Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Exons and Introns
Document related concepts
Expression vector wikipedia , lookup
Signal transduction wikipedia , lookup
Polyadenylation wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Metalloprotein wikipedia , lookup
Biochemistry wikipedia , lookup
Interactome wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Biosynthesis wikipedia , lookup
Western blot wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Genetic code wikipedia , lookup
Gene regulatory network wikipedia , lookup
Protein–protein interaction wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Point mutation wikipedia , lookup
Messenger RNA wikipedia , lookup
Non-coding DNA wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Proteolysis wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Epitranscriptome wikipedia , lookup
Transcript
Exons and Introns Chesley Leslin Steps in Production Proteins • exons: the sequences in the DNA molecule that code for the amino acid sequences of corresponding proteins. • intron: the DNA sequence in a eukaryotic gene that is not translated into a protein. • Transcription – DNA – preRNA - mRNA • Translation – mRNA - Proteins What do we need for transcription? 1.DNA In eukaryotes, the genome is divided into : •Non-coding areas... between genes. •Genes : Each gene is divided into several exons, separated by non coding sequences, •Introns (not coding) •Exons (coding) •Promoters, and regulation sequences. 2.RNA polymerases RNA polymerases are enzymes that will synthesize different kinds of RNA. 3.Other factors E.g. factor sigma: this stabilizes the polymerase at its specific site, to help polymerization to start. These other factors may be proteins or other kinds of molecules Translation mRNA UUUCUCAUUACUUAUUGUCGA now becomes Phe Leu Ile Thr Tyr Cys Arg Degenerate genetic code*….what? T C A G TTT TTC TTA TTG Phe Phe Leu Leu (F) (F) (L) (L) TCT TCC TCA TCG Ser Ser Ser Ser (S) (S) (S) (S) TAT TAC TAA TAG Tyr (Y) Tyr (Y) Ter Ter TGT Cys (C) TGC Cys (C) TGA Ter TGG Trp (W) C CTT CTC CTA CTG Leu Leu Leu Leu (L) (L) (L) (L) CCT CCC CCA CCG Pro Pro Pro Pro (P) (P) (P) (P) CAT CAC CAA CAG His His Gln Gln (H) (H) (Q) (Q) CGT CGC CGA CGG Arg Arg Arg Arg (R) (R) (R) (R) A ATT ATC ATA ATG Ile Ile Ile Met (I) (I) (I) (M) ACT ACC ACA ACG Thr Thr Thr Thr (T) (T) (T) (T) AAT AAC AAA AAG Asn Asn Lys Lys (N) (N) (K) (K) AGT AGC AGA AGG Ser Ser Arg Arg (S) (S) (R) (R) G GTT GTC GTA GTG Val Val Val Val (V) (V) (V) (V) GCT GCC GCA GCG Ala Ala Ala Ala (A) (A) (A) (A) GAT GAC GAA GAG Asp Asp Glu Glu (D) (D) (E) (E) GGT GGC GGA GGG Gly Gly Gly Gly (G) (G) (G) (G) T mRNA 1). Initiation Codon Anti – Condon 2). Elongation Amino Acid tRNA 3). Termination RESEARCH……… We are interested in the evolution of the intron/exon structure of genes. Are the introns ancient structures, used to assemble the first genes four billion years ago? Or are they more recent acquisitions, used for exon shuffling in recently evolved proteins? Our work ranges from theoretical estimates for the size of the universe of exons to theoretical arguments that the introns are very old and that exons are related to folding subunits of proteins. We are studying the assembling of protein shapes from modular substructures. Protein Encoding Exon Containing Genes • Based on current GenBank release 133 • 128,000 proteins – lots of info – Have positions of Introns boundaries in proteins – Have structural data from PDB – Have ability to visualize structure • • • • Can we correlate boundaries to structure? Are boundaries conserved b/t species? Were there ancient exons? Alternative Splicing?
