Download Chapter 17 From Gene to Protein

Chapter 17 From Gene to Protein
Transcription
Name for the process to change the DNA into a single stranded,
new form (RNA) that can carry the same information that was in
the DNA.
The end product is RNA-ribonucleic acid- and there are three forms of RNA
rRNA
tRNA
mRNA
All three forms have some features in common
-both single strand and double strand forms
-ribose for the sugar in the nucleotide instead of deoxyribose
-PO4
-nucleic acids or bases, A, G, C and a new player U for uracil
which base does U pair with???
-all made from DNA just different areas
See Fig. ____ on pg ____ it is very good and just like replication, the RNA polymerase
can only read DNA from 3’ to 5’ and synthesize RNA from5’ to 3’.
promoters
transcription bubble
terminators
Post-transcriptional modification-Eukaryotes only
1. 5’ cap
2. polyA tail
3. splicing
introns
exons
Translation- cellular process that converts the mRNA
codons into amino acids to build proteins.
First let’s practice reading the mRNA into amino acids and then I will outline the process
of how it’s done step by step. Look at the sequence of mRNA below and the chart in Fig.
___ on page _____.
5’ AUGCCUAAAGGCGCUGUAUUUCGAAUAUGA 3’
Next let’s look at the transfer RNA(tRNA) :
It is a cloverleaf, double stranded is some places with three loops, the bottom
loop has three bases called the anticodon. These three bases (the anticodon) is the
mechanism for the correct tRNA to pair with the mRNA in the ribosome.
At the top (3’ end) there is an amino acid attached to the tRNA
Think of the tRNA as a translator, it is the molecule that knows two languages the
mRNA language and the amino acid language.
The ribosome is the location for protein synthesis, as we learned in Chapter 4, it has two
subunits a large and a small. It is made of protein and ribosomal RNA
Let’s write the steps first then draw a picture.....
1. mRNA binds to the small subunit of the ribosome, the first tRNA with the
complementary anticodon to the mRNA binds to the mRNA. The large subunit binds to
this complex. There are three spaces, sites, holes in the large subunit (E,P,A). The first
tRNA fills the P site
2. The second tRNA with the complementary anticodon to the mRNA codon fills the A
site.
3. A peptide bond is formed between the first amino acid and the second amino acid.
4. The ribosome moves over( translocates) so that the first tRNA is now in the E site and
is empty(no a.a.), the second tRNA with the growing a.a. chain is in the P site and the A
site is open/available
5. Go back to step 2 and repeat until a stop codon is reached, then the peptide, now a
polypeptide on its way to folding into a functional protein is released and the ribosome
dissociates.
Mutation
Any change to the DNA, most have little to no immediate effect Why?
Point mutations
Base substitution
misssense
\ nonsense
Frame shift mutations-shift in the reading frame, shortened protein or
nonfunctional protein