Download transcription/translation game

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Catalytic triad wikipedia, lookup

Gel electrophoresis of nucleic acids wikipedia, lookup

Community fingerprinting wikipedia, lookup

Bisulfite sequencing wikipedia, lookup

DNA supercoil wikipedia, lookup

Silencer (genetics) wikipedia, lookup

Metalloprotein wikipedia, lookup

Transcriptional regulation wikipedia, lookup

Ribosomally synthesized and post-translationally modified peptides wikipedia, lookup

Non-coding DNA wikipedia, lookup

Gene expression wikipedia, lookup

Metabolism wikipedia, lookup

Gene wikipedia, lookup

Hepoxilin wikipedia, lookup

Peptide synthesis wikipedia, lookup

Artificial gene synthesis wikipedia, lookup

Protein structure prediction wikipedia, lookup

Messenger RNA wikipedia, lookup

Epitranscriptome wikipedia, lookup

Deoxyribozyme wikipedia, lookup

Biochemistry wikipedia, lookup

Nucleic acid analogue wikipedia, lookup

Point mutation wikipedia, lookup

Amino acid synthesis wikipedia, lookup

Genetic code wikipedia, lookup

Biosynthesis wikipedia, lookup

Transcript
TRANSCRIPTION/TRANSLATION GAME
Gene sequence:
CTTGAAACTTCATAAACGGCACTGAAATAG
mRNA sequence:
GAACUUUGAAGUAUUUGCCGUGACUUUAUC
tRNAs:
cuu gaa acu uca uaa acg gca cug aaa aug
Amino Acids:
Leu Glu Thr Ser STOP Thr Ala Leu Lys STOP
Amino Acid (1 letter):
LETS_TALK_
Concept
DNA transcription to messenger RNA (mRNA) and its subsequent translation into an
amino acid polymer (peptide or protein).
DNA is transcribed into mRNA using the A-T/G-C pairing (but substituting uracil (U) for
thiamine (T)). The mRNA is then translated into a peptide sequence using transfer RNA
(tRNA) that donates a particular amino acid to the chain. By using the single amino acid
codes, words can be made.
The Game
Students are given a DNA sequence and have to go through the steps of transcription
and translation in order to “decode” the secret message. Several examples can be
done in small groups. Then they can try it in reverse (come up with a word and then go
through the process backwards to get the DNA sequence). Students can then send
their DNA sequence to another group to decode. Point out why they can’t use the
letters J, O, U and X (no amino acids have these letters as their 1 letter abbreviation).
Students may notice the similarity between the DNA and tRNA sequence and take the
short cut.
Extension
You can show how mutations in DNA can “mess up” the message. They will probably
have made these kinds of mistakes themselves during the game, either by misreading
sequences or accidentally adding/deleting letters. Use this to discuss missense
mutations (substitution of one base for another, resulting in a codon for a different
amino acid), silent mutations (substitution of one base for another, resulting in a codon
that codes for the same amino acid), nonsense mutations (accidental addition of a stop
codon) and frameshift mutations (addition or deletion of 1 or 2 bases, resulting in a
change in the reading frame).
GENETIC CODE
C
A
G
G
Cys
Cys
STOP
Trp
Arg
Arg
Arg
Arg
Ser
Ser
Arg
Arg
GGT
GGC
GGA
GGG
T
C
A
G
T
C
A
G
T
C
A
G
T
C
A
G
Third Position of Codon
First Position of Codon
T
Second Position of Codon
T
C
A
Phe
Ser
Tyr
Phe
Ser
Tyr
Leu
Ser
STOP
Leu
Ser
STOP
Leu
Pro
His
Leu
Pro
His
Leu
Pro
Gln
Leu
Pro
Gln
Ile
Thr
Asn
Ile
Thr
Asn
Ile
Thr
Lys
Met
Thr
Lys
Val
Ala
Asp
Val
Ala
Asp
Val
Ala
Glu
Val
Ala
Glu
AMINO ACID ABBREVIATIONS
One Letter
A
B
C
D
E
F
G
H
I
K
L
M
N
P
Q
R
S
T
V
W
Y
Z
Three Letters
Ala
Asx
Cys
Asp
Glu
Phe
Gly
His
Ile
Lys
Leu
Met
Asn
Pro
Gln
Arg
Ser
Thr
Val
Trp
Tyr
Glx
Amino Acid
alanine
asparagine or aspartate
cysteine
aspartate
glutamate
phenylalanine
glycine
histidine
isoleucine
lysine
leucine
methionine
asparagine
proline
glutamine
arginine
serine
threonine
valine
tryptophan
tyrosine
glutamine or glutamate