Download Energy Unit SG Key

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project

Document related concepts

Cre-Lox recombination wikipedia , lookup

Non-coding DNA wikipedia , lookup

Peptide synthesis wikipedia , lookup

RNA interference wikipedia , lookup

Replisome wikipedia , lookup

Western blot wikipedia , lookup

Protein (nutrient) wikipedia , lookup

SR protein wikipedia , lookup

Eukaryotic transcription wikipedia , lookup

RNA silencing wikipedia , lookup

Protein adsorption wikipedia , lookup

Molecular evolution wikipedia , lookup

RNA polymerase II holoenzyme wikipedia , lookup

Endomembrane system wikipedia , lookup

Bottromycin wikipedia , lookup

Protein wikipedia , lookup

Silencer (genetics) wikipedia , lookup

Transcriptional regulation wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

RNA-Seq wikipedia , lookup

Protein structure prediction wikipedia , lookup

Cell-penetrating peptide wikipedia , lookup

Proteolysis wikipedia , lookup

Metabolism wikipedia , lookup

Point mutation wikipedia , lookup

Polyadenylation wikipedia , lookup

List of types of proteins wikipedia , lookup

Amino acid synthesis wikipedia , lookup

RNA wikipedia , lookup

Deoxyribozyme wikipedia , lookup

Non-coding RNA wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Gene expression wikipedia , lookup

Biochemistry wikipedia , lookup

Transfer RNA wikipedia , lookup

Messenger RNA wikipedia , lookup

Ribosome wikipedia , lookup

Expanded genetic code wikipedia , lookup

Genetic code wikipedia , lookup

Epitranscriptome wikipedia , lookup

Transcript
Ribonucleic Acid
Proteins
Protein synthesis
Transcription
translation
During transcription, RNA polymerase unwinds the DNA and adds in the
complementary nucleotides to make a single stranded piece of mRNA.
Ligase helps the DNA strand close and the mRNA moves out of the nucleus.
During translation, a ribosome attaches to the mRNA at the start codon (AUG).
The codons on the mRNA match with the complementary anti-codons on
tRNA molecules, which carry the amino acids. The amino acids at strung together
forming a polypeptide.
Insulin is a hormone that carries a signal from cell-to-cell, telling the
body to absorb glucose out of the blood.
To maintain the integrity of the DNA, and so that multiple proteins can
be made at once (from multiple mRNA molecules).
mRNA
ribose
uracil
3
Unwinds the DNA double helix and adds in complementary RNA nucleotides.
uracil
3 nucleotides in a row on a strand of mRNA that code for an amino acid
Only mRNA
The structure and function of a protein is determined by the order of the
amino acids and their chemical properties.
The genetic code is the set of “rules” or code that allows us to transfer
a DNA sequence into a protein.
64
20
amino acid
The same base pair rules and codon table can be used to transcribe and
translate proteins for all living organisms.
out of the nucleus (cytoplasm)
3
Ribosome (made of rRNA)
rRNA stands for ribosomal RNA. This RNA makes up the ribosome and
is the place where mRNA is translated into a protein.
tRNA stands for transfer RNA. This RNA has an anti-codon on one end
and the amino acid on the other. tRNA matches its anti-codon with the
codon on the mRNA during translation, “dropping off” the correct
amino acid at the ribosome.
A 3-nucleotide sequence on tRNA that is complementary to the codon.
The anti-codon “tells” the tRNA where to take its amino acid, just like an
address “tells” the mailman where to take the envelope.
A stop codon (UAA, UAG, UGA)
4
6
3
5
2
Endomembrane system
Ribosomes made by the rough ER are either excreted out of the
cell, imbedded into the cell membrane, or left inside a vesicle to
become a lysosome.
nucleolus
Bound ribosome
Nucleus/nuclear membrane
Rough ER
Smooth ER
Vesicle
Golgi complex
Lysosome
Cell membrane
AUGGGGCUACGAUUAGUCCUGAGG
Met - Gly - Leu – Arg – Leu – Val – Leu – Arg
AAA, AAG
Substrate
Active site
Enzyme
Products