvement Progression -- Slower and more variable than DMD with survival well into mid to late adulthood Carrier of a balanced reciprocal X-autosome translocation Dystrophin gene: page 1/185 Dystrophin gene: page 2/185 Dystrophin gene: page 3/185 Dystrophin gene: page 185/185 Telethon-UILDM 250/300 DMD/BMD Qualitative test rejected Quantitative test more DNA 80plex-PCR Deletions duplications Point mutations mRNA study Family tests Log-PCR = 4 multiplex-PCR (2x20+2x18) with uniform spacing and gel position according to chromosomal position A DMD patient : groups A, B BMD patient : groups C, D Deletion ex 17-43 Duplication ex 13-23 C B DMD BMD 1: del ex 43 2: del ex 11, 17, 19, 21 3: del ex 17, 19, 21 4: del ex 50, 52 5: del ex 7, 11, 17, 19 6: del ex 61 1 2 3 4 5 6 1: no del 2: del ex 8, 12, 18, 20, 22 3: del ex 12, 18, 20, 22 4: del ex 46, 51 5: del ex 6, 8, 12, 18 6: del ex 62 D large deletions in 377/506 DMD/BMD 74.5% large duplications in 51/506 patients 10.1% SALSA MLPA probes Hybridysation 1. 2. The MLPA probemix is added to denatured genomic DNA The two parts of each probe hybridise to adjacent target sequences Ligation 3. Probes are ligated by a thermostable ligase PCR amplification 4. A universal primer pair is used to amplify all ligated probes The PCR product of each probe has a unique length (130 480 bp) Separation and quantification by capillary electrophoresis Each peak is the amplification product of a specific probe. Samples are compared to a control sample. A difference in relative peak height or peak area indicates a copy number change of the probe target sequence Detection of Chr X copy number X Male Female Triple X 283 bp 346 bp MRC-Holland b.v. MLPA discriminates sequences that differ in only a single nucleotide and can be used to detect known mutations. Mismatch Mismatch at the probe ligation site No ligation, no amplification product Perfect match Ligation of the two probe oligonucleotides Amplification product MS-MLPA M M Methylated Target Denaturation and Multiplex probe hybridization Ligation and Digestion with methylation sensitive endonucleases Unmethylated Target M M Only undigested (methylated) and ligated probes are exponentially amplified MRC-Holland b.v. Limb-girdle weakness proximal weakness: most common Lower extremities – difficulty climbing stairs – arising from a low chair or toilet – getting up from a squatted position Upper extremities – trouble lifting objects over their head – brushing their hair distal weakness – difficulty opening jars, inability to turn a key in the ignition, or tripping due to foot drop cranial weakness – dysarthria, dysphagia or ptosis Genetics of limb-girdle muscular dystrophies autosomal dominant LGMD1A LGMD1B LGMD1C LGMD1D LGMD1E LGMD1F LGMD1G 5q31.2 1q21 3p25.3 6q22 7q35 7q31.1 4p21 autosomal recessive LGMD2A LGMD2B LGMD2C LGMD2D LGMD2E LGMD2F LGMD2G LGMD2H LGMD2I LGMD2J LGMD2K LGMD2L LGMD2M 15q15 2p13.2 13q12 17q21.33 4q12 5q33 17q12 9q33 .1 19q13.3 2q24.3 9q34.1 9q31 11p13-p12 myotilin (Hauser, 2000) lamin A/C (Bonne, 1999) caveolin 3 (Minetti, 1997) ? ? filamin C ? calpain 3 (Richard, 1995) dysferlin (Bashir, Liu, 1998) g-sarcoglycan (Noguchi, 1995) a-sarcoglycan (Roberds, 1994) b-sarcoglycan (Bonnemann, Lim, 1995) d-sarcoglycan (Nigro, 1996) telethonin (Moreira, 2000) TRIM 32 (Frosk, 2002) FKRP (Brockington, 2001) titin (Udd, 2002) POMT1 (Balci, 2005) fukutin (Godfrey, 2006) ? autosomal dominant autosomal dominant forms (LGMD1) are generally milder represent less than 10% of all LGMD marked heterogeneity for LGMD1, one gene per one single family autosomal recessive autosomal recessive forms (LGMD2) have an average prevalence of 1:14,000-1:20,000 at birth frequency differences among countries this depends on higher carrier frequencies of single mutations, as 550delA for calpain 3 in Croatia, L276I for FKRP in Northern Europe, 521delT for gamma-sarcoglycan in Northern Africa At least 25% of families are excluded from any known locus and 40% of typical LGMD cases have no mutation in any known gene Tools to address the diagnosis of LGMD Clinical presentation (MRI) WB analysis Segregation study Mutation detection in patients Mutation detection in normal subjects Homogeneous collection of mutations and polymorphisms Segregation analysis Analysis of 30 polymorphic markers linked to LGMD2A, 2B, 2C-2F, 2I in sib pairs To find homozigosity… Calpain 3 24 exons Myotilin dysferlin 55 exons Lamin A/C 13 exons a-sarcoglycan 10 exons Caveolin 3 2 exons (3) b-sarcoglycan 6 ex (7) g-sarcoglycan 8 ex (10) d-sarcoglyican 9 exons Telethonin 2 exons (3) TRIM32 1 exons (7) FKRP 4 esons (8) Titin 363 ex (35) 9 exons Case 1 The gene is known It is composed of five small size exons There are 10 patients, sons of consanguineous parents Expected mutations are homozygous Mutations have never been identified in this gene There is no other member of the same gene families (or pseudogenes) in the genome Case 2 The gene is known The putative function of the gene product is to serve as a transcription factor Expected mutations are dominant Mutations have never been identified in this gene There are other members of the same gene families (or pseudogenes) in the genome Sequencing With the ongoing reduction of costs (today about 2-4 €/run), sequencing of PCR products is applied for mutation detection Sequencing is often thought of as the 'gold standard' for mutation detection. This perception is distorted due to the fact that this is the only method of mutation identification, but this does not mean it is the best for mutation detection Sequencing artifacts FALSE POSITIVE (specificity) –when searching for heterozygous DNA differences there are a number of potential mutations, together with sequence artifacts, compressions and differences in peak intensities that must be rechecked with additional primers and costs FALSE NEGATIVE (sensitivity) –loss of information farther away or closer to the primer –does not detect a minority of mutant molecules in a wild-type environment Current mutation scanning techniques SSCP (single strand conformation polymorphism) HA (heteroduplex analysis) CCM (chemical cleavage of mismatch) CSGE (conformation sensitive gel electrophoresis) DGGE (denaturing gradient gel electrophoresis) DHPLC (denaturing HPLC) PTT (protein truncation test) DGCE (denaturing gradient capillary electrophoresis) direct sequencing SSCP Mutation detection by heteroduplex analysis: the mutant DNA must first be hybridized with the wild-type DNA to form a mixture of two homoduplexes and two heteroduplexes Heteroduplex analysis DHPLC denaturing HPLC from Transgenomic DHPLC analysis at different temperatures of the column Analysis of dystrophin exon 59 3.88 0.49 2.5 Homoduplex DNA: PCR fragments are identicals 6.41 2.0 Intensity (mV) 1.5 1.0 0.5 0.0 0 1 2 3 4 5 Time 6 8 6.39 Heteroduplex DNA: PCR fragments are different 3.65 3.85 1.5 Intensity (mV) 7 (min) 0.49 Retention 1.0 0.5 0.0 0 1 2 3 4 Retention 5 Time (min) 6 7 8 DHPLC analysis of the CAPN3 gene (exon 11) UV 2 0 1:2 FLUO 100 0 1:4 1:6 1:8 1:10 PLATE B PLATE A POOLED PLATES A+B DHPLC analysis c.3285_3288 del CAGT c.2880_2884 del CAAAC stop splicing c.3336 del G c.4100 delA frame-shift c.2302 C>T R768X missense c.4326 delG Q1564X c.2125 C>T Q709X R1577X c.1482 delG c.3464_3471 del GTTTGGAG c.1332-9 A>G R3370X c.5091del G c.1292 G>A W431X c.9926_9929 ins AAGC S805X c.1300_1310 del CTCAGGGTAGC c.6353 delA c.1180 del G c.8732 insA c.5690 ins A c.713_714 delTT C3337Y E1925X c.530+1 G>A c.9429_9430 del GC c.583 C>T R195X c.8391-2 A>G R1967X c.94-1G>A S2008X c.401_404 del CCAA Q242X Q1737X S622X c.6980 delA E3277X c.7006 C>T Q2336X Y3158X Q986X R1314X c.433 C>T R145X c.1062 G>A W354X Q1087X K105X c.1390 del C c.1603 delGTAinsCT 9563+1 A>G c.4119 del G c.8668+3 A>T R1844X R2982X c.4871_4872 del AG R1666X Q1373X R2905X c.10223+1 G>A c.9204_9207 del CAAA 3367 del E PTT protein truncation test Sensitivity 1000-bp fragment > 85% Detects only nonsense mutations Post PCR time: 48-72 hours (translation/trascription, gel preparation, loading and run, analysis of results) Use of 35S radioactivity No special equipment required mRNA as starting template Applications of PTT (% of truncating mutations) Polycystic Kidney Disease PKD1 95% Familial Adenomatous Polyposis APC 95% Ataxia telangiectasia ATM 90% Hereditary breast and ovarian cancer BRCA1-2 90% Duchenne Muscular Dystrophy DMD 90%? Fanconi anemia FAA 80% Hereditary non-polyposis colorectal cancer hMSH1-2 70%80% Neurofibromatosis type 2 NF2 65% Hunter Syndrome IDS 50% Neurofibromatosis type 1 NF1 50% Cystic Fibrosis CFTR 15% Molecular inversion probe (MIP) genotyping •MIP genotyping uses circularizable probes with 5′ and 3′ ends that anneal upstream and downstream of the SNP site leaving a 1 bp gap •Polymerase extension with dNTPs and a non-stranddisplacing polymerase is used to fill in the gap •Ligation seals the nick, and exonuclease I is used to remove excess unannealed and unligated circular probes •The resultant product is PCR-amplified and the orientation of the primers ensures that only circularized probes will be amplified •The resultant product is hybridized and read out on an array of universal-capture probes GoldenGate genotyping assay GoldenGate uses extension ligation between annealed locus-specific oligos (LSOs) and allelespecific oligos (ASOs) An allele-specific primer extension step is used to preferentially extend the correctly matched ASO (at the 3′ end) up to the 5′ end of the LSO primer Ligation then closes the nick GoldenGate genotyping assay A subsequent PCR amplification step is used to amplify the appropriate product using common primers to ‘built-in’ universal PCR sites in the ASO and LSO sequences The resultant PCR products are hybridized and read out on an array of universal-capture probes 454 technology: DNA fragmentation and adaptor ligation 454 technology: a water-in-oil emulsion is created: a single molecule of DNA with a single bead 454 technology: Beads with clones are selected and assembled onto a planar substrate 454 technology: Sequencing by synthesis pyrosequencing Up to 100 Million bp in 8 hours can be read Ambiguities arise for homopolymeric tracts 7.4 x coverage 234 runs 24.5 billions bp 11 genetic diseases !! NimbleGen sequence capture