Download DNA Technology ppt 2014

DNA Technology
Genetic
Engineering
DNA Technology
DNA Technology – science involved
in the ability to manipulate
genes/DNA
 Purpose:

◦ Cure disease (Cystic Fibrosis)
◦ Treat genetic disorders (Hemophilia,
diabetes)
◦ Improve food crops (better tasting,
longer shelf life, fungus resistance…)
◦ Improve human life in general
◦ Helps us ID genes for traits
I. How could you get a desired trait without
directly manipulating the organisms’ DNA?
A. Selective Breeding
- choosing organisms with desired
traits to produce the next generation
 Breeding the winners of a horse race
(Smarty Jones)
 Taking the seeds from the
Great Pumpkin

B. Hybridization

Crossing organisms with different
traits to produce a hardier product
Ex. A mule is a cross of a horse and a
donkey – Sturdy and surefooted
Hybrid corn – tastes good and is more
resistant to disease.
C. Inbreeding
Maintaining the present genes by
breeding only within the population
 Ex. Pedigree animals
 Risk with dipping into the same gene
pool and recessive traits showing
up that may be lethal or harmful.

D. Inducing mutations
By using known mutagens, attempt to
force mutations to occur
 Radiation & Chemicals
 Not a sure bet nor do you know what
you are going to get
 Polyploidy (3N or 4N) plants have
resulted from this – larger & hardier
II. Manipulating Genes by altering an
organisms DNA
DNA Technology Purpose
 Cure Diseases
 Treat Genetic Disorder
 Improve Food Crop
 Improve Human Life (reproduce
desired traits)
III. Practical Uses of DNA Technology
(positive)






Pharmacutical Products
Genetically engineered vaccine
Increasing Agricultural Yields
 (negative)
Allergies
GMO (genetically Modified
Organisms)
Supperweeds
Cloning
Growing a population of genetically identical
cells from a single cell



Let’s discuss the positives and negatives of m
cloning…..
 Let’s do a little research first……


Lab Bio: Read Pros and Cons of Cloning
Honors Bio: Read The Real Face of Cloning
DNA Technology:
ex: Gene Therapy
Treatment of a genetic disorder (like
cystic fibrous) by correcting a
defective gene that causes a
deficiency of an enzyme.
 Nasal spray that carries normal
enzyme gene. Body makes enzyme
and patient breathes normally.
Regular treatments necessary
 Has not been proven to be successful
in the long term

How do we copy a piece of DNA…..
The Tools:
 DNA Extraction – Chemical procedure
(we’ll do this)
 Restriction enzymes – molecular
scissors that cut DNA at specific
nucleotide sequences
 Gel Electrophoresis – method to
analyze fragments of DNA cut by
restriction enzymes through a gel
made of agarose (molecular sieve)
 DNA Ligase – molecular glue that puts
pieces of DNA together
 Polymerase Chain Reaction (PCR)molecular copy machine. Makes
millions of copies of DNA/hr
Let’s suppose that you are a diabetic
and can not make your own insulin.
What are you to do?
Inject insulin of course but from what
source?
 Old method was to use sheep insulin.
Costly and labor intensive
 New method: Let bacteria with a
human insulin producing gene make
it for you

The Method:
 Transformation of a
bacterium to produce human
insulin
1. Extract the insulin
producing gene from a
healthy human
2. Using a restriction
enzyme, cut the insulin
producing gene out of a the
DNA
What are restriction enzymes?
Bacterial enzymes – used to cut
bacteriophage DNA (viruses that
invade bacteria).
 Different bacterial strains express
different restriction enzymes
 Restriction enzymes recognize a
specific short nucleotide sequence
 For example, Eco RI recognizes the
sequence:

 5’ - G A A T T C - 3’
 3’ - C T T A A G - 5’
 Pandindrones same base pairing forward and
backwards
Let’s try some cutting:

Using this piece of DNA, cut it with Eco RI
 G/AATTC




GACCGAATTCAGTTAATTCGAATTC
CTGGCTTAAGTCAATTAAGCTTAAG
GACCG/AATTCAGTTAATTCG/AATTC
CTGGCTTAA/GTCAATTAAGCTTAA/G
What results is:
GACCG AATTCAGTTAATTCG AATTC
 CTGGCTTAA
GTCAATTAAGCTTAA G

Sticky end
Sticky end - tails
of DNA – easily
bind to other
DNA strands
Blunt & Sticky ends

Sticky ends – Creates an overhang. EcoRI

Blunts- Enzymes that cut at precisely
opposite sites without overhangs. SmaI is
an example of an enzyme that generates
blunt ends
Cloning vector is a carrier that is used to clone a
gene and transfer it from one organism to another.
 Many bacteria contain a cloning vector called a
PLASMID.
 PLASMID  is a ring of DNA found in a bacterium
in addition to its main chromosome

Cloning Vectors
3. Cut cloning vector:

Use bacterial plasmids
◦ Plasmids will be cut with the
same restriction enzyme used
to cut the desired gene



4. Ligation - Donor gene (desired gene)
is then spliced or annealed into the
plasmid
using DNA ligase as the glue.
Recombinant DNA - DNA with new
piece of genetic information on it
5. Plasmid is then returned to
bacterium and reproduces with donor
gene in it.
Transgenic organism – organism with
foreign DNA incorporated in its
genome (genes)
6. Bacterium reproduces and starts
producing human insulin gene which we
harvest from them.
Recombinant DNA
Donor Gene
Sometimes PROMOTERS must also be
transferred so the genes will be turned
on.
Genes are often turned off until the
proteins they code for are needed.
Expression of Cloned Genes